ID: 1181685675

View in Genome Browser
Species Human (GRCh38)
Location 22:24526153-24526175
Sequence CACCAGTGGGAAGAGGGTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 499}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181685675 Original CRISPR CACCAGTGGGAAGAGGGTGA GGG Exonic
900719230 1:4164562-4164584 CACCTGTGGGAGGAGGAAGATGG - Intergenic
900803946 1:4755283-4755305 CCCCTGTGGGAAGTGGGTGCGGG + Intronic
900859508 1:5218074-5218096 CAACAAGGGGAAGAGGGTCAGGG - Intergenic
900949752 1:5851826-5851848 CAGCAGGAGGAAGAGGGTGAAGG - Intergenic
901031579 1:6310232-6310254 AAAAGGTGGGAAGAGGGTGAGGG + Intronic
901139000 1:7015896-7015918 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901165233 1:7216140-7216162 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901296759 1:8166716-8166738 CACCTTTGAGAAGGGGGTGACGG + Intergenic
901731854 1:11285740-11285762 GACCAGTGGGAAGATGGCCAGGG - Exonic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
902479161 1:16702598-16702620 CACTAGTGGGCACAGGGTGGGGG - Intergenic
902596287 1:17511751-17511773 CAAAAGTGGGATGAGGATGAGGG + Intergenic
902840267 1:19069916-19069938 CAGAAGGAGGAAGAGGGTGAAGG - Intergenic
903328924 1:22586974-22586996 CGCCTGTGCGGAGAGGGTGAGGG + Intronic
903674519 1:25055600-25055622 CACCACCGGGGAGAGGGTGTTGG + Intergenic
903740526 1:25556101-25556123 CCCCGGTGGGCAGAGCGTGAAGG - Intronic
906289874 1:44612900-44612922 AACCAGTGGGAAGAAGAAGAAGG + Intronic
906594942 1:47067629-47067651 AACCAGTGGGCAGGGGGTGCAGG - Exonic
906941179 1:50256841-50256863 CAGCAGAGGGCAGAGGATGAAGG - Intergenic
907246583 1:53113032-53113054 CTGCAGTGGGAAGAGGGTCGTGG - Intronic
907306781 1:53517741-53517763 GAACAGAGGGGAGAGGGTGAGGG - Intronic
907551518 1:55309007-55309029 CACCGGTGGGAAGAGGGAAGAGG + Intergenic
907875949 1:58488768-58488790 AAACAGTGAGAAGTGGGTGAGGG - Intronic
910509760 1:87990652-87990674 GACCAGTGGGGAGAAGGTCATGG - Intergenic
911677312 1:100674210-100674232 CAACAGGGGAAAGGGGGTGAGGG - Intergenic
912801995 1:112725530-112725552 CAACAGTGGGAATGGGGTGGGGG - Intronic
914454876 1:147826636-147826658 GAAGCGTGGGAAGAGGGTGAGGG - Intergenic
914733627 1:150395143-150395165 AAAGAGTGGGAAGGGGGTGAGGG - Intronic
914804836 1:150984239-150984261 CAGCAGAGGGACGGGGGTGAGGG - Intronic
915733150 1:158068089-158068111 CAGCAGTGGGAAGGCGGTAAAGG + Intronic
916463213 1:165047739-165047761 CTGAAGTGGGAAGAGGGTGAGGG - Intergenic
916598650 1:166271364-166271386 CACTAGTGGGGAGAGGGAGTAGG - Intergenic
917456889 1:175193094-175193116 CACCGGCGGGAAGACGGGGAGGG - Intergenic
917521571 1:175752149-175752171 GAACTGTGGGAAGGGGGTGAGGG + Intergenic
917593962 1:176508802-176508824 CAGCAGGAGGGAGAGGGTGAAGG - Intronic
917594028 1:176509482-176509504 CAGCAGGAGGGAGAGGGTGAAGG + Intronic
918128835 1:181607458-181607480 GACCAGTGGGAAGGGGAGGAAGG - Intronic
919279968 1:195476785-195476807 GAACAGTGGGAGGTGGGTGAGGG + Intergenic
919897601 1:202018754-202018776 CTCCTGGGGGAAGTGGGTGAAGG + Intergenic
921159270 1:212461819-212461841 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
921963126 1:221057217-221057239 GGCGAGTGGGATGAGGGTGAAGG - Intergenic
922291312 1:224211058-224211080 TTCCAGTGGGAAGAGGGTACAGG - Intergenic
922628199 1:227075044-227075066 CTCAAGTGGGGAGAAGGTGAGGG + Intronic
922878336 1:228959089-228959111 CACTTGGGGGAAGAGGGTGTGGG + Intergenic
923171282 1:231420386-231420408 AAACAGTAGGAACAGGGTGAGGG + Intronic
923367063 1:233272996-233273018 AAAGAGTGGGAGGAGGGTGAGGG + Intronic
923626169 1:235615741-235615763 CACCAGGAGGAGGGGGGTGATGG + Intronic
923802937 1:237228114-237228136 AAAGGGTGGGAAGAGGGTGAGGG - Intronic
924448480 1:244156297-244156319 AGGCAGTGGGTAGAGGGTGAGGG - Intergenic
1062886985 10:1024175-1024197 CATCAGTGGGAAGGGGGTTCTGG + Intronic
1063282479 10:4645433-4645455 CAAGAGTGAGAAGAGAGTGAAGG - Intergenic
1065447640 10:25819807-25819829 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
1065689543 10:28319165-28319187 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
1065731542 10:28713823-28713845 CAGCACAGGGAAAAGGGTGAAGG - Intergenic
1066020955 10:31301294-31301316 CACCAGTGGCTAGAGGGTGGAGG - Intergenic
1066255334 10:33673036-33673058 CACCTGTGGGAAGATATTGAGGG + Intergenic
1067748785 10:48956507-48956529 AAGCAGAGGGAGGAGGGTGAAGG - Intronic
1068522800 10:58095639-58095661 CACCAGTGTGCAGAGAGAGAAGG + Intergenic
1069436173 10:68385546-68385568 GAACAGTGGGAAGAGAGGGACGG + Intronic
1069567818 10:69475124-69475146 AACCAGGGGGAGGAGGGTGTTGG + Intronic
1069652800 10:70062879-70062901 GAAAGGTGGGAAGAGGGTGAGGG + Intronic
1070761626 10:79027749-79027771 CACGAGGGGGAGGTGGGTGAAGG - Intergenic
1071054201 10:81490474-81490496 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1072392686 10:95004305-95004327 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
1075002503 10:118808852-118808874 CCACAGCGGGAAGAGGCTGAGGG + Intergenic
