ID: 1181680648

View in Genome Browser
Species Human (GRCh38)
Location 22:24494246-24494268
Sequence TTCTCAATAGGACCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181680638_1181680648 16 Left 1181680638 22:24494207-24494229 CCGGCTGCCCGCCGAAGTAAGCG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1181680641_1181680648 9 Left 1181680641 22:24494214-24494236 CCCGCCGAAGTAAGCGGGCCTTA 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1181680643_1181680648 5 Left 1181680643 22:24494218-24494240 CCGAAGTAAGCGGGCCTTACTGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1181680637_1181680648 17 Left 1181680637 22:24494206-24494228 CCCGGCTGCCCGCCGAAGTAAGC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1181680636_1181680648 23 Left 1181680636 22:24494200-24494222 CCTTCACCCGGCTGCCCGCCGAA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1181680644_1181680648 -9 Left 1181680644 22:24494232-24494254 CCTTACTGCCCTAATTCTCAATA 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1181680642_1181680648 8 Left 1181680642 22:24494215-24494237 CCGCCGAAGTAAGCGGGCCTTAC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181680648 Original CRISPR TTCTCAATAGGACCCCAAAG AGG Intronic
904453958 1:30635822-30635844 TCCTCAACAGATCCCCAAAGAGG + Intergenic
906588080 1:46997983-46998005 TTCTCAAAAGGACATAAAAGTGG - Intergenic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
916124129 1:161554233-161554255 TCCTTAATAGTGCCCCAAAGTGG - Intergenic
916134013 1:161635593-161635615 TCCTTAATAGTGCCCCAAAGTGG - Intronic
920750302 1:208668477-208668499 TTGTTAATAGGAGCTCAAAGTGG - Intergenic
921289326 1:213641721-213641743 TTCTGAATAGGAGACCAAAATGG - Intergenic
921427750 1:215023918-215023940 TTGTCATTAGGACACAAAAGAGG + Intronic
923546865 1:234929571-234929593 TTATCAAAGGGACCCCAGAGAGG + Intergenic
1063433204 10:6008989-6009011 TTCTCGATAGAATACCAAAGTGG + Intergenic
1067123709 10:43497320-43497342 TTCTGATTTTGACCCCAAAGGGG - Intergenic
1067892963 10:50151944-50151966 TTCTCATTAGAACCCCACTGAGG - Intergenic
1068293869 10:55041612-55041634 TTCTAAATAGGACAGCAAGGGGG + Intronic
1069599191 10:69692595-69692617 TTCTAAAAAGAACCCCATAGGGG - Intergenic
1074689490 10:115991495-115991517 TTCTTAATATCACCACAAAGGGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079940430 11:26673517-26673539 TTGTTAATAGGTCGCCAAAGAGG - Exonic
1080870384 11:36231712-36231734 ATATAAATAGGACACCAAAGCGG + Exonic
1082229750 11:49748689-49748711 TTGTGAATAGGACCCAAAATTGG - Intergenic
1084558800 11:69891183-69891205 TTCTCAATAGCCCCACAAAGGGG + Intergenic
1084650464 11:70486584-70486606 GTCTCAACAGGGACCCAAAGGGG - Intronic
1085253295 11:75157677-75157699 TCCTCTATACGACCTCAAAGAGG - Intronic
