ID: 1181690612

View in Genome Browser
Species Human (GRCh38)
Location 22:24557308-24557330
Sequence GTGTGTCAGGGGAGGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 8, 3: 87, 4: 830}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181690612_1181690625 23 Left 1181690612 22:24557308-24557330 CCAGTCCCCCTCCCCTGACACAC 0: 1
1: 0
2: 8
3: 87
4: 830
Right 1181690625 22:24557354-24557376 AGCTGAAGATTAAGGGACATAGG 0: 1
1: 0
2: 0
3: 21
4: 173
1181690612_1181690627 30 Left 1181690612 22:24557308-24557330 CCAGTCCCCCTCCCCTGACACAC 0: 1
1: 0
2: 8
3: 87
4: 830
Right 1181690627 22:24557361-24557383 GATTAAGGGACATAGGGTAGCGG 0: 1
1: 0
2: 0
3: 10
4: 147
1181690612_1181690626 24 Left 1181690612 22:24557308-24557330 CCAGTCCCCCTCCCCTGACACAC 0: 1
1: 0
2: 8
3: 87
4: 830
Right 1181690626 22:24557355-24557377 GCTGAAGATTAAGGGACATAGGG 0: 1
1: 0
2: 1
3: 11
4: 156
1181690612_1181690621 -6 Left 1181690612 22:24557308-24557330 CCAGTCCCCCTCCCCTGACACAC 0: 1
1: 0
2: 8
3: 87
4: 830
Right 1181690621 22:24557325-24557347 ACACACACAGTATTGGCTAATGG 0: 1
1: 0
2: 1
3: 12
4: 187
1181690612_1181690623 16 Left 1181690612 22:24557308-24557330 CCAGTCCCCCTCCCCTGACACAC 0: 1
1: 0
2: 8
3: 87
4: 830
Right 1181690623 22:24557347-24557369 GTCCTTTAGCTGAAGATTAAGGG 0: 1
1: 0
2: 0
3: 10
4: 152
1181690612_1181690622 15 Left 1181690612 22:24557308-24557330 CCAGTCCCCCTCCCCTGACACAC 0: 1
1: 0
2: 8
3: 87
4: 830
Right 1181690622 22:24557346-24557368 GGTCCTTTAGCTGAAGATTAAGG 0: 1
1: 0
2: 0
3: 2
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181690612 Original CRISPR GTGTGTCAGGGGAGGGGGAC TGG (reversed) Intronic
900315123 1:2052478-2052500 GTGTGGCAGGGAAGGGAGAGAGG - Intronic
900319100 1:2073729-2073751 GGATGTGAGGGGCGGGGGACAGG + Intronic
900337289 1:2170642-2170664 GTGAGGCTGGGGCGGGGGACAGG - Intronic
900638384 1:3676487-3676509 TTGGGACAGGGCAGGGGGACAGG + Intronic
900883926 1:5402184-5402206 GTGGGCCAGGGCAGGGGGGCAGG - Intergenic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901443803 1:9294819-9294841 GGGGGTCTGAGGAGGGGGACAGG - Intronic
901592189 1:10353800-10353822 GTATGTCTGGGGAGGGGGAGTGG + Intronic
901624775 1:10617690-10617712 GGGTGGCAGGGGAGAGGGGCTGG - Intronic
901642615 1:10700552-10700574 GTGTGTCAGGGGTGGGGTGGGGG + Intronic
901797863 1:11691220-11691242 GTCTGTCAGGGCAGGGGCCCGGG - Intronic
902464448 1:16607424-16607446 GTGTTTCAGAGGAGGAGGAAGGG - Intronic
902658396 1:17885154-17885176 GTGTGTTAATGGAGGGGGAGAGG + Intergenic
902717671 1:18283577-18283599 CTGTGTAGGGGGAGGGGCACAGG - Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903594765 1:24485629-24485651 GCCTGTCAGGGGTGGGGGGCTGG - Intergenic
903954050 1:27012710-27012732 GTGGTTAAGGGGAGGAGGACAGG + Exonic
