ID: 1181685371

View in Genome Browser
Species Human (GRCh38)
Location 22:24524306-24524328
Sequence TTAACTCGAAGGTCCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181685359_1181685371 25 Left 1181685359 22:24524258-24524280 CCCCTTGTGCTCCCAAGCCTTAG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685363_1181685371 13 Left 1181685363 22:24524270-24524292 CCAAGCCTTAGTACTCCCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685368_1181685371 -2 Left 1181685368 22:24524285-24524307 CCCAGTTGTAAAATACGGGGCTT 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685369_1181685371 -3 Left 1181685369 22:24524286-24524308 CCAGTTGTAAAATACGGGGCTTA 0: 1
1: 0
2: 1
3: 6
4: 66
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685362_1181685371 14 Left 1181685362 22:24524269-24524291 CCCAAGCCTTAGTACTCCCAGTT 0: 1
1: 0
2: 3
3: 6
4: 99
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685361_1181685371 23 Left 1181685361 22:24524260-24524282 CCTTGTGCTCCCAAGCCTTAGTA No data
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685364_1181685371 8 Left 1181685364 22:24524275-24524297 CCTTAGTACTCCCAGTTGTAAAA 0: 1
1: 0
2: 2
3: 29
4: 314
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1181685360_1181685371 24 Left 1181685360 22:24524259-24524281 CCCTTGTGCTCCCAAGCCTTAGT No data
Right 1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181685371 Original CRISPR TTAACTCGAAGGTCCCATGC TGG Intronic
1064218272 10:13418338-13418360 GCAACTAGATGGTCCCATGCAGG - Intergenic
1067805973 10:49394127-49394149 TTATCCCCAAGTTCCCATGCAGG - Intronic
1068917137 10:62444638-62444660 TTAACTGCCAGGGCCCATGCAGG - Intronic
1081350190 11:42042651-42042673 TTATATGGAAGGTCCTATGCTGG - Intergenic
1081859655 11:46325613-46325635 TTACCTCAAAGGCCCCAGGCCGG + Intergenic
1083932722 11:65854834-65854856 TTTAATCGAAGGTCCCTTACTGG + Exonic
1098176802 12:67800737-67800759 TTAACTTGAAGGTCTCTGGCAGG + Intergenic
1100729587 12:97449534-97449556 TTGACTCAAAGGTACCAGGCTGG - Intergenic
1103067160 12:117909101-117909123 TGAACTTCAGGGTCCCATGCTGG + Intronic
1110214548 13:73011506-73011528 TTAACTAGAAGCTACCCTGCTGG + Intronic
1111870349 13:93824378-93824400 TTAACTCTAATGTAGCATGCTGG + Intronic
1115990567 14:39145637-39145659 TTATCTCGCCGGTCCCAGGCTGG + Intergenic
1121479847 14:94256981-94257003 TTAACTCAAAGGGCCCTTCCAGG - Intronic
1127742111 15:61920122-61920144 TTGACTTGAAGGTACCATGCTGG + Exonic
1128480512 15:68033617-68033639 TCAACCCCAAGGTCCCATTCTGG + Intergenic
1137375683 16:47949895-47949917 TCATCTGGAAGGGCCCATGCTGG - Intergenic
1139122167 16:64033702-64033724 TTAACTAGATGGTCCCATCTAGG + Intergenic
1168384677 19:55953251-55953273 GCAACTCGATGGTCCCATCCAGG - Intronic
929998506 2:46845405-46845427 TAAACTCTAAGGTCCCTTTCAGG - Intronic
935947626 2:108300628-108300650 TTAACTCTAAGGCCCCATCCAGG + Intronic
946466580 2:219917411-219917433 TTTCCTAGAAGCTCCCATGCTGG + Intergenic
1170699254 20:18688622-18688644 ATATCTGGAAGGTCCCTTGCCGG + Intronic
1174046393 20:47736931-47736953 TTGACTTGCAGGTTCCATGCAGG - Exonic
1175492035 20:59385763-59385785 TGAACTCAAAGCTCCCAGGCAGG - Intergenic
1177900825 21:26913203-26913225 TTAACTGGAAGGTCCAAGACAGG - Intergenic
1177993846 21:28071760-28071782 GCAACTAGAAGGTCCCATGTGGG + Intergenic
1181685371 22:24524306-24524328 TTAACTCGAAGGTCCCATGCTGG + Intronic
955533476 3:59899203-59899225 TTACCTCCAGGGTCACATGCGGG + Intronic
974869481 4:67622037-67622059 CTAAAGCAAAGGTCCCATGCTGG + Intronic
980188322 4:129490884-129490906 TTAAATCAAAATTCCCATGCAGG - Intergenic
984233705 4:177131233-177131255 TTTAATCGAAGGTCGCATGGTGG + Intergenic
991699829 5:69307232-69307254 TTAACTCAATGGTCCCATCAAGG + Intronic
998915812 5:147010456-147010478 TCAACTAGATGGTCCCATGTTGG + Intronic
1005748695 6:28863900-28863922 TTATATCGAAAGTCCCGTGCTGG + Intergenic
1014354103 6:120382808-120382830 TTAACTCATAGGTCCCAGGGAGG + Intergenic
1028447469 7:90941748-90941770 CAAACTCGCAGGGCCCATGCTGG - Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1030664298 7:112257474-112257496 TTACCTGGCAGGTCCCTTGCAGG - Intronic
1035680196 8:1482526-1482548 TTAACTACAAGGTCCTCTGCAGG - Intergenic
1044416433 8:91945348-91945370 GGAACTCGAAGGTCCCATCTAGG + Intergenic
1044817032 8:96124068-96124090 TTATGTCGAAGGTCCCAGCCCGG + Intergenic
1047750347 8:127875896-127875918 TTATCTCCAAGGCCTCATGCTGG + Intergenic
1060853147 9:126894266-126894288 TAAACTCGAAGCTTCCATGAGGG - Intergenic
1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG + Intergenic
1200083950 X:153593641-153593663 GCAACACGAAGGGCCCATGCGGG + Intronic
1201578781 Y:15489550-15489572 GTAACTAGAAGATCTCATGCTGG - Intergenic