1086620328 11:88880434-88880456 TTGTGAATAGGACCCCAAATTGG + Intronic
1089431816 11:118431154-118431176 TTCTCCAAAGGGCCCCCAAGTGG - Intronic
1089838825 11:121395955-121395977 ATAACAATAGGACACCAAAGGGG + Intergenic
1092169254 12:6363207-6363229 TTCTACATAGGACCCCAGGGAGG + Intronic
1097623753 12:61974380-61974402 TTTTCAACAGGACCAAAAAGTGG - Intronic
1102237784 12:111305078-111305100 ATGACACTAGGACCCCAAAGAGG - Intronic
1102775723 12:115516966-115516988 TTCTCAATGGGTCCCCAGGGAGG - Intergenic
1104652478 12:130546055-130546077 TGCTCAATGAGATCCCAAAGGGG - Intronic
1105658927 13:22471375-22471397 TTCTAAAGATGAACCCAAAGGGG - Intergenic
1106534165 13:30624182-30624204 TTCTCCAGAGGACACCAAATGGG - Intronic
1107142586 13:37018043-37018065 TTCTCCTAAGGACCTCAAAGTGG - Intronic
1108143214 13:47448455-47448477 TTCTCCATAGGAGACTAAAGAGG - Intergenic
1109938833 13:69331994-69332016 TTCTAAATAGTGCCACAAAGAGG - Intergenic
1110397940 13:75053735-75053757 GTGTCAATAGGCCCTCAAAGAGG + Intergenic
1110714043 13:78681747-78681769 TTCTTAATAGGACTCTACAGAGG + Intergenic
1113160162 13:107370922-107370944 TTCTCAAGAGGACATCATAGAGG + Intronic
1115449702 14:33532397-33532419 TGCTGAAGAGAACCCCAAAGAGG - Intronic
1118192719 14:63594840-63594862 GTCTCAGCAGGACCTCAAAGAGG + Intergenic
1118383561 14:65237385-65237407 CTCTCAATAGGATCCCACTGGGG - Intergenic
1119080468 14:71688581-71688603 TTCTCAGTAGGACTACAAAGGGG - Intronic
1127562189 15:60150479-60150501 TTGTCAAAATGACACCAAAGGGG + Intergenic
1129827330 15:78642245-78642267 TTCTCCAAAGCATCCCAAAGGGG - Intronic
1202949926 15_KI270727v1_random:24807-24829 TTCTCAATAGGATCTCACAATGG + Intergenic
1137252943 16:46753178-46753200 TTCCCTGTAGGACCCCAGAGAGG + Intronic
1140252632 16:73307617-73307639 TTCTCAAGAGGAACCCAGCGAGG + Intergenic
1143896992 17:10144183-10144205 CTTTGAACAGGACCCCAAAGGGG - Intronic
1147358441 17:39915989-39916011 CTCTCACTTGGAGCCCAAAGTGG - Intronic
1148105164 17:45114973-45114995 AGGTCAAGAGGACCCCAAAGAGG - Intronic
1148567752 17:48643555-48643577 TTCTCAAGAAGATGCCAAAGTGG - Intergenic
1148850223 17:50550988-50551010 TTCTCCTCAGGACCCCAAGGGGG + Exonic
1149685261 17:58531402-58531424 TTCCCAAAGGGACCCCAGAGAGG - Intronic
1150017497 17:61573058-61573080 TTCCTTATAGGACCCCCAAGAGG - Intergenic
1151967670 17:77439843-77439865 TTCTTAATGAGTCCCCAAAGAGG - Intronic
1152170940 17:78747815-78747837 TTTTCATAAGAACCCCAAAGTGG - Intronic
1153982459 18:10321860-10321882 TTCTCATCAGGACCAGAAAGGGG - Intergenic
1157988362 18:52465561-52465583 TTCACAATAGATCCCCAAAGAGG + Intronic
1158260944 18:55605031-55605053 TCCTCAACAGGACCCCAGTGAGG - Intronic
1160301633 18:77687032-77687054 TTCTCAAGAGGAACCCAATTTGG - Intergenic
