ID: 1181684651

View in Genome Browser
Species Human (GRCh38)
Location 22:24520142-24520164
Sequence TCCCAAAGGCTGTTCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181684646_1181684651 -8 Left 1181684646 22:24520127-24520149 CCTGCAGCAGGCCCTTCCCAAAG 0: 1
1: 1
2: 2
3: 30
4: 307
Right 1181684651 22:24520142-24520164 TCCCAAAGGCTGTTCAGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 179
1181684644_1181684651 6 Left 1181684644 22:24520113-24520135 CCACGTGGCTTATGCCTGCAGCA 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1181684651 22:24520142-24520164 TCCCAAAGGCTGTTCAGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181684651 Original CRISPR TCCCAAAGGCTGTTCAGGCC AGG Intronic
900090107 1:916553-916575 CCCCAGAGCCTGCTCAGGCCTGG - Intergenic
900461613 1:2804652-2804674 TGCCAAAGGCAGTGCAGGCCTGG - Intergenic
902251986 1:15159893-15159915 TCTCAAAGGCCTCTCAGGCCAGG - Intronic
903006847 1:20304218-20304240 GCCCAAAGGCTATGCAAGCCCGG + Intronic
903514184 1:23899389-23899411 TCCCAAAGTTAGTTCAGCCCAGG - Intronic
903937906 1:26909514-26909536 TCCTAAAGGTTGTTCAGGGCCGG + Intronic
904625225 1:31798593-31798615 TCCCGAAGGCTGTGGAGGCCAGG + Exonic
911652582 1:100406626-100406648 TTAAAAAGGCTGTTCTGGCCAGG + Intronic
919237060 1:194859288-194859310 TCCTGAAGGCAGTTAAGGCCTGG - Intergenic
920618588 1:207521270-207521292 TTCAAAAGGCTATACAGGCCTGG - Intronic
920920427 1:210293334-210293356 TCCAAAAGGAAGTTAAGGCCGGG - Intergenic
923160655 1:231311896-231311918 TCCCAAAGGCGGCTCAGATCTGG + Intergenic
923786387 1:237072306-237072328 TCTCAAAAGCTGCACAGGCCGGG - Intronic
1064030534 10:11880161-11880183 TCCCCGAGGCTGGGCAGGCCTGG + Intergenic
1071490245 10:86131286-86131308 TCCCCAAGGGTGTTCAGCCTTGG - Intronic
1073294647 10:102431804-102431826 TCCCAAGGGCAGCACAGGCCTGG + Intronic
1077093973 11:791627-791649 TCCCTGGGGGTGTTCAGGCCAGG + Exonic
1080373884 11:31685055-31685077 TAGCAAAGGAAGTTCAGGCCGGG + Intronic
1080819082 11:35788039-35788061 TCCCAAGGGCTGGTAAGACCAGG - Intronic
1081847823 11:46253357-46253379 TCCCAAAGGAGGAACAGGCCTGG - Intergenic
1085409737 11:76284030-76284052 TCCCACAGGCTGCTGCGGCCCGG + Intergenic
1086160911 11:83720826-83720848 TCACAAGGGCTATTCAGACCTGG - Intronic
1087388182 11:97500310-97500332 TCACATAGGTTGTTCATGCCAGG - Intergenic
1088713647 11:112529811-112529833 TCCCTAAGGCTGTCCAGCCTGGG - Intergenic
1090711829 11:129393279-129393301 TCCCAAAGGGTGATCAGGACCGG - Intronic
1091181246 11:133606422-133606444 TCCCAAAGGCTCTTCATTCTGGG - Intergenic
1091299583 11:134498848-134498870 TCCCAAAGCGTGTTCCGGCAGGG - Intergenic
1091542979 12:1479636-1479658 TCCAAAAGTCTTTTCAGGACGGG + Intronic
1094428263 12:30338516-30338538 TCCCAAAGACTCTTTAGGCTTGG + Intergenic
1095728791 12:45481940-45481962 TTCCAAATGCTGTTCATGCATGG + Intergenic
1098488185 12:71046047-71046069 TCCACAAGGCTGTCCAGTCCAGG - Intergenic