1075177403 10:120178551-120178573 CACCAGTGGGTAGAGCCTGGAGG - Intergenic
1075405630 10:122193866-122193888 CACCGGTGGAAGCAGGGTGATGG + Intronic
1075904154 10:126065939-126065961 CAGCATTAGGAAGAGGATGAAGG + Intronic
1075995017 10:126870084-126870106 AATCAGTGGAAAGTGGGTGAAGG + Intergenic
1076641911 10:131923149-131923171 TACCAGAGGGCAGAGGGTGGAGG - Intronic
1076664992 10:132082369-132082391 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1076812790 10:132897994-132898016 CTCCAGTGGGAGGAGGAGGACGG - Intronic
1077097327 11:804627-804649 CACCACTGGAAAGAGGGTTGGGG + Intronic
1077236276 11:1483449-1483471 CACCTGTTGGAATAGTGTGAGGG - Intronic
1077373778 11:2195730-2195752 CACCTGTGGAATGGGGGTGATGG - Intergenic
1077382328 11:2249937-2249959 CACTAGAGGGAGGAGGCTGAGGG + Intergenic
1080759906 11:35238399-35238421 AACCAGAAAGAAGAGGGTGAAGG + Intergenic
1081441341 11:43084949-43084971 GACCAGGAGGAAGAGAGTGAAGG + Intergenic
1081710283 11:45211708-45211730 GAAGAGTGGGAAGGGGGTGAGGG - Intronic
1082224244 11:49683609-49683631 CCCCATTAGGAAGAGTGTGATGG - Intergenic
1083048409 11:59755942-59755964 CAGCAGTGGGCAGGTGGTGAAGG - Intronic
1083077513 11:60056369-60056391 GACAAGTGGGAAGAGGTTGTGGG - Intergenic
1083305997 11:61762300-61762322 CAGCAGTGGGAAGTTGTTGAAGG + Intronic
1083347457 11:62003481-62003503 CACAGGTGGGAACAGGCTGAAGG + Intergenic
1084042682 11:66551406-66551428 CAGCAGGGGGAATAGGGTGGCGG + Intronic
1084220991 11:67679025-67679047 GAAGAGTGGGAAGGGGGTGAGGG + Intronic
1084411579 11:69009090-69009112 CACTACGGGGAAGAGGGAGAGGG + Intronic
1084990241 11:72916049-72916071 TACCAGAGGGTAGAGGGTGGAGG + Intronic
1085019486 11:73196506-73196528 CAACAGTGGAAAGAGGACGAAGG - Intergenic
1085034620 11:73292609-73292631 CAGCAGGGGAAAGAGGGGGATGG - Intronic
1085138475 11:74117589-74117611 CAAGAGTGGGAAGAAGGTGAGGG + Intronic
1085865283 11:80283406-80283428 CAGCAGTGGGAAGAGGGAGCAGG - Intergenic
1086490965 11:87357434-87357456 CCCAAGTGGGAAGTGAGTGAAGG - Intergenic
1086624802 11:88935585-88935607 CCCCATTAGGAAGAGTGTGATGG + Intronic
1087127331 11:94640856-94640878 GACAGGTGGGAAGAGGGGGATGG - Intergenic
1087322746 11:96683392-96683414 CACAAATGGGAAGAGGAAGATGG - Intergenic
1087999693 11:104862374-104862396 CATGAGTGGGAACTGGGTGATGG + Intergenic
1089176440 11:116552183-116552205 CAGCAGGGTGAAGAGGGTGCAGG - Intergenic
1089453895 11:118614656-118614678 CTCCAGCGGCAGGAGGGTGATGG - Exonic
1090529710 11:127578091-127578113 CACCAGTAGTAAGAAGGTGCTGG + Intergenic
1090962648 11:131570934-131570956 CTCCAGAGGGAAGAGAGTGGCGG + Intronic
1091356861 11:134944108-134944130 GACCAGTGGGAAGCAGGAGAAGG + Intergenic
1092651927 12:10644167-10644189 TACCAGTAGGAACAGGGAGAAGG + Intronic
1093306599 12:17528033-17528055 CACCAGTGTGACCAGGGTGTGGG + Intergenic
1093412140 12:18879549-18879571 CACAAATGGGAACAGGGTGGGGG + Intergenic
1095780180 12:46049980-46050002 CCCCACTGGGAAGGGGGTAAAGG + Intergenic
1099018255 12:77371446-77371468 TACCAGTGGGAAGAGGGAGAGGG + Intergenic
1099588051 12:84546440-84546462 CACCAGTGGCAAGTGTCTGAGGG + Intergenic
1102464769 12:113122217-113122239 TACCAGGGGGAAGTGTGTGATGG - Intronic
1102532148 12:113554338-113554360 CAGCACTGGGGAGTGGGTGATGG + Intergenic
1102630109 12:114270622-114270644 CGATAGTGGGAAGAGGATGAGGG + Intergenic
1103900149 12:124299495-124299517 AAAGGGTGGGAAGAGGGTGAGGG - Intronic
1104058529 12:125248802-125248824 CCACAGTGGGCAGAGGGAGAAGG - Intronic
1104160690 12:126177342-126177364 AAAGGGTGGGAAGAGGGTGAGGG + Intergenic
1105531478 13:21224603-21224625 CGCCAATGGGAAGAGTCTGAAGG - Intergenic
1105961277 13:25343159-25343181 AAGGGGTGGGAAGAGGGTGAGGG - Intronic
1106120614 13:26857348-26857370 AAACAGTGGGAAGAGGGTGAGGG - Intergenic
1107031027 13:35853908-35853930 CACCCTAAGGAAGAGGGTGAGGG - Intronic
1108125236 13:47235558-47235580 AAAGAGTGGGAAGAGGGAGAGGG - Intergenic
1110369250 13:74721096-74721118 CACCAGCGGGGAGGGGGAGAAGG + Intergenic
1110641395 13:77829010-77829032 CATCACTGGGAAGAATGTGAGGG - Intergenic
1111706737 13:91759509-91759531 GAGTAGTGGGAAGAGGGTAATGG - Intronic
1112019391 13:95358557-95358579 CACCAGTGGGGTGGGAGTGAGGG + Intergenic
1113793113 13:113041189-113041211 CACCAGAGGGATGAAGGTGATGG - Intronic
1113811353 13:113144336-113144358 GCCCAGTGGGAAGGGGCTGAGGG - Intronic
1113890418 13:113732450-113732472 CACCAGTGGGTACAGTGTGAAGG - Intronic
1117845640 14:59908586-59908608 GACAAGTGGGAAGGGGATGAGGG - Intergenic
1118776276 14:68976304-68976326 CACAAGTGGACAGAGGCTGATGG - Intronic
1119031934 14:71199617-71199639 CTCCAAAGGGAAGAGGATGATGG + Intergenic
1119528044 14:75338207-75338229 CAGCAGTGAGAAAAGGGAGAAGG - Intergenic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1120494990 14:85223759-85223781 CACCAGAGAGAAGAGACTGAGGG + Intergenic
1121001706 14:90455785-90455807 TCCCAGTGGGACCAGGGTGAGGG + Intergenic