1161124043 19:2546116-2546138 TTCTCACCAGGACGCCAAAGAGG + Intronic
1164054229 19:21608298-21608320 TGCTGTATAGGACCCAAAAGAGG + Intergenic
1166645285 19:44526997-44527019 TTCTCAAAAGGGCCCCAATGTGG + Intronic
1168291119 19:55358246-55358268 TTCTGAAGACGACCCCACAGTGG + Exonic
926634398 2:15164731-15164753 TTCTCAATACCAGCACAAAGAGG + Intergenic
933638142 2:84729489-84729511 TTCTCAACAGAAACTCAAAGAGG + Intronic
935115211 2:100129487-100129509 TACTCTCTAGGAACCCAAAGGGG + Intronic
939389011 2:141542845-141542867 TTTTCAATAGGACTGCAAATAGG - Intronic
941652013 2:168102084-168102106 TTATCCATAGTAGCCCAAAGTGG - Intronic
1168857228 20:1017089-1017111 GTCTCAAGAGGACCTCAATGGGG + Intergenic
1169700749 20:8443883-8443905 GTCACAATAGCACCCCACAGTGG + Intronic
1170901758 20:20470182-20470204 TTCTCAAAAAGACCCCCAAAGGG + Intronic
1172969630 20:38863905-38863927 TTCTCACAATCACCCCAAAGTGG + Intronic
1173101026 20:40088760-40088782 TTCTCACTAGGACTCCAGTGAGG + Intergenic
1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG + Intronic
1184410250 22:44322158-44322180 TTCTCACTAGGAGCTCAGAGAGG - Intergenic
1185064247 22:48622817-48622839 CTGTCAACAGGACTCCAAAGAGG - Intronic
950883192 3:16339649-16339671 TTTTCTAGAGGACCCCAAATAGG - Intronic
952638358 3:35558770-35558792 TTGCCAAAAGGACCCCAAATAGG + Intergenic
953461056 3:43081439-43081461 ATCTCATTAGGGCCCCACAGTGG - Exonic
953575821 3:44112394-44112416 TTCTCGACAGAACCACAAAGTGG + Intergenic
956691854 3:71885811-71885833 TTCTCAATAGAACCCCATGGTGG + Intergenic
957944853 3:87051022-87051044 TTCTGAAAAGGATACCAAAGTGG - Intergenic
958218760 3:90631767-90631789 TTCTAAAGAAGACCACAAAGAGG + Intergenic
960380238 3:116951303-116951325 TACTAAAAAGGTCCCCAAAGTGG - Intronic
962108733 3:132419539-132419561 TTCTCAATAGGTCCCAAATTAGG + Intronic
962807197 3:138936273-138936295 TTCTCACTGGGTCCCCAGAGTGG - Intergenic
962898794 3:139738826-139738848 TTCTCAACTGGAGCCCAAAGAGG - Intergenic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
969298475 4:6283230-6283252 TTCTCCATAGAACCTCACAGAGG + Intronic
971240731 4:24886517-24886539 TTCTCAATAGCACTTCCAAGTGG - Intronic
973893668 4:55391941-55391963 TTTTCAATAGAACCCTAGAGTGG + Intergenic
981737503 4:147968217-147968239 TTCTCAATAGGACCACCTTGAGG + Intronic
987947706 5:24633902-24633924 TTCTCAACATGACCACAAGGTGG + Intronic
988862828 5:35302472-35302494 TTTTCTATAGGCCCCTAAAGAGG + Intergenic
993772059 5:91940723-91940745 TTTTCAAAAGGACCCAAGAGCGG + Intergenic
993942710 5:94079879-94079901 TTTTTAATAGGTCCCCAAATTGG + Intronic
998721043 5:144949490-144949512 TTCTCATTAAAACCCTAAAGAGG - Intergenic
999586719 5:153097271-153097293 TTCTCAAGAGGATGACAAAGTGG - Intergenic
1007052799 6:38849830-38849852 AGCTCAATAGTACCCCAAGGCGG - Intronic