1106040955 13:26093029-26093051 TCCAAAATGCTGTTCAGAACAGG - Intergenic
1106647071 13:31647703-31647725 TCCCAAAAGCTGCTCAGCCTCGG - Intergenic
1108695889 13:52901971-52901993 TCCCAAAGGCTGCTAGGTCCAGG - Intergenic
1108733633 13:53259969-53259991 TCCCAAAGGATTCTCAGACCAGG - Intergenic
1109345903 13:61113992-61114014 TCCCAAAATCTGTTCAAGCCTGG - Intergenic
1112985296 13:105441945-105441967 TCCCACAGGCTGATGAGGCCTGG - Intergenic
1117713761 14:58559670-58559692 TTCCCAAGGCTTCTCAGGCCAGG - Intergenic
1121402786 14:93695594-93695616 TCCAAAAGTTTTTTCAGGCCAGG + Intronic
1124512139 15:30336507-30336529 TCCCAGAGCCTGCTCAGGTCAGG + Intergenic
1124730775 15:32194244-32194266 TCCCAGAGCCTGCTCAGGTCAGG - Intergenic
1126195089 15:45922564-45922586 TTAGAAAGGCTGTTCAGGCCAGG - Intergenic
1126580298 15:50236736-50236758 ACACAAAAGGTGTTCAGGCCGGG + Intergenic
1128468716 15:67934194-67934216 TTCCACAGGCTGTACAGGTCTGG + Intergenic
1128713005 15:69885972-69885994 TCTCAAAGGGTGGGCAGGCCTGG + Intergenic
1128801727 15:70501323-70501345 TCCCACAGACTCCTCAGGCCTGG + Intergenic
1128922900 15:71628512-71628534 TCCCAAAGGGTGAGCAGCCCTGG - Intronic
1129071222 15:72953094-72953116 TCCCAAAGGCTGATCCTCCCAGG + Intergenic
1129668360 15:77592371-77592393 TCCCAAACCCAGATCAGGCCTGG + Intergenic
1129787816 15:78320990-78321012 TCACAAAGGCCTTTGAGGCCAGG + Intergenic
1130088317 15:80797139-80797161 TCCCGTAGGCAGTTCTGGCCAGG - Intronic
1134882442 16:17757474-17757496 TCCCAAAGGCTGGCCAGGCGAGG - Intergenic
1141648805 16:85381709-85381731 TCCCAAGGGCCGCTCAGACCTGG - Intergenic
1141676598 16:85521010-85521032 TCCCAAAGGCTCCTCAACCCCGG - Intergenic
1141757109 16:85998578-85998600 TCCCAAAGGCCGCTCAGGAAAGG - Intergenic
1142051744 16:87963306-87963328 TCCCAAGTGCAGTGCAGGCCAGG + Intronic
1142848813 17:2694634-2694656 TCCCCAACGCTGTCCAGCCCGGG + Intronic
1145021633 17:19436127-19436149 TTCAAAAGGCTCTTCAGGCTAGG + Intergenic
1148116623 17:45179148-45179170 TCCAAATGGCTATACAGGCCGGG + Intergenic
1149517667 17:57292645-57292667 CCCCAAAGGATGCTGAGGCCTGG + Intronic
1150191142 17:63240608-63240630 TCCCATAGTCTGTTCAGTTCTGG - Intronic
1150290835 17:63980667-63980689 ACATAAAGGGTGTTCAGGCCAGG - Intergenic
1151048331 17:70947888-70947910 TCCCAAATCCTGTTCTGGCCAGG - Intergenic
1151732417 17:75919429-75919451 ACCCACAGGCTGTTCAGGCATGG - Intronic
1152251652 17:79215678-79215700 CCCCAAAGGCTGTGCATGGCTGG + Intronic
1155263302 18:24066517-24066539 AACCAAAGGCTGGTGAGGCCTGG - Intronic
1156253430 18:35373960-35373982 TCCCAAAAGAGCTTCAGGCCTGG - Exonic
1162770918 19:12948898-12948920 ACCCAAAGGCTTTTCAGGGCAGG - Intronic
1163329697 19:16628394-16628416 TCCCAACGGCTGCCTAGGCCGGG - Intronic
1163620379 19:18356135-18356157 TCAAAAGGGCTTTTCAGGCCGGG + Intronic
1163699628 19:18780832-18780854 CTGCCAAGGCTGTTCAGGCCTGG - Exonic