1121398441 14:93648916-93648938 CAGCAGTGGGAAGACAGTGAAGG + Intronic
1121967847 14:98326871-98326893 CACCACTGGGAACTGGGTAAGGG + Intergenic
1122784069 14:104155851-104155873 GCCCTGTGGGAAGAGGGTGGAGG + Intronic
1123130883 14:105984378-105984400 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123581114 15:21715599-21715621 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123617763 15:22158222-22158244 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123812768 15:23945668-23945690 CAAGGGTGGGAGGAGGGTGATGG - Intergenic
1123899189 15:24859108-24859130 CACCAATGGGAAAAGGGTACAGG + Intronic
1124683029 15:31753441-31753463 AAAGAGTGGGAAGGGGGTGAAGG - Intronic
1126109594 15:45167592-45167614 ACCCAGTGGGGAGAGGGTGGTGG + Exonic
1126925556 15:53582060-53582082 CAACTGTATGAAGAGGGTGAAGG - Intronic
1127264050 15:57346900-57346922 CAGCAGAGGAAAGAGAGTGAGGG + Intergenic
1128079971 15:64851135-64851157 AAGCAGTGGGAAGAGGGCAAGGG + Intronic
1128698170 15:69784444-69784466 AAAGAGTAGGAAGAGGGTGAGGG - Intergenic
1129112109 15:73343377-73343399 CACCAGTGGGAAGAGGTAAGTGG - Exonic
1129262864 15:74378541-74378563 CACCTGGGGGAACCGGGTGAAGG - Intergenic
1129339562 15:74876322-74876344 CACAAGTGGGAGGATGGGGAAGG + Intergenic
1129590187 15:76907852-76907874 GTCCAGTGGGAAAAGAGTGAAGG - Intergenic
1129691191 15:77714514-77714536 CACCTGTGGGAGGACCGTGAGGG - Intronic
1130028604 15:80292219-80292241 CACCAGTGGGAAGATATTAAGGG + Intergenic
1130272708 15:82460447-82460469 CCCCAGTGGGAAGAGGACTAGGG + Intergenic
1130353315 15:83109390-83109412 AGCCACTGGGAAGATGGTGATGG + Intronic
1130465060 15:84187801-84187823 CCCCAGTGGGAAGAGGACTAGGG + Intergenic
1130487628 15:84407003-84407025 CCCCAGTGGGAAGAGGACTAGGG - Intergenic
1130499205 15:84485736-84485758 CCCCAGTGGGAAGAGGACTAGGG - Intergenic
1130587350 15:85192414-85192436 CCCCAGTGGGAAGAGGACTAGGG + Intergenic
1131107585 15:89745286-89745308 CACCAGCGGGACGAGGGAGAAGG + Intergenic
1131114118 15:89783739-89783761 CACAAGGGGGAAGAGGGCCAAGG + Intergenic
1131143731 15:89998970-89998992 CACAAGTGGGAAAAAGGGGAGGG - Intergenic
1131511006 15:93049459-93049481 CACAGATGGGAAGAGGGTGATGG + Intronic
1131586140 15:93694996-93695018 AAAGAGTGGGAAGAGGGTAAGGG - Intergenic
1131601295 15:93851454-93851476 AAAGAGTGGGAAGAGGGTGAGGG - Intergenic
1132012406 15:98287682-98287704 CACCAGATGAAACAGGGTGAGGG + Intergenic
1132626683 16:894728-894750 ACACGGTGGGAAGAGGGTGAGGG + Intronic
1133241569 16:4417047-4417069 CACCAGTGGTAAGAGGCAGAGGG + Intronic
1133581548 16:7149379-7149401 CACCAGTGGGAATGGAGTGGGGG - Intronic
1133983892 16:10653267-10653289 CTCTGGTGGGAAGAGGGTGGTGG + Intronic
1133997086 16:10756667-10756689 CTGCAGAGGGAACAGGGTGAGGG - Intronic
1134855832 16:17518290-17518312 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1136074700 16:27808939-27808961 CATCAGTGGGACGCAGGTGAAGG - Intronic
1136296745 16:29308362-29308384 GACCAGTGCGAAGATGGTGTGGG - Intergenic
1138353881 16:56362517-56362539 ACCCAGTGGGAAGAGTGTGGGGG - Exonic
1138499490 16:57430507-57430529 CAGAAGTGGGAGGAGGATGAGGG + Intronic
1139482063 16:67236173-67236195 CCGCAGTGGGAAGTGGGGGAAGG + Intronic
1141057210 16:80829516-80829538 TAGCAGTGGGAAGGAGGTGATGG - Intergenic
1141254291 16:82386415-82386437 CACCAGTGGGGAGAGGGACAGGG - Intergenic
1141864478 16:86740679-86740701 GAAGGGTGGGAAGAGGGTGAGGG + Intergenic
1142020784 16:87780899-87780921 AGCCTGTGGGGAGAGGGTGAAGG - Intergenic
1142169863 16:88616029-88616051 CCCCAGAGGAAAGCGGGTGACGG + Intronic
1142509263 17:384398-384420 CACCAGCGGGAAGTGAGTGAGGG + Intronic
1143580046 17:7820186-7820208 AAGCAGTGGGAAGATGGGGAGGG - Intronic
1144009263 17:11130512-11130534 AAACAGGAGGAAGAGGGTGAAGG + Intergenic
1144147625 17:12413703-12413725 CAAGAGTGGGAGGCGGGTGAGGG - Intergenic
1144701554 17:17344061-17344083 CACCAGTGGCGAGAGGATGCCGG + Intronic
1145061497 17:19737165-19737187 CAGGAGTGGGAAGGGGGTGGTGG + Intergenic
1145773652 17:27511340-27511362 CACCAGTGTGGAGAGGTAGAAGG + Intronic
1145902031 17:28495725-28495747 CACCAGGAGGGAGAGGATGATGG - Exonic
1146477123 17:33171986-33172008 GACCAGTGTGAAAAGGGAGAGGG - Intronic
1146598661 17:34192303-34192325 CATCAGCTGGAAGAGGTTGATGG + Intergenic
1146916245 17:36680194-36680216 CCCCAGAGGGAAGCGGGTGGTGG + Intergenic
1148583922 17:48763343-48763365 CACCAGTGGGAAGTGTGTCTTGG + Intronic
1148769726 17:50059956-50059978 CACCAGTGGGGAGAGGGGGCTGG + Intronic
1148901755 17:50883923-50883945 CCCCAGTGGGTGCAGGGTGACGG - Intergenic
1148911259 17:50944376-50944398 CACCAGGGGCAAGAAGGTGGAGG - Intergenic
1148977529 17:51542741-51542763 CAGCAGGGGGAAGAGGAAGAGGG + Intergenic
1149119884 17:53150239-53150261 CACCTGTGTGGAGAGGGTTAGGG - Intergenic
1150001537 17:61443654-61443676 AACGAGGGGGAAGCGGGTGAGGG - Intergenic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1150595869 17:66604037-66604059 CTTCAGTGGGAAGCGGGGGAAGG - Intronic
