ID: 1181685244

View in Genome Browser
Species Human (GRCh38)
Location 22:24523489-24523511
Sequence GCATTTGGCAGACACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181685239_1181685244 -9 Left 1181685239 22:24523475-24523497 CCTTTTGGGCCTCAGCATTTGGC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 216
1181685235_1181685244 9 Left 1181685235 22:24523457-24523479 CCTGAGATGAGAGACAGGCCTTT 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 216
1181685233_1181685244 17 Left 1181685233 22:24523449-24523471 CCTTCAGGCCTGAGATGAGAGAC 0: 1
1: 0
2: 2
3: 27
4: 397
Right 1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181685244 Original CRISPR GCATTTGGCAGACACTGGGG AGG Intronic
900169152 1:1257850-1257872 GCATTTGGCAGAACTTGGAGGGG - Intronic
900894378 1:5473140-5473162 GCATTTGGCAGGCAGTCGGGGGG - Intergenic
901315300 1:8303359-8303381 GCATGTGGCATTCAGTGGGGTGG - Intergenic
901762925 1:11482209-11482231 CCAAGTGGCAGACACTGGGCTGG + Intronic
902205501 1:14865463-14865485 GCAGATGGCAGACATGGGGGAGG - Intronic
902617222 1:17630394-17630416 ACATTTGGCAGCCCTTGGGGCGG + Intronic
902618221 1:17635401-17635423 GCAATGGGAAGCCACTGGGGCGG - Intronic
904875379 1:33650802-33650824 GCATTTGGAACTCTCTGGGGTGG - Intronic
905768625 1:40623470-40623492 GCATATGGCAGAGACAGGAGTGG - Exonic
907413686 1:54299680-54299702 GGAGAAGGCAGACACTGGGGTGG - Intronic
909450988 1:75797477-75797499 TCATTTGTCAGACACTGTGAGGG - Intronic
909484118 1:76154897-76154919 TCATCTGGCAGCCACTGGGTGGG + Intronic
910284387 1:85537513-85537535 GTGTTTATCAGACACTGGGGAGG + Intronic
910455170 1:87390104-87390126 GCATTTAGGAGACACCTGGGTGG + Intergenic
915917432 1:159949410-159949432 GAACTTGGCAAGCACTGGGGAGG - Intergenic
916274556 1:162979725-162979747 GCATTTGGCAAACAATGGCAAGG - Intergenic
916604678 1:166328957-166328979 GGATTAGGGAGACAGTGGGGAGG - Intergenic
921098049 1:211903795-211903817 CCATGTGGCAGATACTGTGGTGG - Intergenic
921924024 1:220697017-220697039 GAAGGTGGCAGGCACTGGGGCGG + Exonic
922892532 1:229072796-229072818 GCCTTGGGCAGACACAGTGGGGG - Intergenic
923382683 1:233437395-233437417 GCATATGGCAGACTCTTGGAGGG + Intergenic
1064326485 10:14356009-14356031 GCCTTTGGCAGCCAGTGGGGTGG - Intronic
1064554433 10:16534428-16534450 TCATTGGGAAGACACTGGGATGG + Intergenic
1067820119 10:49521002-49521024 GCATTTGGGAGAGACTGTTGGGG - Intronic
1070307091 10:75246080-75246102 GCATTTGGCAGCCCCTGAGCTGG + Intergenic
1070563902 10:77589394-77589416 GCAGTTGGAAGACTCTGGGCAGG - Intronic
1073193081 10:101666096-101666118 GCATTAGGAAGAAACTGAGGAGG + Intronic
1074543912 10:114387825-114387847 GCACTTGGAAGACTCTGGGTAGG + Intronic
1075091807 10:119448038-119448060 GCATGGTGCAGACACTGTGGAGG + Intronic
1076478076 10:130766424-130766446 GCATGAGGCAGGCACTGGGCAGG + Intergenic
1077612067 11:3649433-3649455 GCATTGGGCAGAGACTAGGGAGG - Intronic
