ID: 1181683812

View in Genome Browser
Species Human (GRCh38)
Location 22:24514805-24514827
Sequence TTATATAGAACGGTGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181683812_1181683815 -4 Left 1181683812 22:24514805-24514827 CCGGGCTCCACCGTTCTATATAA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1181683815 22:24514824-24514846 ATAATGACATGTGATTGCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 201
1181683812_1181683816 -3 Left 1181683812 22:24514805-24514827 CCGGGCTCCACCGTTCTATATAA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1181683816 22:24514825-24514847 TAATGACATGTGATTGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181683812 Original CRISPR TTATATAGAACGGTGGAGCC CGG (reversed) Intronic
901711604 1:11119931-11119953 TTATATAAAATGGTGTAGGCCGG + Intronic
910779202 1:90909719-90909741 TAATATACAACAGTGAAGCCGGG + Intergenic
913529756 1:119725352-119725374 TTAGATAGCACTGTGGAGTCTGG + Intronic
916456444 1:164975595-164975617 TTTTGTAGAGTGGTGGAGCCTGG + Intergenic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
1064811652 10:19206735-19206757 TTTTATGGAAAGGTGGAGCTAGG + Intronic
1070449210 10:76541203-76541225 TAATAGAGAAGGGTGAAGCCGGG + Intronic
1073320643 10:102614258-102614280 TAATATAGAATGTTGGGGCCAGG + Intronic
1076298552 10:129406284-129406306 TTACATTGAACGGTGGGGGCAGG - Intergenic
1080605683 11:33863022-33863044 TTATATAAAACGGTAGAGATAGG + Intronic
1083598020 11:63928825-63928847 TTATAAAGAACAGAGGCGCCGGG + Intergenic
1085252165 11:75151071-75151093 TTCTATACAACCGTGGAGCCAGG + Exonic
1086873501 11:92067635-92067657 TTATATAGCACAGTTCAGCCAGG + Intergenic
1088379101 11:109173619-109173641 TTAAATACAAGGGTGGGGCCAGG - Intergenic
1091619511 12:2075743-2075765 AGATGTAGAACAGTGGAGCCAGG + Intronic
1092651522 12:10640285-10640307 TTCCCTAGAACGGTAGAGCCTGG - Intronic
1099727291 12:86448180-86448202 TTCCATAGAAGGATGGAGCCTGG + Intronic
1104455856 12:128911650-128911672 TTAGATGGAAAGGTGGAGGCAGG - Intronic
1110904026 13:80863014-80863036 TTATTTCCAACGGTGGTGCCTGG + Intergenic
1112325710 13:98441655-98441677 TTACACAGAACGGTGGAGAAAGG + Intronic
1123183425 14:106491076-106491098 TTATATTGAACAGTGGACACAGG - Intergenic
1133445587 16:5858280-5858302 TTATGAAGAAGGGAGGAGCCTGG - Intergenic
1138465858 16:57189477-57189499 TTATGTAGCACTGTGGGGCCTGG + Intronic
1138674621 16:58642066-58642088 TTAAATAGAATTGTGGGGCCAGG - Intergenic
1138787983 16:59869137-59869159 TTATGCAGAAGGGAGGAGCCTGG - Intergenic
1151186057 17:72364644-72364666 TCATATGGAGAGGTGGAGCCAGG - Intergenic
1162896143 19:13765592-13765614 TCATATAGAATGGTGGAGGAGGG - Intronic
1165440581 19:35824775-35824797 TTCAATAGAAAGATGGAGCCAGG + Intergenic
926735006 2:16067045-16067067 TTATATGGAAAGGTGGAAACTGG + Intergenic
934123628 2:88865050-88865072 TTTTGTAGAACGGTGGATCCTGG - Intergenic
942287561 2:174435768-174435790 TTATATAAAATGGTGTAGGCCGG - Exonic
943292062 2:186086070-186086092 TTATATAAATTGCTGGAGCCGGG - Intergenic
944994784 2:205281329-205281351 TCATAGAGCAAGGTGGAGCCAGG + Intronic
1173348867 20:42226344-42226366 TTATCTAAAACTGTGGAGCCAGG + Intronic
1174660049 20:52204502-52204524 ATATAGAGATCGGTGGAGCTAGG + Intergenic
1181094694 22:20496980-20497002 TTAAAAAGAAAGGTGGGGCCGGG + Intronic
1181683812 22:24514805-24514827 TTATATAGAACGGTGGAGCCCGG - Intronic
951424702 3:22530394-22530416 ATTTATAGAACGGTGTTGCCTGG + Intergenic
959575982 3:107934539-107934561 CTATTTAGAACTGTGGAGACAGG - Intergenic
962855807 3:139343770-139343792 TTATTTAGAACGATGGAAACGGG + Intronic
964603064 3:158524696-158524718 TTATATAGAACAATGGAGCAGGG + Intronic
967648804 3:191960315-191960337 TTACAAAGAACGAAGGAGCCAGG - Intergenic
976177322 4:82367746-82367768 TTATATTGTACGTTGGAGCTAGG - Intronic
982268521 4:153563227-153563249 TTTTATAAAACTGTGGAGCATGG + Intronic
986812086 5:11371032-11371054 CTATAGAGAAGGGTGGGGCCTGG + Intronic
991029904 5:62071907-62071929 TTTTATAGGAGTGTGGAGCCTGG + Intergenic
996500632 5:124212147-124212169 TTATATTGATAGGTGGAGCATGG - Intergenic
997991191 5:138545557-138545579 TAATATAGAAAGGAGGAACCAGG - Intergenic
1018867511 6:167757863-167757885 ATATTTAGCACGGTGGAGCGGGG + Intergenic
1024706697 7:51969424-51969446 TTAATTAGAAAGCTGGAGCCTGG - Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034484942 7:151354108-151354130 TTATATAGAAAGGGGGACTCTGG - Intronic
1037061552 8:14516977-14516999 ATAGATACAAGGGTGGAGCCAGG + Intronic
1054904748 9:70404873-70404895 ATAAATAGAATGGTGGAGACAGG + Intronic
1061476766 9:130872870-130872892 TGATATAGAACGGGGGCTCCCGG - Exonic
1188363995 X:29291690-29291712 TTATATAGAAAGGAAGAGCATGG - Intronic
1188758293 X:33992527-33992549 TGATATAGAACTGTAGATCCTGG - Intergenic
1190371826 X:49749845-49749867 TTATAAAGGACGGTGGTGGCTGG + Intergenic
1190691607 X:52917443-52917465 TAATAAAGAACACTGGAGCCCGG + Intergenic
1190694376 X:52938349-52938371 TAATAAAGAACACTGGAGCCCGG - Intronic
1190866431 X:54388773-54388795 TTATATTGAAAGTTGGGGCCGGG + Intergenic
1198751421 X:139939972-139939994 TTATATAGAAATATGGGGCCGGG + Intronic