1151141160 17:71993364-71993386 AAACAGTGGGAAGAGGCTGCAGG - Intergenic
1151758863 17:76089568-76089590 CACCAGAGGCAGGAGAGTGACGG + Intronic
1153612304 18:6898885-6898907 CAAAAGGGGGAAGAGGGTGAGGG + Intronic
1153929647 18:9866853-9866875 AGCCAGTGGGAGGAGGGTGGTGG + Intergenic
1155577813 18:27267070-27267092 AAGGAGTGGGAGGAGGGTGAAGG + Intergenic
1155761272 18:29570403-29570425 CCCTAGTAGGAAGAGGGTGGTGG + Intergenic
1156037256 18:32778924-32778946 CCCCAGCGGGAAAAGGGTGGTGG - Intergenic
1157110290 18:44814131-44814153 GGCCAGTGGGAGTAGGGTGATGG + Intronic
1160858267 19:1227036-1227058 CACCAGTGGGTGGTGGGTGGTGG + Intronic
1160961066 19:1721038-1721060 GACCTTTGGGGAGAGGGTGAGGG - Intergenic
1161335172 19:3709048-3709070 CAGCGGTGAGAACAGGGTGAGGG - Intronic
1161769183 19:6222204-6222226 CACCAGAGGGGAGAAGGTGAAGG - Exonic
1161818567 19:6515514-6515536 CTGGAGTGGGAAGAGGGTGCAGG + Intergenic
1162037801 19:7951757-7951779 AGCCAGAGGGAAGAGGCTGAGGG - Intergenic
1162849118 19:13417095-13417117 CCCCCTTGGGGAGAGGGTGACGG - Intronic
1163270237 19:16248642-16248664 AACTGGTGGGAAGTGGGTGAGGG - Intergenic
1163741823 19:19018974-19018996 CTCCAGTGAGAAGAGCATGAGGG - Intronic
1164254154 19:23512441-23512463 AACCGGTGGGAAGCGGTTGATGG - Intergenic
1165335311 19:35165808-35165830 CCCCACTGGGAAGGGAGTGAAGG + Intronic
1166125705 19:40714487-40714509 CCCCAAGGGGAAGAGGCTGAGGG - Intronic
1166331705 19:42081488-42081510 CACCAGTGCTAAGAGGTGGAAGG - Exonic
1166558288 19:43716097-43716119 TATCAGTGGGGAGAGTGTGAGGG + Exonic
1167368582 19:49067309-49067331 CACCAGTGGGAAGCATGGGAAGG - Intergenic
1168582933 19:57570351-57570373 GACCTGTGGGTAGAGGGAGAAGG + Intergenic
1168635237 19:57991032-57991054 AAGCAGTGGGACGAGGGTGCAGG - Intronic
1202713200 1_KI270714v1_random:28504-28526 CACTAGTGGGCACAGGGTGGGGG - Intergenic
924965202 2:70097-70119 CACTATTGGGAAAAGGGCGATGG + Intergenic
926288277 2:11508161-11508183 CCACAGTGGGGAGAGGCTGAAGG - Intergenic
928175338 2:29029801-29029823 AACTAGTGGCAAGGGGGTGAGGG + Intronic
928265553 2:29808593-29808615 GGCCAGTGAGAAGAGGGTAATGG - Intronic
928680791 2:33700276-33700298 CTGCAGTGGGAGGAGGGTGCAGG - Intergenic
928798784 2:35060246-35060268 AAAAAGTGGGAAGGGGGTGAGGG + Intergenic
929500421 2:42486400-42486422 CACCACTGGGTAGAGAATGAAGG - Intronic
929599112 2:43194105-43194127 CACCAGTAAGTAGAGGGTGGAGG + Intergenic
929814084 2:45217522-45217544 CAACAGGAGGAAGAGAGTGAAGG - Intergenic
930956130 2:57205015-57205037 CTCCAGAGGGTAGATGGTGAGGG + Intergenic
931517418 2:63058191-63058213 CACCAGAAAGAAGAGGGGGAGGG + Intergenic
931518285 2:63066959-63066981 TCCCAGTGGGAAGAGGTAGAAGG - Intergenic
931524593 2:63138841-63138863 GAAGAGTGGGAAGGGGGTGAGGG - Intronic
931897925 2:66754012-66754034 CTGGGGTGGGAAGAGGGTGAGGG - Intergenic
932875069 2:75442811-75442833 GAAGGGTGGGAAGAGGGTGAGGG + Intergenic
934715345 2:96539721-96539743 CAGCAGCGGGGAGAGGGGGAGGG - Intronic
937301954 2:120848051-120848073 AAGCTGTGGGAAGAGGGAGAAGG + Intronic
937410121 2:121667739-121667761 CACCAGTGGCAGAAGGGTAAGGG + Intergenic
939019000 2:136936671-136936693 AAAGGGTGGGAAGAGGGTGAGGG + Intronic
939059627 2:137404856-137404878 GAACAGTGGGAGGGGGGTGAGGG + Intronic
939358179 2:141131976-141131998 CAAGAGTGGGAAGGGGGTGAAGG - Intronic
941165098 2:162075449-162075471 CAGCAGTTGGAAGAGGGAGGAGG - Intergenic
941788656 2:169526377-169526399 CATCTGTGGCAGGAGGGTGAGGG + Intergenic
942629556 2:177940997-177941019 CACCAGTTGGGAGAAGGTTAGGG + Intronic
942821774 2:180123227-180123249 CTCCAGTGGGAAGAGGTTAATGG + Intergenic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943228204 2:185208744-185208766 CACCAGTGGAAAGATAGTCAAGG + Intergenic
943780846 2:191821900-191821922 CACAATTGTGAAGTGGGTGAAGG - Intergenic
944190000 2:196992589-196992611 CAGTAGTGTTAAGAGGGTGAGGG + Intronic
944269489 2:197765182-197765204 AAGGAGTAGGAAGAGGGTGAGGG + Intronic
944602587 2:201318945-201318967 AAAGAGTGGGAAGGGGGTGAGGG + Intronic
945918859 2:215734271-215734293 CAAGGGTGGGAAGGGGGTGAGGG - Intergenic
946161186 2:217836991-217837013 CAGCTGTGGGAAGAGGGAGTGGG - Intronic
947046960 2:225998688-225998710 AAAAAGTGGGAAGGGGGTGAGGG - Intergenic
947813038 2:233016113-233016135 AACTCGTGAGAAGAGGGTGAAGG + Intergenic
947824530 2:233095835-233095857 CAACAGTGGGACTAGGGTGGGGG - Intronic
947903774 2:233744298-233744320 CACAGGAGGGAAGAGGGTGGTGG + Intronic
947905163 2:233755649-233755671 CACAGGAGGGAAGAGGGTGGTGG + Intronic
947986459 2:234451791-234451813 CACAACTGGGAGGAGAGTGAAGG + Intergenic
948702364 2:239768418-239768440 CATCAGTGGGAAGAGGTGGGAGG - Intronic
948880638 2:240855639-240855661 CACTTGGGAGAAGAGGGTGATGG + Intergenic
1171069449 20:22053463-22053485 GAAGAGTAGGAAGAGGGTGAGGG - Intergenic
1171815346 20:29781475-29781497 GAGCAGGGGGAAGAGAGTGAGGG + Intergenic
1172569942 20:35962152-35962174 CTCCAGTGGCCAGAGGGTGACGG - Intronic