1008059307 6:46980288-46980310 TCCTCCATAGAAACCCAAAGTGG + Intergenic
1012173266 6:96046160-96046182 TTTTAACTAGGACCCAAAAGGGG + Intronic
1012927508 6:105282339-105282361 TTGTGGATAGGACCACAAAGTGG - Intronic
1013068500 6:106706387-106706409 TTCTCAAAATTACCCCAAAATGG + Intergenic
1017344178 6:153360243-153360265 TTCAAAATAGTACCCCAACGTGG - Intergenic
1018251270 6:161872910-161872932 TTCACAATTGGACCCAAAATTGG - Intronic
1020709172 7:11584640-11584662 TTTTCAATAGAACCCCAGATAGG - Intronic
1021105770 7:16638158-16638180 TTCTCCATTGGACACCAATGGGG + Intronic
1021205344 7:17773383-17773405 TTCTAAATAGGAGACCAAAGGGG + Intergenic
1028895993 7:96042696-96042718 TTCTCCATAGGTGGCCAAAGAGG - Intronic
1035396279 7:158537073-158537095 TTCTCACTGGGACCTCACAGGGG - Intronic
1038218118 8:25581679-25581701 TTCCCAAGAGGAGCACAAAGGGG - Intergenic
1038516767 8:28194018-28194040 GTCTGAATAGGACCCCGGAGTGG + Intergenic
1038652698 8:29420142-29420164 TCATCAATAGGACCATAAAGAGG + Intergenic
1039936293 8:42049206-42049228 TTCTCAATAGCACCACACATGGG + Exonic
1042501531 8:69514584-69514606 TTCCCAATAGCCCCCTAAAGTGG + Intronic
1042996444 8:74704609-74704631 TTCTCCTCAGGATCCCAAAGTGG + Intronic
1044835635 8:96292908-96292930 TTCCAAAGAGGACCCAAAAGAGG + Intronic
1045008443 8:97936449-97936471 TTCACATCAGGACCTCAAAGGGG - Intronic
1045917107 8:107485377-107485399 TTCTCCATAGAGACCCAAAGAGG - Intronic
1046143080 8:110120623-110120645 TTCTCAGTAGGACCTGAAAAAGG - Intergenic
1048357791 8:133667627-133667649 TTATCAATATGACCAGAAAGAGG - Intergenic
1049908829 9:245610-245632 CTCTCAATAGCATCCCAAGGAGG + Intronic
1051616381 9:19010814-19010836 TTCTCAATAGGACCACATAAAGG + Intronic
1053189584 9:36051221-36051243 GTCTCAAGAGGACTCCAAAGGGG - Intronic
1054451783 9:65407203-65407225 CTCTCATTAGGACCCCCACGGGG + Intergenic
1055065566 9:72114852-72114874 CTCTCTACAGCACCCCAAAGAGG + Intronic
1055295966 9:74834023-74834045 TTCTCAATGACACCCCAAGGAGG + Exonic
1057945591 9:99325394-99325416 ATCTTAAGAGGTCCCCAAAGAGG + Intergenic
1062720773 9:138042798-138042820 TTCTCTGCAGGACCTCAAAGTGG + Intronic
1188504342 X:30865217-30865239 ATCTCAGTAGCACCCCCAAGTGG + Intronic
1189182679 X:39018463-39018485 TTCTCAATATGTCCCCCATGGGG - Intergenic
1190658348 X:52632781-52632803 TTCATCATAGGACCCAAAAGGGG + Intergenic
1194697895 X:97078346-97078368 CTCTCCATGGGTCCCCAAAGAGG - Intronic
1195576860 X:106461156-106461178 TTCTCACTATTACCACAAAGAGG - Intergenic
1195670351 X:107464571-107464593 TTCTGGAAAGGACCCCTAAGAGG - Intergenic
1196974833 X:121147995-121148017 TTCTTAATAGCACCACAATGGGG - Intergenic
1199340524 X:146671758-146671780 TTCTCCATTGGAGCCAAAAGGGG + Intergenic
1201255728 Y:12106623-12106645 TTCTGAATATTACCACAAAGTGG + Intergenic