1165771787 19:38384645-38384667 TCCCAAAGGCAGTTTAGGGCAGG + Intronic
1165820873 19:38675225-38675247 TCCCATATGCTTTCCAGGCCAGG - Intronic
1166965679 19:46528295-46528317 TCCCAAAGGCTGCTGTTGCCCGG + Intronic
926113421 2:10196653-10196675 TCCGGATGGCTGCTCAGGCCAGG - Intronic
932542835 2:72674534-72674556 TTTAAAAGGCTGTGCAGGCCGGG + Intronic
934814850 2:97315583-97315605 TCCTACAGGCTGCTCAGACCAGG + Intergenic
934822845 2:97392900-97392922 TCCTACAGGCTGCTCAGACCAGG - Intergenic
938891334 2:135708662-135708684 TCTGAAAGACTGCTCAGGCCAGG + Intronic
938957270 2:136310158-136310180 TCCCCAAGGCTCTGCAGCCCAGG + Intergenic
941003674 2:160226045-160226067 TCCCGCAGGCTGGTGAGGCCTGG - Intronic
941122705 2:161549526-161549548 GCAAAGAGGCTGTTCAGGCCTGG - Intronic
942085599 2:172440720-172440742 TCTCAAAGGCTGTTGGTGCCAGG - Intronic
945135098 2:206618360-206618382 TTCCAAAGGATGCTCAGTCCAGG - Exonic
947790745 2:232867091-232867113 TTCCAAAGGGTGTTCAGGCTTGG - Intronic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1169794624 20:9448407-9448429 TACCAAGGGCTGTTTGGGCCAGG - Intronic
1172098408 20:32471924-32471946 TTCCACAGGCTGTACAGGCATGG - Intronic
1172693129 20:36804137-36804159 TCCCAGAGGCTGCTGACGCCTGG + Intronic
1172792405 20:37514857-37514879 TCTCAAAGGCTGTTCTGACTGGG + Intronic
1172869441 20:38126624-38126646 GCCGGGAGGCTGTTCAGGCCTGG + Intronic
1173173346 20:40744734-40744756 TCCCAAAAGTTGTCAAGGCCGGG - Intergenic
1173866516 20:46316047-46316069 TCTCTAAGGCAGCTCAGGCCAGG - Intergenic
1174051596 20:47771072-47771094 TCACAGAGGCTGGCCAGGCCTGG + Intronic
1176388685 21:6152302-6152324 ACCCACAGGCTGTCCTGGCCAGG - Intergenic
1178438935 21:32583251-32583273 TCTCAAAGGCTGTACTGGCATGG + Intronic
1178599538 21:33984041-33984063 TCCCCAAAGTGGTTCAGGCCAGG - Intergenic
1178623486 21:34196867-34196889 TCCCAAAGAGTGTTGAAGCCTGG - Intergenic
1179098445 21:38336062-38336084 ACCCCAAGGCTGCTGAGGCCTGG + Intergenic
1179180522 21:39040978-39041000 TCTCAAAGTGTGGTCAGGCCAGG + Intergenic
1179488776 21:41727296-41727318 ACCCACGGGCTATTCAGGCCTGG + Intergenic
1179734787 21:43385946-43385968 ACCCACAGGCTGTCCTGGCCAGG + Intergenic
1179766686 21:43578920-43578942 TCCCAGAGGCGGTCCTGGCCGGG - Intronic
1180173277 21:46072234-46072256 TACCACTGTCTGTTCAGGCCGGG + Intergenic
1180628911 22:17213686-17213708 TCTCAAAGGCTGCGCGGGCCGGG - Intronic
1181546729 22:23606556-23606578 TCTCAAAGGCTGGTCTGACCAGG + Intergenic
1181684651 22:24520142-24520164 TCCCAAAGGCTGTTCAGGCCAGG + Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1183870334 22:40736971-40736993 GCCCCAAGGCTGCCCAGGCCCGG - Intergenic
1184090146 22:42288865-42288887 GCCCAAGGGCAGTGCAGGCCTGG + Intronic
949635263 3:5975223-5975245 TTCCACAGGCTGTACAGGCATGG - Intergenic
950423626 3:12912970-12912992 TCCCTAAGCCTCTCCAGGCCAGG - Intronic
