ID: 1181683649

View in Genome Browser
Species Human (GRCh38)
Location 22:24513999-24514021
Sequence AGTTTCATGTGCCCATGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181683649 Original CRISPR AGTTTCATGTGCCCATGATC AGG Intronic
904859772 1:33527162-33527184 AGTTTCTTGAGCCAATGATCTGG + Intronic
906579966 1:46928179-46928201 AGTTTATTTTGCTCATGATCTGG - Intergenic
910971265 1:92858181-92858203 AGATTCAGGAGCCCAAGATCAGG - Intronic
918987300 1:191649209-191649231 AGTTGCGTGTGCCCATAAACTGG + Intergenic
1067440413 10:46306105-46306127 AGTGGCATGTGCCAATGCTCTGG - Intronic
1067971323 10:50973994-50974016 AGTTTCATGTGTGCATGATGTGG - Intergenic
1068614142 10:59093582-59093604 ATTTTCATGCTCCCATGAGCTGG + Intergenic
1070955631 10:80461580-80461602 AGTGGCATGTGCCCAGGATGGGG + Intronic
1075406682 10:122200140-122200162 TGTTTCATGGGCCCAGGACCAGG + Intronic
1076137334 10:128054305-128054327 AGTATCATGTACCCACCATCCGG + Intronic
1080675036 11:34418312-34418334 AGTTTTATGTGCAGAGGATCTGG - Intergenic
1084701718 11:70790629-70790651 ACTTGCCTGTTCCCATGATCGGG + Intronic
1086329227 11:85736915-85736937 AGTTTCCTTTGACCTTGATCTGG - Intronic
1087505578 11:99016637-99016659 AGATTCATTTGCTCATGACCAGG - Intergenic
1087549198 11:99625871-99625893 AGTCTCATGAGCTCATGATAAGG + Intronic
1088189691 11:107214800-107214822 TGTTTCATGTGGCTATGTTCTGG - Intergenic
1089815356 11:121168152-121168174 ATTTTCATGTGCTTATGAGCTGG + Exonic
1089970838 11:122691915-122691937 AGATCCATCTGCCCAGGATCTGG + Intronic
1092153373 12:6266593-6266615 GGTTTCAGGTGCCCAAGAGCAGG + Intergenic
1096012093 12:48227286-48227308 AGTTCCATGTGCTCATGAATAGG + Intergenic
1102455768 12:113069989-113070011 AGTCTCATGAGCCCATGTTCTGG - Intronic
1107277197 13:38690041-38690063 AGTTTCCTATGCCCATAATGGGG + Exonic
1109863707 13:68233852-68233874 ACTTTGATGTGCCCAGCATCAGG - Intergenic
1110311268 13:74052235-74052257 AGCTCCATGTGCCCATCATTTGG + Intronic
1111632406 13:90859160-90859182 ATTGTCATGGGCCCATTATCTGG - Intergenic
1112787544 13:102967909-102967931 AGATTCATGTGCACATGCTCAGG + Intergenic
1113109859 13:106811678-106811700 AGCTTCATGAGCCCTTGATCTGG - Intergenic
1114382343 14:22220645-22220667 AGTTTCAAATGCCTAGGATCTGG - Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1121396120 14:93624817-93624839 ACTTTCCTGTGTCCATCATCAGG + Intronic
1123694590 15:22869186-22869208 TGTTACCTGTGCCCATGACCTGG - Exonic
1128305860 15:66598603-66598625 AGCTCCATGTGCTCATCATCTGG - Intronic
1128444154 15:67741838-67741860 TGTAAGATGTGCCCATGATCTGG - Intronic
1130103062 15:80908586-80908608 ATCTTCATGAGCCCATGTTCTGG - Intronic
1131311739 15:91296703-91296725 AGGAGCGTGTGCCCATGATCAGG - Exonic
1131311743 15:91296730-91296752 AGGAGCGTGTGCCCATGATCGGG - Exonic
1135652753 16:24221019-24221041 ATTTTCTTGTGCCCCTAATCAGG + Intergenic
1137278356 16:46952978-46953000 AGTCTCATGAGCACATGATTTGG + Intergenic
1137311040 16:47259014-47259036 AGTTTCAAAGGCCCATGATGTGG + Intronic
1138769205 16:59642781-59642803 TGTTTAATGTGCCCATTATTGGG + Intergenic
1144515386 17:15914067-15914089 AGCTGCATGTCCCCATGATTCGG - Intergenic
1145405941 17:22594047-22594069 AGTTTCACGTCATCATGATCAGG + Intergenic
1150743572 17:67798779-67798801 AGTTCCATGGGCCCATGTTTAGG + Intergenic
1152356086 17:79808188-79808210 AGTTTCAAGTCCCCATGCTAGGG + Intergenic
1153755842 18:8282185-8282207 ATTTTCATGTTCCTATCATCTGG - Intronic
1160167199 18:76524418-76524440 AGTTTCAGGTGCCTTTTATCAGG - Intergenic
1161638207 19:5402481-5402503 AGTTTCCTGTGACCACGAACTGG - Intergenic
1164738934 19:30562354-30562376 AGTTTCATATGCCCGTGCACTGG - Intronic
931465604 2:62484132-62484154 AGTTTCATTTCCCAATGATTTGG + Intergenic
932535391 2:72587533-72587555 AGTTTCATGTGGCCACGTGCAGG - Intronic
935516207 2:104042558-104042580 AGTCTCAAATGCCCATGTTCTGG + Intergenic
935984666 2:108661129-108661151 TATTTCATGTACCCATGATGGGG - Intronic