1077766502 11:5164498-5164520 GCATTGGGAAGAGACTAGGGAGG + Intronic
1077899182 11:6476021-6476043 GCATCTGGCATGGACTGGGGTGG - Exonic
1080098999 11:28437825-28437847 TCATTTGGAAGAAACTGGGCTGG - Intergenic
1081459652 11:43260264-43260286 GCATTTGATAGACAACGGGGTGG - Intergenic
1083516980 11:63269091-63269113 CCATGTGTCACACACTGGGGTGG + Intronic
1083970050 11:66069456-66069478 GCATTTGCCAGCCTGTGGGGAGG + Exonic
1084453344 11:69252805-69252827 GGAGTTGGCAGAGGCTGGGGTGG + Intergenic
1085611118 11:77950403-77950425 GTGGTTAGCAGACACTGGGGAGG + Intronic
1088841557 11:113631620-113631642 GCATGTGCCAGACACTGTGCGGG - Intergenic
1089077353 11:115748893-115748915 TAATTGGGCAGACACTGTGGTGG + Intergenic
1090391611 11:126392454-126392476 GCATTTGGCAGAAAGTGCGCTGG + Intronic
1091588050 12:1827260-1827282 CCAGTTGGGAGACACTGGGGGGG + Intronic
1091999580 12:5021239-5021261 GCTTTGGGCAGACAGAGGGGAGG - Intergenic
1093578704 12:20764923-20764945 GCATTGGGCAGAGACTAGGAAGG - Intergenic
1093584631 12:20821167-20821189 GCATTGGGCAGAGACTAGGAAGG + Intronic
1096010815 12:48212866-48212888 GGCTTTGGCAGACGCTGGTGAGG - Intergenic
1097178378 12:57156632-57156654 GGATTTGGAAGCCACAGGGGTGG - Intronic
1097344703 12:58477940-58477962 GCCTAAGGCAGGCACTGGGGAGG - Intergenic
1097464564 12:59906434-59906456 GAATTTGGCAGAGACTCTGGTGG + Intergenic
1099003278 12:77206345-77206367 TCAGGTGGCAGTCACTGGGGTGG - Intergenic
1104679476 12:130739623-130739645 GCAGTTGGCAGCCTCTGGGCAGG + Intergenic
1106588084 13:31074401-31074423 TCATTTGCCAGGCAGTGGGGAGG - Intergenic
1112592639 13:100777669-100777691 ACTATTGGCAGACACTTGGGTGG + Intergenic
1115010706 14:28541076-28541098 AGATTTGGGAGAGACTGGGGTGG + Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1118914194 14:70088163-70088185 GCATTTAGCAGACAGTGGGTAGG + Intronic
1119746921 14:77051335-77051357 GAGTCTGGCAGACACTGGTGTGG - Intergenic
1122097291 14:99381233-99381255 GCATCTGGCAGACAGGTGGGAGG - Intergenic
1123058048 14:105581700-105581722 GCATCTGGCAGTGACTGTGGTGG - Intergenic
1123894255 15:24812574-24812596 GACTTTGGCAGACACTGTGTGGG - Intergenic
1126089518 15:45039078-45039100 CCATGTGCCAGACAGTGGGGTGG - Intronic
1127730696 15:61799340-61799362 CTATTTGCCAGACACTGGGCTGG + Intergenic
1129709151 15:77811436-77811458 GGATTGGGCAGACACAGGAGAGG - Intronic
1131664145 15:94552213-94552235 GGATTTGTCAGACACTGGAATGG - Intergenic
1133911011 16:10066677-10066699 ACATTTAGCAAACACTGGGAGGG - Intronic
1134537473 16:15037900-15037922 TCATTTGAAAGACACTGAGGAGG + Exonic
1135709626 16:24704266-24704288 GTATTTGGTAGAGACTGGTGGGG + Intergenic
1136655865 16:31708857-31708879 GCATTTGGAAGTCACTGGGTGGG + Intergenic
1137718167 16:50611504-50611526 GCATGTGGCAGCCCGTGGGGTGG + Intronic
1137726697 16:50661535-50661557 CCATTTGGGAGCCACTGGGATGG - Intergenic
1144512243 17:15887047-15887069 TCATTTGACAGACACTCAGGAGG - Intergenic
