ID: 1181683074

View in Genome Browser
Species Human (GRCh38)
Location 22:24509263-24509285
Sequence TCTCCTATGCAGGGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181683074_1181683081 1 Left 1181683074 22:24509263-24509285 CCCTCCATCCCCTGCATAGGAGA No data
Right 1181683081 22:24509287-24509309 TGCTCTGAACTTGGTGTGCATGG 0: 1
1: 0
2: 1
3: 12
4: 179
1181683074_1181683080 -8 Left 1181683074 22:24509263-24509285 CCCTCCATCCCCTGCATAGGAGA No data
Right 1181683080 22:24509278-24509300 ATAGGAGACTGCTCTGAACTTGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181683074 Original CRISPR TCTCCTATGCAGGGGATGGA GGG (reversed) Intronic
No off target data available for this crispr