952303593 3:32125970-32125992 TCCCAAAGGATGTACAGACATGG + Intronic
954640376 3:52094196-52094218 ACACAAAGGCTCTTCAGGACTGG + Intronic
954784804 3:53084942-53084964 TAGCAAATGCTGCTCAGGCCAGG + Intronic
956440735 3:69278147-69278169 TTGAAAATGCTGTTCAGGCCAGG - Intronic
957255107 3:77826086-77826108 CCCCAGGGGCTGTTCAGGGCTGG + Intergenic
958169634 3:89922566-89922588 TTCCAAAGGCTGTTCTTGCTAGG + Intergenic
961841935 3:129721563-129721585 TCACAAAGCATGTGCAGGCCGGG + Intronic
962808422 3:138943021-138943043 CCCTAGAGGCTGGTCAGGCCTGG - Intergenic
963511311 3:146251759-146251781 TCAAAAAGGCTCTTGAGGCCGGG - Intergenic
967221631 3:187252434-187252456 TCTGACAGGCTCTTCAGGCCTGG + Intronic
967399101 3:189040941-189040963 TCCTCAAGCCTGTTCAGCCCTGG + Intronic
968135977 3:196219927-196219949 ACCCCAAGGCTGTTCAGAACAGG + Intronic
968422871 4:499787-499809 ACCCAAAGGCTGCTCAGGAAAGG - Intronic
970487231 4:16536748-16536770 TCCCAAAGATTGTGCAGGGCTGG + Intronic
970781420 4:19742253-19742275 AGCCAAAGACTGGTCAGGCCTGG + Intergenic
972639264 4:40910909-40910931 TCCCATAGGCTGTGCTGGGCTGG - Intronic
973728503 4:53800468-53800490 TCCCCAGGAATGTTCAGGCCAGG + Intronic
975810531 4:78164015-78164037 ACCCAACTGTTGTTCAGGCCAGG - Intronic
976216581 4:82720854-82720876 TCCAAAGGGCTGTCCGGGCCAGG + Intronic
976217808 4:82731307-82731329 TCCCCAAGGCTGTCCTAGCCAGG - Intronic
979482515 4:121236214-121236236 TCACAGAGGCTGGTGAGGCCAGG - Intergenic
983280392 4:165673792-165673814 TACCAAAGACTGTACAAGCCTGG - Intergenic
984920953 4:184763789-184763811 TGCCAAAGGCTGTTAAGACTGGG + Intronic
984965636 4:185137471-185137493 ACCCTGAGGCTCTTCAGGCCTGG + Intergenic
987086765 5:14477213-14477235 CCCCAGATACTGTTCAGGCCTGG - Intronic
988441587 5:31240097-31240119 TTCCACAGGCTTTTAAGGCCTGG - Intronic
997998843 5:138608065-138608087 TCTTAAAGGCTGTATAGGCCAGG - Intergenic
998607429 5:143649317-143649339 TCCCAGAGGCAGTTCAGGGAAGG - Intergenic
1001270368 5:170306730-170306752 GCTCAAAGGCTGATAAGGCCAGG + Intergenic
1002928297 6:1617658-1617680 GCCCCAAGTCTGTTGAGGCCTGG - Intergenic
1003389799 6:5703834-5703856 TGGAAAAGGCTGTGCAGGCCTGG + Intronic
1006152814 6:31998356-31998378 TCCCCAAGGCTGATCTGGCTGGG - Intronic
1006159122 6:32031093-32031115 TCCCCAAGGCTGATCTGGCTGGG - Intronic
1006224256 6:32522612-32522634 TCCCAGAGGCAGTGCAAGCCTGG - Intronic
1008609798 6:53175208-53175230 TCCCAGAGGGTTTTCAGGTCAGG + Intergenic
1011454191 6:87529353-87529375 TAGCAAAAGCTGTTCAGGCTTGG - Intronic
1015861576 6:137686495-137686517 TCACAAAGGGTGTTCAGTTCTGG - Intergenic
1016899863 6:149090849-149090871 TCACAAACTCTGCTCAGGCCTGG + Intergenic
1017115005 6:150967928-150967950 TCCCTAGGGCTTTTCAGACCGGG - Intronic
1019333563 7:472017-472039 TCACACTGCCTGTTCAGGCCGGG + Intergenic
1019998047 7:4737785-4737807 ACCCAAGGGCTCTTCAGTCCTGG - Intronic
1020361017 7:7326766-7326788 TCCCAAGGGCTGGTCAGTTCTGG - Intergenic