1148242881 17:46011930-46011952 ACACTTAGCAGACACTGGTGAGG - Intronic
1148246267 17:46032798-46032820 GCATTTGGAAGACAGTTGGGGGG - Intronic
1148317742 17:46718197-46718219 CCCTTTGGCACTCACTGGGGTGG - Intronic
1149379366 17:56077780-56077802 GCATTTGGCAGCCTCTTGGTGGG + Intergenic
1149671007 17:58410024-58410046 TCATTTGGCAGACTCTCGGTTGG - Intronic
1150445956 17:65227152-65227174 GCATTTGCCAAAGACTGTGGTGG - Intronic
1153666250 18:7369824-7369846 GGATTGTGCAGACAGTGGGGGGG + Intergenic
1156721308 18:40073287-40073309 GAATTTTGCAGAAACTGAGGTGG + Intergenic
1157363933 18:47046005-47046027 GCATTTGGCAAGGACTGGGCGGG + Intronic
1160299889 18:77669826-77669848 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160299915 18:77669962-77669984 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299927 18:77670013-77670035 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160299935 18:77670047-77670069 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299967 18:77670200-77670222 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160299979 18:77670251-77670273 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160299991 18:77670302-77670324 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300003 18:77670353-77670375 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160300017 18:77670421-77670443 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300029 18:77670472-77670494 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160300041 18:77670523-77670545 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300053 18:77670574-77670596 GCATGGGGCAGAGACTGGTGTGG + Intergenic
1160300065 18:77670625-77670647 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300095 18:77670778-77670800 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160300115 18:77670863-77670885 GCATGGGGCAGAGACTGGCGTGG + Intergenic
1160610629 18:80082226-80082248 GCCTGTGGCTGACTCTGGGGTGG + Intronic
1160715497 19:574684-574706 GCCTTGGGCAGAGGCTGGGGAGG + Intronic
1160884635 19:1340037-1340059 GCAGGTGGCAGGCACTAGGGTGG - Intergenic
1166458237 19:42962971-42962993 CTTTTTGGTAGACACTGGGGAGG - Intronic
1166475178 19:43118227-43118249 CTCTTTGGTAGACACTGGGGAGG - Intronic
1166976027 19:46605521-46605543 GCATGTGGGAGCCACAGGGGCGG - Intronic
926191764 2:10733727-10733749 GCATTTCCCAGGCGCTGGGGCGG + Intronic
926826655 2:16912699-16912721 GGATTTGAAAGACACAGGGGTGG + Intergenic
927906275 2:26860337-26860359 TCATTTGACAGACACAGGAGGGG - Intronic
929071972 2:38039857-38039879 GCATTTGTCAGACACTGTCCTGG - Intronic
929741728 2:44609176-44609198 GCGATTGCCAGAGACTGGGGTGG + Intronic
929894834 2:45950733-45950755 ACACTTGGCAGACACAAGGGTGG - Intronic
930247992 2:49004228-49004250 TCATTTGTCAGGGACTGGGGTGG + Intronic
930731754 2:54734574-54734596 GATATTGGCAGGCACTGGGGAGG + Intronic