1172614589 20:36274859-36274881 CACCTGTGGGTAGGGGGTGGGGG + Intergenic
1172645779 20:36468404-36468426 CCCCAGTGGGCAGAGGGAAAGGG + Intronic
1173263451 20:41457251-41457273 CACCAATGGGGTGAGTGTGATGG - Exonic
1173639690 20:44592224-44592246 CACAATTGGGAAGAAGGAGAAGG + Intronic
1173727048 20:45305467-45305489 CACCAGTGGGAGGAGGGGAGCGG - Intronic
1173837396 20:46134876-46134898 AGCCAGTGGGCAGGGGGTGAGGG + Intergenic
1174511611 20:51057725-51057747 CAGCAGTGGGAAGTCAGTGAAGG + Intergenic
1175433141 20:58921436-58921458 AAAGGGTGGGAAGAGGGTGAAGG + Intergenic
1175563847 20:59956543-59956565 GAAGAGTGGGAAGAGGGTGAGGG - Intergenic
1175613987 20:60376971-60376993 CAGCAGAGGGAAGAAGGTGAGGG + Intergenic
1175817487 20:61891057-61891079 CACCAGCGGAAGGAGGGAGAGGG + Intronic
1176026143 20:62986554-62986576 TACAGGTGGGAAAAGGGTGATGG + Intergenic
1176120037 20:63450206-63450228 GAGCAGTGGGAAGAGGGTTTGGG - Intronic
1176390617 21:6161253-6161275 CGCCAGTGGCAACAGGGTGATGG - Intergenic
1176667314 21:9699719-9699741 CACCAGTGGAATAAGGGTGGAGG - Intergenic
1176667377 21:9699994-9700016 CACCAGTGGAATAAGGGTGGAGG - Intergenic
1176980442 21:15375520-15375542 GAACAGTGGGGAGAGGGGGAGGG + Intergenic
1177963744 21:27701486-27701508 CAAGAGTGGGAGGGGGGTGAGGG + Intergenic
1178711792 21:34923779-34923801 CAGCAGTGGGGAGGAGGTGAGGG - Intronic
1178721792 21:35016985-35017007 CAGTAATGGGAAGGGGGTGAGGG + Intronic
1178925940 21:36775077-36775099 CTCCAGTGGGAGGATTGTGATGG - Intronic
1179106252 21:38403384-38403406 CCCCAGTGGGAACTGGGCGAGGG + Intronic
1179469152 21:41598921-41598943 CACCAGATGGGAGAGGGTGTAGG - Intergenic
1179732850 21:43376986-43377008 CGCCAGTGGCAACAGGGTGATGG + Intergenic
1180202048 21:46229757-46229779 CAGCAGAGGGAAGAGGAAGATGG + Intergenic
1181363257 22:22354890-22354912 CACCTGTGGGACCAGGCTGAAGG - Intergenic
1181685675 22:24526153-24526175 CACCAGTGGGAAGAGGGTGAGGG + Exonic
1182711998 22:32328992-32329014 CACCAGTAGGAAGAGGAAGCAGG - Intergenic
1184399542 22:44265876-44265898 CACCAGTAGGAAGAGGAAGCAGG - Intronic
1184597235 22:45521559-45521581 CCCCAGTGAGAACAGGGTAAAGG - Intronic
1184746407 22:46458631-46458653 GACCAGAGGGAAGAGGCTGGAGG + Intronic
1184885845 22:47344007-47344029 GAGCATTGGGAAGAGGGTCAAGG + Intergenic
1184935184 22:47716005-47716027 CTGCAGTGGGAAGAGGATGCAGG + Intergenic
1185078622 22:48696678-48696700 CAACAGTGGTATGGGGGTGAAGG - Intronic
1185148996 22:49153668-49153690 CACCAGTGGAAGGAGGTTGCCGG - Intergenic
1185355557 22:50367467-50367489 GAGCAGTGGGCAGAGGATGAGGG + Intronic
951487415 3:23229432-23229454 AAAGGGTGGGAAGAGGGTGAGGG - Intronic
952262554 3:31754418-31754440 CTCCAGTGGAGAGAGGGTGCTGG + Intronic
952754338 3:36852955-36852977 AACCTGGGGGAAAAGGGTGATGG - Intronic
953160069 3:40410855-40410877 TACAAATGAGAAGAGGGTGATGG + Intronic
954687815 3:52380120-52380142 CACCAGTGAGAGTAAGGTGAGGG + Exonic
954843612 3:53534597-53534619 AACCAGTGGGCAGAGAGAGACGG - Intronic
955148058 3:56339667-56339689 CAGGGGTGGGAAGAGGGAGAGGG - Intronic
955195310 3:56800697-56800719 CACCACTGGGGAAAGGCTGAAGG - Intronic
956754088 3:72368377-72368399 CCCCAGGGGGAAGAGAGGGAAGG - Intergenic
957568056 3:81909473-81909495 CACCAGTGGGAGGTGGGGGGTGG - Intergenic
958942199 3:100328929-100328951 AAAGAGTGGGAAGGGGGTGAAGG + Intergenic
959411791 3:106032972-106032994 AACTAGTGGGAAAAGGGAGATGG + Intergenic
959624055 3:108429848-108429870 AACCAGTTGGAAGAGGATCATGG - Intronic
961022613 3:123521660-123521682 CACCACAGGGAGGAGGGTGCAGG + Intronic
961141102 3:124557216-124557238 ACCCAGTGGGAAGTGGATGAGGG - Intronic
961380287 3:126492365-126492387 AGGCAGTGGGAAGAGGCTGAGGG + Intronic
961457033 3:127029420-127029442 CACCTGTGGGCAGAGGGCCAGGG - Exonic
961841205 3:129714111-129714133 CACCTTTGGGGAGGGGGTGAGGG + Intronic
962001661 3:131304905-131304927 CACCATTGGGAATGGAGTGATGG + Intronic
962013507 3:131417274-131417296 AAAGAGTGGGAGGAGGGTGAGGG + Intergenic
963574072 3:147037214-147037236 CACCTGTGGGAGGGGAGTGATGG + Intergenic
964536152 3:157724586-157724608 GAAGAGTGGGAAGAGGCTGAGGG + Intergenic
964937120 3:162103488-162103510 TACTAGAGGGAAGAGGGAGAGGG - Intergenic
966004507 3:174993318-174993340 AACCAGGGGGAACATGGTGAAGG - Intronic
967109461 3:186280822-186280844 GCCCAGTGGGAAGAGGGACAGGG + Intronic
967459079 3:189724466-189724488 AAAGGGTGGGAAGAGGGTGAGGG - Intronic
969457359 4:7307633-7307655 CATCAGAGGGAAGCGGCTGAGGG + Intronic
971369395 4:26003711-26003733 CAACACTGGCAAGAGTGTGAAGG - Intergenic
971948707 4:33315511-33315533 CACCAGTGGGGACAGTGTGTGGG - Intergenic
972839102 4:42910099-42910121 GACGAGAGGGAAGAGTGTGAAGG + Intronic
975195032 4:71514323-71514345 CAGCAGGAGGAAGAGGGTGAAGG - Intronic
975242011 4:72070934-72070956 AACTATTGGCAAGAGGGTGAAGG - Intronic
975945362 4:79699057-79699079 GACTAGTGGGATGAGAGTGAAGG + Intergenic
978158009 4:105511376-105511398 CAAGGGTGGGAAGCGGGTGAGGG - Intergenic
979483137 4:121241012-121241034 CAAGGGTGGGAGGAGGGTGAGGG - Intergenic