936137101 2:109904777-109904799 TATTTCATGTACCCATGATGGGG - Intergenic
936207596 2:110466708-110466730 TATTTCATGTACCCATGATGGGG + Intronic
939799592 2:146693103-146693125 GTTTTCAAGTGCACATGATCTGG - Intergenic
941685618 2:168445546-168445568 TTTTTCATGTGCCCATGATGTGG - Intergenic
946086991 2:217183745-217183767 AGTTCCATGTGCTCTTGATCTGG - Intergenic
1168819076 20:761438-761460 GGGTTCACGTGCCCATGATCAGG + Intronic
1171308993 20:24130942-24130964 AGTTTCCTGTGGCCAAGATGGGG + Intergenic
1171350971 20:24503025-24503047 AGTTTCAAGGGCCCTTTATCTGG + Intronic
1181458394 22:23072035-23072057 AGTTCCATGACCCCATGAGCTGG + Intronic
1181683649 22:24513999-24514021 AGTTTCATGTGCCCATGATCAGG + Intronic
954616656 3:51972258-51972280 AGTTACATGTGACCATCAGCTGG - Intronic
954926351 3:54238768-54238790 AGTTTAATCTGCCCATGATGGGG + Intronic
955419585 3:58722942-58722964 ACATTCATGAGCACATGATCAGG + Intronic
960677824 3:120214132-120214154 ACTTTCATGTTCCCAACATCTGG - Intronic
963123337 3:141794280-141794302 AGTTTCCAGTGCCCATGGACAGG - Intronic
963342706 3:144056415-144056437 AGTTTAAAATGCACATGATCTGG + Intergenic
963787590 3:149550665-149550687 AGTTTCATGTGCCTAGAATGAGG + Intronic
966234983 3:177690742-177690764 AGTGTCATTTGCCCATAATCAGG + Intergenic
966479108 3:180385292-180385314 AATTTCATTGGCACATGATCTGG + Intergenic
967019021 3:185506287-185506309 AGTTTCATGTAACAGTGATCAGG - Exonic
967858949 3:194137570-194137592 AGTTTCACGGGCGCATGGTCAGG + Intronic
969751296 4:9113279-9113301 AATGTCATGAGCCCACGATCAGG - Intergenic
974036286 4:56821305-56821327 ATTTTCAGGTGCCCAAGATGAGG - Intronic
977045945 4:92069758-92069780 AGTTTCATGTTCCCTAGAGCAGG - Intergenic
979911849 4:126377518-126377540 TATTTCAGGTGCCCATCATCAGG - Intergenic
985627678 5:998324-998346 AGTTTCCTGAACCCATGTTCTGG + Intergenic
995045018 5:107635886-107635908 AGTTTCATTTGCCCACAATCTGG - Intronic
995340042 5:111048293-111048315 AGTTTCATTTTTCCATGTTCGGG - Intergenic
995651104 5:114369487-114369509 AGTTTCATGTACCTATGAGGTGG + Intronic
997820801 5:137063970-137063992 AGTTTTCTGTGCCCCTGAACAGG + Intronic
1001781200 5:174370512-174370534 AGTGTCATGTGCTCAGGATTTGG + Intergenic
1003995410 6:11536018-11536040 AGTTTAATGAGCCCCTGCTCAGG + Intergenic
1005134882 6:22556503-22556525 AGAGACATTTGCCCATGATCTGG + Intergenic
1008465667 6:51827770-51827792 AGTTCCAAGCGCTCATGATCTGG - Intronic
1011259097 6:85453355-85453377 AGTTTCATGTGCCCTGGGTGGGG + Intronic
1014335008 6:120122487-120122509 TGTTTCATTTGTCCAGGATCAGG - Intergenic
1020464748 7:8464869-8464891 GGATTCATATGCCCATGTTCTGG + Intronic
1025002289 7:55326488-55326510 AGTTTCTGGTCCCCAAGATCAGG + Intergenic
1026010994 7:66635966-66635988 AGGTGGATGTGCCCATGCTCAGG + Intronic
1026016257 7:66673073-66673095 AGGTGGATGTGCCCATGCTCAGG + Intronic
1033016196 7:137674038-137674060 GGTTTCCAGTGCCCATAATCAGG + Intronic
1036081811 8:5565627-5565649 ATTTTAATGTGCCCATGAACAGG + Intergenic
1037405927 8:18542293-18542315 AATTTCATGTGAGAATGATCAGG - Intronic
1037897054 8:22664660-22664682 AGTATTCTGTCCCCATGATCAGG - Intronic
1040792305 8:51246407-51246429 AGGTTCAAGTGCCCATGTGCAGG - Intergenic
1042187989 8:66156025-66156047 AGTTTCAAGTGTCCATAATGCGG + Intronic
1046367737 8:113258468-113258490 AGTTTCATGTGGCTATAATCTGG + Intronic
1046731310 8:117729327-117729349 AGATTCATGTGATCATGATTTGG - Intergenic
1047283400 8:123465152-123465174 AGTTCCATGTACCCTTCATCTGG + Intronic
1048161628 8:132026849-132026871 GGTTTCTTGGGCTCATGATCTGG + Intronic
1049993013 9:1007719-1007741 GATTTCAGGTGCCCATAATCGGG - Intergenic
1051829574 9:21260467-21260489 AGTTTCATTTATCCATGTTCAGG - Intergenic
1057381294 9:94569688-94569710 TGTTTCTTGTGACCAGGATCTGG - Intronic
1189115580 X:38338962-38338984 TGGATCATGTGCCCATGACCTGG + Intronic
1197507486 X:127324827-127324849 AGTTTCATGTACCCTTGACCTGG - Intergenic