1022320620 7:29284487-29284509 TCCCATAGGCTGTTCACAACAGG - Intronic
1022480650 7:30741096-30741118 TTCCAAAGCCGGTGCAGGCCAGG - Intronic
1025088239 7:56040959-56040981 GCCCATAAGATGTTCAGGCCAGG - Intronic
1026339024 7:69419635-69419657 TCTCTAAGGCTGGTGAGGCCTGG - Intergenic
1026672518 7:72402455-72402477 TCCCTAAGGCTGTTCAGAATGGG - Intronic
1026890487 7:73978955-73978977 TCCCCAACGCTGTTTAGGCAAGG - Intergenic
1027362795 7:77426924-77426946 TCACAGAGCCTGTTCATGCCAGG - Intergenic
1029323246 7:99783902-99783924 TCAAAAAAGATGTTCAGGCCGGG - Intronic
1036707454 8:11055993-11056015 ACCCAAGGGCTGCACAGGCCCGG - Intronic
1038162013 8:25048687-25048709 TCACAAAAGCAATTCAGGCCAGG + Intergenic
1038717368 8:30003931-30003953 TTAGAAAGGCTATTCAGGCCGGG - Intergenic
1040285958 8:46100534-46100556 CCCCCAAGGGTGTTCTGGCCAGG - Intergenic
1045021572 8:98049187-98049209 TCCCAAAGGCTATTCAGTAATGG - Intergenic
1049211667 8:141389455-141389477 TCCCCAAGCCTGTTCATGCCCGG + Intergenic
1050426273 9:5516008-5516030 TCCCAATGTCTGTTCAAGTCTGG + Intronic
1051923854 9:22299447-22299469 ACCCATAGGCTGTTCAGTCTGGG + Intergenic
1052813755 9:33083996-33084018 TAAGAAAGGCTGTTTAGGCCAGG + Intergenic
1053203132 9:36166147-36166169 TCCCAAAGGCTGGTCCGGGTGGG + Intergenic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1060238663 9:121884783-121884805 TCCCAAATGCTGAGCAGGACAGG - Intronic
1060268490 9:122125951-122125973 GCCCCCAGGCTGGTCAGGCCCGG + Intergenic
1060957932 9:127657454-127657476 TCCCAAAAGCTGTTCTTTCCAGG + Intronic
1061032641 9:128095326-128095348 TCCCAAAGCCTGTCAAGGGCAGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186417276 X:9394685-9394707 TTCCTAATGCTGGTCAGGCCTGG + Intergenic
1186960717 X:14734144-14734166 TCCCAAGGATTCTTCAGGCCTGG - Intergenic
1187198571 X:17112253-17112275 TTTCAAAGTCTGTTCTGGCCAGG - Intronic
1188586277 X:31779341-31779363 ACCCCAAGTCTGTTCATGCCTGG + Intronic
1194648171 X:96483358-96483380 ACTCAAAGGCTGGTGAGGCCTGG + Intergenic
1194727584 X:97416435-97416457 TCCAAAAGGCTGTTCTGTGCTGG + Intronic
1197159199 X:123304762-123304784 TCCAAAAGGCTATACTGGCCTGG + Intronic
1197598996 X:128505032-128505054 TCAGAAAAGCTGTTCAGGGCAGG + Intergenic
1197707249 X:129643092-129643114 TCAGAATGGCTGCTCAGGCCAGG + Intergenic
1197890423 X:131264707-131264729 TCCCAAAGGATTGTCAGGCCTGG + Intergenic
1198184178 X:134237495-134237517 TCCCAAACGCTCTCCAGCCCCGG - Intronic
1199635635 X:149809112-149809134 TCCCAAAGCCTCTTCATGCAGGG - Intergenic
1199643702 X:149885189-149885211 TCCCAAAGCCTCTTCATGCAGGG - Exonic
1200238769 X:154482842-154482864 TCCTGAAGGCTTTTCAGGGCTGG + Intergenic
1200417303 Y:2925855-2925877 ACACAAATTCTGTTCAGGCCAGG - Intronic
1201277971 Y:12316085-12316107 TCCCAAAGCCTGCACAGGCTTGG + Intergenic
1201357860 Y:13115392-13115414 TCCCAAAGCCTGCACAGGCTTGG + Intergenic