931179683 2:59886843-59886865 CCATTGGGAAGACTCTGGGGTGG + Intergenic
931921048 2:67016254-67016276 GCATTTGGGAGACACTGAGCTGG - Intergenic
931943298 2:67277123-67277145 GCATTAGAAAGACACTGGGGAGG + Intergenic
933749362 2:85593243-85593265 CCCTTTGGCACTCACTGGGGTGG - Exonic
934949969 2:98569588-98569610 GGATGTGCCAGACACTGGGCTGG + Intronic
936154062 2:110036944-110036966 GCACATGGCAGGCAGTGGGGAGG + Intergenic
936190622 2:110334471-110334493 GCACATGGCAGGCAGTGGGGAGG - Intergenic
937992689 2:127673366-127673388 GCCTTTGGCAGGCACTGTGTAGG - Intronic
939984012 2:148812784-148812806 GGATCTGGGAGACTCTGGGGTGG - Intergenic
940608831 2:155964257-155964279 GCCCTTTGCAGACACTGGGAAGG + Intergenic
941936015 2:170981838-170981860 GCATTGGGCACAGACTAGGGAGG + Intergenic
942714393 2:178874806-178874828 GATTTTGGCAGACACTTGGAGGG + Intronic
943091418 2:183379796-183379818 GAATTTTGAAGACACTGAGGAGG - Intergenic
945592287 2:211748524-211748546 AGATTTGGGAAACACTGGGGTGG - Intronic
947636563 2:231683387-231683409 CCAGTTGGGAGGCACTGGGGAGG + Intergenic
947911719 2:233804995-233805017 GAGTTTCGCAGAAACTGGGGAGG - Exonic
948975184 2:241459482-241459504 TCAAGTGGGAGACACTGGGGAGG - Intronic
1169586674 20:7093443-7093465 CCATTGGGCAAGCACTGGGGTGG - Intergenic
1170616126 20:17953199-17953221 GCATTTAGCACACACTTGAGTGG - Intronic
1170694690 20:18647731-18647753 GCAGTGGGCAGCCACTGAGGAGG + Intronic
1172432514 20:34904388-34904410 GCTTTTGCCAAACACTGGGGAGG + Intronic
1175883924 20:62277493-62277515 GCACATGGCAGACACTGGCAAGG - Intronic
1176059000 20:63163968-63163990 CCATTTGGCTGACACAGGGCAGG + Intergenic
1179913413 21:44461741-44461763 GCATTTTGCAGACACCCGGGAGG - Exonic
1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG + Intronic
1184473331 22:44707845-44707867 GCATTTGGGAGACACAGGCCTGG - Intronic
1184788970 22:46687558-46687580 GGAGTGGGCAGACACTGGAGCGG - Intronic
949109308 3:239432-239454 TCTTTTGACAGACACTGTGGTGG + Intronic
949387993 3:3526412-3526434 AAAATGGGCAGACACTGGGGAGG + Intergenic
949916714 3:8970412-8970434 TCTTTTGGTAGAGACTGGGGTGG - Intergenic
950476900 3:13220400-13220422 GCAACTGGCAGATAATGGGGTGG - Intergenic
952398005 3:32938179-32938201 GCAACTGGCAGAGACTGCGGAGG - Intergenic
952652022 3:35738390-35738412 GCCACTGGCTGACACTGGGGTGG + Intronic
960084817 3:113579114-113579136 GCAGGTTGCAGAAACTGGGGAGG + Intronic
960453225 3:117836764-117836786 CTATGTGGCAGACACTGTGGTGG + Intergenic
962069282 3:132016500-132016522 GCATTTGGGGGACACTGAAGAGG + Intronic
966653550 3:182327540-182327562 TCATTTGGCTGAGACTGTGGGGG - Intergenic
967358335 3:188599242-188599264 TCATTTGAAAGTCACTGGGGTGG + Intronic
967727232 3:192873107-192873129 TCATTTTGGAGACAGTGGGGAGG - Intronic
968901895 4:3435909-3435931 GCATGTGGCAGACCCCAGGGAGG - Intronic
968911101 4:3477364-3477386 GCACTTGGCTCACACTGGTGGGG + Intronic