979524052 4:121698570-121698592 CGCCAGTGGGGTGGGGGTGATGG - Intergenic
980014966 4:127639053-127639075 CATCAGGGGAAAGTGGGTGAAGG - Intronic
981259929 4:142707568-142707590 GAGCAGGAGGAAGAGGGTGAAGG - Intronic
981422363 4:144565673-144565695 AACCAGTGGGGAGAGAGTGTTGG + Intergenic
982070662 4:151691693-151691715 CTCCAGTTGGAATAGGATGAAGG + Intronic
982353725 4:154444361-154444383 CACCTGGGGGAAGAGGTTTAGGG - Intronic
982364392 4:154559302-154559324 CACCTGTGGTTAGAGGGTCAGGG + Intergenic
982657908 4:158171490-158171512 CTCCAGTGGGCAGAGGTGGAAGG + Exonic
983732299 4:171011036-171011058 CACAAGTTGGAAGAGCTTGAGGG + Intergenic
985320696 4:188707787-188707809 TACCAGTGGGAGAAGGGTAAGGG - Intergenic
985407430 4:189651600-189651622 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407442 4:189651644-189651666 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407454 4:189651688-189651710 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407466 4:189651732-189651754 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407478 4:189651776-189651798 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407490 4:189651820-189651842 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407502 4:189651864-189651886 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407514 4:189651908-189651930 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407526 4:189651952-189651974 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407538 4:189651996-189652018 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407550 4:189652040-189652062 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407562 4:189652084-189652106 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407574 4:189652128-189652150 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407586 4:189652172-189652194 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407598 4:189652216-189652238 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407619 4:189652305-189652327 CACCAGTGGAATAAGGGTGGAGG + Intergenic
985407671 4:189652527-189652549 CACCAGTGGAATAAGGGTGGAGG + Intergenic
986511595 5:8512795-8512817 CAGCAGGAGGAAGAGAGTGAAGG + Intergenic
987425989 5:17773043-17773065 AAAGAGTGGGAAGCGGGTGAGGG - Intergenic
987862257 5:23503953-23503975 GAGCAGGAGGAAGAGGGTGAAGG - Intergenic
989690285 5:44135397-44135419 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
989824758 5:45839633-45839655 AACCAGTAGGTAGAGGGTAAGGG + Intergenic
990630403 5:57662477-57662499 CAGAGGTGGGAAGAGAGTGAGGG - Intergenic
991351399 5:65723067-65723089 GACCAGTAGCAAGATGGTGAGGG + Intronic
993614231 5:90090768-90090790 GAAGGGTGGGAAGAGGGTGAGGG + Intergenic
994104732 5:95934571-95934593 CTCCAGTGGAAAGAAGGTGCAGG - Intronic
994684031 5:102926763-102926785 CCCTAGTGGGCAGAGGGTGTGGG - Intronic
994970464 5:106730730-106730752 CTGCAGTGGGAGGAGGGTGTTGG - Intergenic
995431607 5:112085450-112085472 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
996416243 5:123213762-123213784 CATCATTTGGAAGAGGGAGATGG + Intergenic
996901854 5:128551887-128551909 CACCAGTGGGAGGTGGTTGGAGG - Intronic
997372077 5:133368427-133368449 CAACAGAGGGAAGAGGGGCATGG - Intronic
997653591 5:135539347-135539369 ACCCAGTGGAAAGAGGGTAAGGG + Intergenic
998673637 5:144382253-144382275 AGCATGTGGGAAGAGGGTGAAGG + Intronic
998679697 5:144453192-144453214 CACCTGAGGGAAAAGGGAGATGG - Intronic
999563662 5:152833554-152833576 AAGCAGGGGGAAGAGGGTAAAGG + Intergenic
1000124105 5:158226780-158226802 CACCAGTGGGGGGAGGCTGTGGG - Intergenic
1000991842 5:167919299-167919321 AGACAGTGGGGAGAGGGTGAGGG - Intronic
1001118943 5:168962851-168962873 CAGCAGTGTGAAGAGTGGGAAGG - Intronic
1001190954 5:169630756-169630778 AAATGGTGGGAAGAGGGTGAGGG - Intergenic
1001447194 5:171794682-171794704 CAGCAGTGGCAGGAGGGAGAGGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003643299 6:7893702-7893724 CAAAAGTGGGAAAAGGCTGAAGG + Intronic
1004890741 6:20098040-20098062 AACCACTGGGAAGAAGGTTATGG + Intergenic
1005435695 6:25809244-25809266 GAAGAGTGGGAGGAGGGTGAGGG + Intronic
1005520085 6:26593325-26593347 CACCAATGGGAAGAACGGGAAGG - Intergenic
1005906333 6:30264090-30264112 TTCCAGTGGGAAGAGGCAGACGG + Intergenic
1006454105 6:34122248-34122270 CACCAGGGGGAAGAAAGAGATGG + Intronic
1006889943 6:37418165-37418187 CACCTGGAGGAAGAGGGGGACGG + Intergenic
1007714917 6:43850382-43850404 CGCCAGTGGGACCTGGGTGAGGG - Intergenic
1007931209 6:45692825-45692847 AAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1007948381 6:45846761-45846783 TACTAGTGGGTGGAGGGTGAGGG + Intergenic
1008657128 6:53627468-53627490 AAACAGTGGGTAGAGGATGAAGG - Intergenic
1009033252 6:58085812-58085834 GAAGAGTGGGAAGAGAGTGAAGG + Intergenic
1009208862 6:60837587-60837609 GAAGAGTGGGAAGAGAGTGAAGG + Intergenic
1009428683 6:63542275-63542297 AAAGGGTGGGAAGAGGGTGAGGG + Intronic