971679663 4:29680493-29680515 GCATTTGGAAATCAATGGGGTGG + Intergenic
972496143 4:39636711-39636733 GCTTTAGGCATCCACTGGGGGGG - Intronic
974355317 4:60805376-60805398 TCATGTGCCAGACACTGTGGTGG + Intergenic
976108459 4:81644561-81644583 GCAATTGGGAGACTCTGTGGTGG - Intronic
976183064 4:82417437-82417459 GCAGTTACCAGAGACTGGGGAGG - Intergenic
976818152 4:89174402-89174424 GCTTGTGGGAGACACTGAGGGGG + Intergenic
978549298 4:109907821-109907843 GCATTTGCAACACTCTGGGGTGG + Intergenic
980656128 4:135789129-135789151 ACATTTGTCATACTCTGGGGTGG - Intergenic
982628524 4:157801005-157801027 GTATTTGGCAGAAACTTGGATGG - Intergenic
982837334 4:160136747-160136769 GCATTTACCAGAGACTGGGGAGG + Intergenic
983333729 4:166365633-166365655 ACATTCTGCAGACACTGGGAAGG - Intergenic
985650232 5:1104151-1104173 GCCCTGGGCAGTCACTGGGGAGG - Intronic
985902617 5:2808494-2808516 GCTTCTGGCAGTCCCTGGGGTGG - Intergenic
987186434 5:15425188-15425210 CTATTTGCCAGACACTGGGCTGG - Intergenic
989227860 5:39051290-39051312 GCATTTGCCAGACACTACGCTGG + Intronic
989618001 5:43356615-43356637 GCACTTGGCAGGTAGTGGGGTGG - Intergenic
990726384 5:58759433-58759455 TTATGTGCCAGACACTGGGGAGG - Intronic
990941192 5:61204832-61204854 GCACTTGACAGTGACTGGGGAGG - Intergenic
990954948 5:61332012-61332034 GCGCTTGGCGGACACGGGGGTGG - Intergenic
992002811 5:72452019-72452041 GCAGTGGGCAGCCACTGGGCTGG + Intronic
992094980 5:73354418-73354440 GCATTTGGAAGACAGCGTGGTGG + Intergenic
992551786 5:77866365-77866387 GCATGTGGTAGCCACTGGGTGGG + Intronic
994166557 5:96615334-96615356 GCATTTGGCAGTCCCTAGGCAGG + Intronic
997227906 5:132223158-132223180 CCCTTTGGTAGCCACTGGGGAGG - Intronic
997480098 5:134178166-134178188 GCACCTGGCAGACACTGGATAGG - Intronic
999697921 5:154202771-154202793 GCGGTTGTCAGACACTGGTGTGG + Intronic
1004116351 6:12771621-12771643 GTATATGGCAGACCCTGGTGTGG - Intronic
1004289056 6:14350133-14350155 GCCATTTGCAGACACTGGGGTGG + Intergenic
1004482103 6:16030870-16030892 CCATTTTGCAGTCACTGGGCTGG + Intergenic
1005830429 6:29666821-29666843 GCATTGGGGAGACACTTGGTAGG - Intronic
1007717450 6:43865436-43865458 GCATTTGACCGGCACTGGTGTGG + Intergenic
1010261516 6:73822498-73822520 ACATTTGGGAAACACTGGTGTGG + Intronic
1011003083 6:82613461-82613483 ATATTTGGCAGGCACTGGGCTGG + Intergenic
1011411850 6:87074443-87074465 GCATGGAGCAGGCACTGGGGTGG + Intergenic
1013798199 6:113908902-113908924 GCATTTGGGAGACACTAGACGGG + Intergenic
1016463734 6:144305752-144305774 GCTTTTGGCTGACCCTGGGAAGG + Intronic
1019848484 7:3529624-3529646 CCATTTGGCAACCACTGTGGTGG + Intronic
1020902096 7:14017042-14017064 ACATTTGGAAGAGACTGGAGAGG - Intergenic
1023311864 7:38895741-38895763 GCTTTTGGCAGAGATGGGGGAGG - Intronic
1023900759 7:44476699-44476721 GAATTCGGCATGCACTGGGGGGG + Intronic
1024606466 7:51026383-51026405 GCCTGTGTGAGACACTGGGGTGG - Intronic
1025841978 7:65158667-65158689 GTGGTTAGCAGACACTGGGGAGG - Intergenic
1025881069 7:65537315-65537337 GTGGTTAGCAGACACTGGGGAGG + Intergenic
1025892370 7:65665300-65665322 GTGGTTAGCAGACACTGGGGAGG - Intergenic
1026001981 7:66566967-66566989 TCCTTTGGCAAACACTGAGGGGG - Intergenic
1026126863 7:67586912-67586934 GCATTTGGCAGACTTTGCAGAGG + Intergenic
1027160807 7:75800756-75800778 GCATCTGGCAGACACTGCTATGG - Intergenic
1029676828 7:102075522-102075544 CCACATGGCAGGCACTGGGGTGG - Intronic
1031086804 7:117310234-117310256 ACATTTGGCTGCCACTGGGAAGG - Intronic
1032012850 7:128358236-128358258 TCATTGGGAAGACACTGAGGAGG - Intronic
1037186291 8:16067503-16067525 GCATTTGACAAGCTCTGGGGTGG + Intergenic
1039138008 8:34349074-34349096 GCATTTGGCAAAAAGTGGAGGGG + Intergenic
1039900948 8:41752162-41752184 GCTGATGGGAGACACTGGGGAGG - Intronic
1040287608 8:46108452-46108474 GCAGATGGCAGACACTCAGGGGG - Intergenic
1041135745 8:54756902-54756924 GCATTTTCCAGACAGTAGGGAGG + Intergenic
1042368873 8:67968217-67968239 GCATCTGCCAGCGACTGGGGAGG + Intronic
1045074098 8:98543319-98543341 GCAATTGGTAGTCACTGGGAGGG + Intronic
1045522498 8:102915411-102915433 GGTTTTGGCAGACGCTGGAGTGG - Intronic
1045659635 8:104423970-104423992 GCATTTGCCAGGCACTGAAGTGG + Intronic
1045664163 8:104467504-104467526 GTAATTGGCAGACACAGGGAAGG + Intergenic
1051201069 9:14624623-14624645 GTAGTTAGCAGAGACTGGGGAGG + Intronic
1051335940 9:16066050-16066072 GCATTAGGGAGACAGTGGGATGG - Intergenic
1051365633 9:16319662-16319684 GCATTCGGGAGACACTGAGACGG + Intergenic
1052279060 9:26712386-26712408 ACATTTGAAAGACCCTGGGGAGG + Intergenic
1058415819 9:104787747-104787769 TCCCTTGGCACACACTGGGGTGG - Intronic
1059042089 9:110826149-110826171 GCATTTAGCTGACACTTGAGCGG - Intergenic
1059168043 9:112097693-112097715 GCATTTAGAAGACTCTGGGCCGG - Intronic
1060128570 9:121074254-121074276 GAATTTAGCAGATACTGGGCTGG - Intergenic
1061996773 9:134190118-134190140 GCCTTGGGGACACACTGGGGAGG - Intergenic
1186184766 X:7010017-7010039 CTTTTTGGTAGACACTGGGGAGG - Intergenic
1187261361 X:17687672-17687694 GCTTTTGGCCAACCCTGGGGTGG - Intronic
1187392680 X:18896297-18896319 GCAGAAGGGAGACACTGGGGGGG + Intronic
1190577646 X:51856965-51856987 GAATTTGTGAGACACTGGGGAGG + Intronic
1192896386 X:75447014-75447036 CCATTGGGCAGTAACTGGGGTGG - Intronic
1193344970 X:80395032-80395054 GTATTTGCCAGAGACTGGGGAGG - Intronic
1193606727 X:83578395-83578417 TCATTTGAAAGACACTGTGGTGG + Intergenic
1194215999 X:91130930-91130952 GGCAATGGCAGACACTGGGGAGG + Intergenic
1195386560 X:104318990-104319012 CCTTTTGGGAGACAGTGGGGAGG + Intergenic
1197157868 X:123289833-123289855 GAATTTGGCAGGGACTAGGGTGG - Intronic
1198627345 X:138591814-138591836 GCAGTTGGCAGCCACTGGAGGGG - Intergenic
1199685559 X:150262117-150262139 GTATCTGGCAGAGACTGGAGTGG + Intergenic
1200838763 Y:7758837-7758859 ACCCTTGGCAGACACTAGGGTGG - Intergenic