1009584698 6:65584287-65584309 CAACAGTGGGAAGGGCGTTAGGG + Intronic
1010056310 6:71569466-71569488 CAAAATAGGGAAGAGGGTGAGGG - Intergenic
1011093003 6:83627994-83628016 AAAGGGTGGGAAGAGGGTGAGGG - Intronic
1011095776 6:83660279-83660301 CTCTCGTGAGAAGAGGGTGAAGG + Intronic
1011319485 6:86074946-86074968 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1011447739 6:87460623-87460645 CAACAGTGGAAAGAGTGGGAGGG + Intronic
1012378011 6:98585915-98585937 CAGAAGTGGGAGGAGGGTAAGGG - Intergenic
1013954315 6:115822891-115822913 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1014313783 6:119837970-119837992 CACAAGTGGGATGAGGGGTAAGG + Intergenic
1015933199 6:138382930-138382952 CACCCATGAGAAGAGGGAGAAGG + Exonic
1015955100 6:138590461-138590483 AACCAGAGGGAAGAGGGGCAGGG - Intronic
1016785214 6:148003627-148003649 GAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1017492746 6:154958680-154958702 CAGCAGAGGGAAGAGTGTGGAGG - Intronic
1017898469 6:158701421-158701443 GAGCCGTGGGAAGAGGGTCATGG + Intronic
1017994566 6:159520994-159521016 TCCCAGTGGGAAGGGAGTGACGG - Intergenic
1018049527 6:159996994-159997016 CAGCAGTGGGTAGAGGGTGGGGG + Intronic
1018651046 6:165991442-165991464 AGCCAGTGGGACGAGGGTGCTGG + Intergenic
1019331603 7:463215-463237 CACCAGTGTGATGAGGGCAAGGG - Intergenic
1019502887 7:1374005-1374027 GAACAGGAGGAAGAGGGTGAAGG + Intergenic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1019632005 7:2054364-2054386 CTCCAGTGTGAAGATGATGAAGG - Intronic
1020013582 7:4818797-4818819 CACTGGTGGGAAGAGGGAAACGG + Intronic
1020374936 7:7474292-7474314 AAAGGGTGGGAAGAGGGTGAGGG + Intronic
1020512394 7:9074135-9074157 TACCAGAGGGTGGAGGGTGAAGG - Intergenic
1021398965 7:20187485-20187507 AAGCTGTGGGAAGAGGGAGAAGG - Intronic
1022431893 7:30332518-30332540 CAAAAGTGGGAAGAGAGGGAGGG - Intronic
1022953383 7:35360015-35360037 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
1023288552 7:38644728-38644750 GAAGAGTGGGAGGAGGGTGAGGG - Intergenic
1023838092 7:44080096-44080118 CACCAGCGGCATGAGGCTGAGGG + Intronic
1023982022 7:45075919-45075941 CACCAATGGGAACAGGGCCACGG + Exonic
1024088436 7:45916302-45916324 CAGGAGTGGGAAGCGGGTGGTGG + Intronic
1024126919 7:46308233-46308255 AAAGGGTGGGAAGAGGGTGAGGG + Intergenic
1024550524 7:50559157-50559179 CAGCAATGCGAAGAGGCTGAGGG + Intronic
1024626065 7:51209366-51209388 CACCCCTGGGAAGTGGGTGCTGG + Intronic
1024875716 7:54020708-54020730 AAAGAGTGGGAGGAGGGTGAGGG - Intergenic
1025110741 7:56214098-56214120 GAAGAGTGGGAAGGGGGTGAGGG - Intergenic
1025603060 7:63017540-63017562 TACCAGTAGGGAGAGGGTGCAGG - Intergenic
1025734136 7:64132024-64132046 AAACAGTAGGAAAAGGGTGAAGG - Intronic
1027731247 7:81876040-81876062 CATCAGAGGTAAGAGAGTGATGG - Intergenic
1028406884 7:90485057-90485079 CAGTAGTAGGAATAGGGTGAGGG + Intronic
1029563321 7:101318590-101318612 CAAAAGTAGGAAGTGGGTGATGG + Intronic
1030267971 7:107640162-107640184 CAGGAGTGGGAAGAAGGGGAAGG - Intergenic
1031066037 7:117106559-117106581 AAAGAGTGGGAAGAGGGTGAGGG - Intronic
1034296147 7:149973949-149973971 TGCCAGAGGGAAGAGGTTGATGG + Intergenic
1034809884 7:154122860-154122882 TGCCAGAGGGAAGAGGGTGATGG - Intronic
1035050157 7:155994143-155994165 CAGGAGTGGGAAGAGGGAGCTGG - Intergenic
1035164110 7:156974139-156974161 CCACAGTGGGGAGAGGGGGAGGG - Intergenic
1036709945 8:11071804-11071826 GCCCAGTGGGGAGAGGGTGCTGG - Intronic
1036782174 8:11657307-11657329 TACCAGTAGGGAGAGGGTGCAGG + Intergenic
1037209355 8:16366896-16366918 GGAGAGTGGGAAGAGGGTGAAGG + Intronic
1038340574 8:26682043-26682065 CAGGAGTGGGAAGAGGGTGGAGG - Intergenic
1038679381 8:29652818-29652840 GAACAGTGGGGACAGGGTGATGG + Intergenic
1039364438 8:36915635-36915657 AGCCAGTGTGAACAGGGTGAAGG - Intronic
1039747988 8:40449204-40449226 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1039854271 8:41398886-41398908 CACTAGTGAGTAGAGGGAGATGG + Intergenic
1040391888 8:46957116-46957138 CACCAGAGGGCAGTGGGTGACGG - Intergenic
1040958004 8:52999719-52999741 CACAAATCAGAAGAGGGTGAGGG + Intergenic
1041589978 8:59567189-59567211 AAAGAGTGGGAAGAGGGTGAGGG + Intergenic
1042563799 8:70093291-70093313 AACCACTGGCAAGAGGGTGCTGG + Intergenic
1042648484 8:71013367-71013389 CACCAGTGGGGAGAGTGTGTAGG - Intergenic
1043188391 8:77184887-77184909 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
1043208980 8:77486507-77486529 CATGTGTGGGAAGGGGGTGAGGG + Intergenic
1043348967 8:79336088-79336110 AAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1043988416 8:86721414-86721436 AAAGAGTGGGAAGGGGGTGAAGG + Intronic
1044523591 8:93226704-93226726 CAGCAGGGGGAAGGGAGTGATGG + Intergenic
1044754458 8:95447059-95447081 CAGAAGAGGGCAGAGGGTGAGGG - Intergenic
1045065323 8:98438940-98438962 CACCCGTGGGGAGAAGGGGATGG + Intronic
1045337932 8:101224744-101224766 CAACTGTGGGAGGAGGCTGAAGG - Intergenic
1047937596 8:129797731-129797753 GAGCAGTGGGAAGAGAGAGAAGG + Intergenic
1048260991 8:132944901-132944923 TCCCTGTGGGAAGAGGGTGCAGG + Intronic
1049465681 8:142750298-142750320 CAAGAGTGGGAGGAGCGTGAGGG + Exonic
1049783829 8:144441066-144441088 CAACAGCTGGAAGAGGCTGAGGG - Exonic
1049815270 8:144596246-144596268 CCTCAGTGGGCAGAGGGGGACGG + Intronic
1049877854 8:145037800-145037822 AAAGGGTGGGAAGAGGGTGAGGG + Intergenic
1050264932 9:3879999-3880021 CAGCAGTGAGAAGAGGAAGAAGG - Intronic
1050999233 9:12259630-12259652 GAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1051277390 9:15409727-15409749 AAAGAGTGGGAAGAAGGTGAGGG - Intergenic
1051800945 9:20933336-20933358 AAAGCGTGGGAAGAGGGTGAGGG - Intronic
1053058835 9:35012504-35012526 CAAAAGTGGGATGGGGGTGAGGG + Intergenic
1057357058 9:94340631-94340653 CAGCAGAGAGAAGCGGGTGAGGG + Intergenic
1057650694 9:96916996-96917018 CAGCAGAGAGAAGCGGGTGAGGG - Intronic
1058955124 9:109939363-109939385 CATTGGTGGGAAGAGGGAGAGGG + Intronic
1059499775 9:114741649-114741671 GAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1060026072 9:120172628-120172650 AAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1060835517 9:126752752-126752774 CAGGATTGGGCAGAGGGTGAAGG - Intergenic
1061246193 9:129402240-129402262 CTTGAGAGGGAAGAGGGTGAAGG - Intergenic
1061812165 9:133168540-133168562 CGTCAGTGGGAAGTGGGGGAGGG - Intergenic
1061916171 9:133755629-133755651 CACCAGTGGGGAGAGGGAGAGGG + Intergenic
1203658438 Un_KI270753v1:20704-20726 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658475 Un_KI270753v1:20844-20866 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658534 Un_KI270753v1:21113-21135 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658576 Un_KI270753v1:21292-21314 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658588 Un_KI270753v1:21336-21358 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658612 Un_KI270753v1:21425-21447 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658624 Un_KI270753v1:21469-21491 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658636 Un_KI270753v1:21513-21535 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658676 Un_KI270753v1:21645-21667 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658688 Un_KI270753v1:21689-21711 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658700 Un_KI270753v1:21733-21755 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658712 Un_KI270753v1:21777-21799 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658724 Un_KI270753v1:21821-21843 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658736 Un_KI270753v1:21865-21887 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658748 Un_KI270753v1:21909-21931 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658760 Un_KI270753v1:21953-21975 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658772 Un_KI270753v1:21997-22019 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1203658784 Un_KI270753v1:22041-22063 CACCAGTGGAATAAGGGTGGAGG + Intergenic
1185502918 X:612578-612600 AAAGAGTGGGAAGGGGGTGAGGG - Intergenic
1185587641 X:1252372-1252394 CACCAGTGGGAAAAGTCTCAGGG - Intergenic
1186235305 X:7501741-7501763 AAAAAGTGGGAAGGGGGTGAGGG + Intergenic
1187802010 X:23074431-23074453 AAACAGTGGGAGGAGGGTGAAGG + Intergenic
1188433137 X:30129567-30129589 GAAGAGGGGGAAGAGGGTGAGGG + Intergenic
1189096699 X:38148146-38148168 TAGGGGTGGGAAGAGGGTGAAGG - Intronic
1189216573 X:39330221-39330243 CACCTGTGGAAGGAGAGTGAAGG - Intergenic
1189733453 X:44045872-44045894 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1190449440 X:50563728-50563750 GAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1190464324 X:50710508-50710530 TACCAGAGGGGAGAGGGAGAGGG + Intronic
1192148149 X:68695242-68695264 TCGCAGTGGGAAGAGTGTGATGG + Intronic
1192304868 X:69948506-69948528 CACCAGTGGGGTGGGGGTGGTGG - Intronic
1193779429 X:85684276-85684298 GAAAAGTGGGAAGAGAGTGAGGG - Intergenic
1194053492 X:89101329-89101351 CAACAGTGGGAAGAGCCTTATGG - Intergenic
1194125516 X:90011843-90011865 CACGACTGGGAAGAGGCTGAAGG - Intergenic
1194527877 X:95001977-95001999 AAAGGGTGGGAAGAGGGTGAAGG - Intergenic
1197145007 X:123162139-123162161 AAAGGGTGGGAAGAGGGTGAGGG - Intergenic
1198683961 X:139208261-139208283 CTACAGTGGGATGAGGGAGATGG - Intronic
1199498699 X:148484998-148485020 AAAGAGTGGGAAGGGGGTGAGGG + Intergenic
1200312293 X:155089864-155089886 GAACAGTGGGCAGAGGGTGTGGG + Intronic
1200339999 X:155386207-155386229 CACAAGGGGGAAGAGTGTGAGGG - Intergenic
1200346471 X:155454481-155454503 CACAAGGGGGAAGAGTGTGAGGG + Intergenic
1201518026 Y:14839424-14839446 CACAAGTGGGCAGAGGTAGAAGG - Intronic
1201985890 Y:19964822-19964844 GAACAGTGGGATGGGGGTGAGGG - Intergenic
1202370178 Y:24190893-24190915 CCCCAGTGGGAAGAGGACTAGGG - Intergenic
1202500606 Y:25479224-25479246 CCCCAGTGGGAAGAGGACTAGGG + Intergenic