904131898 1:28281589-28281611 GTGTGTGAGAGGAGGAGGAGAGG + Exonic
904454213 1:30637380-30637402 CTGTGACAGGGAAGGAGGACAGG - Intergenic
904464904 1:30701900-30701922 GAGGGTCAGGGGAGAGGGCCTGG - Intergenic
905030738 1:34882843-34882865 GTGGGGCAGGGGAGTGGGAAGGG - Intronic
905152244 1:35939529-35939551 GTATGTCAGGGCAGGAGGCCTGG + Intronic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905421055 1:37844738-37844760 GTTTGGCAGGGCAGGGAGACAGG - Intronic
905866679 1:41380704-41380726 GTGGGTCAGGAGAGGAGGGCAGG + Intronic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906079734 1:43077393-43077415 GTGGGGGAGGGGCGGGGGACGGG - Intergenic
906219697 1:44069026-44069048 TTCTGTGAGGGGAGGGGGTCAGG - Intergenic
906540506 1:46582172-46582194 GTGTGTCAGGGTATGGGGATGGG - Intronic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906704480 1:47885002-47885024 GGGTGGCAGGGGAAGGGGAGGGG - Intronic
906962592 1:50427437-50427459 CGGTGTCAGAGGACGGGGACAGG - Intergenic
907246361 1:53111525-53111547 GAGTGGCAGGGGAGGTGGAAGGG + Intronic
907315638 1:53569387-53569409 GTGTGTGAGGGCAGGGGTATAGG + Intronic
907403927 1:54242114-54242136 GTTTGTCAGGGGAGCGGTTCTGG - Intronic
907856274 1:58306810-58306832 GTGAGACAGGGGAGAGAGACAGG - Intronic
908477659 1:64505586-64505608 GTGTGCCCAGGGAGGGGGAGGGG - Intronic
910109486 1:83667450-83667472 GTGTGTCTGTGTAGGGAGACAGG - Intergenic
910315108 1:85873680-85873702 GTGGGGTAGGGGAGGGGGAAGGG + Intronic
910631971 1:89364649-89364671 GTGTGTGTGGGGAGGGGGTGGGG + Intronic
910859020 1:91725221-91725243 GTGTGTCGGGGGTGGGGCATGGG - Intronic
911132260 1:94400954-94400976 GTTAATCAGGGGAGGGGAACTGG + Intergenic
911168314 1:94744825-94744847 GTGTGGGAGGGGAGGTGGACAGG + Intergenic
911217428 1:95210834-95210856 GCCTGTCAGGGGTGGGGGGCTGG - Intronic
911293451 1:96084764-96084786 ATTTGTCTGGGGATGGGGACAGG - Intergenic
911733171 1:101310453-101310475 TTCTCTCAGGGGAGGGGGGCAGG + Intergenic
911820335 1:102411297-102411319 GAGGGACAGGGGAGGGGGAGGGG + Intergenic
912195499 1:107392518-107392540 GAGTGTCAGGGGAGAGGGAGTGG + Intronic
913129781 1:115828872-115828894 GCGTCCCAGGGGAGGGGGGCAGG - Intergenic
914322184 1:146575880-146575902 GAGTGTCAGGGGAGGTGAAGTGG - Intergenic
914718018 1:150267693-150267715 GTGAGCCAAGGGAGAGGGACTGG - Intronic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915842449 1:159225479-159225501 GAGTGACAGGGGAGGCGCACAGG + Intergenic
916043538 1:160981601-160981623 GTGGGTTAGGGGAGCGGGATTGG - Intergenic
916313995 1:163427387-163427409 GTGTGGGAGGGGCTGGGGACAGG + Intergenic
916325724 1:163557647-163557669 GTGTGGCAGAGGACGGGGAGTGG - Intergenic
916731861 1:167573708-167573730 GAGTGTCAGGGTTGGGGGATAGG - Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917451588 1:175151803-175151825 GTGTGTGAGGAGATGTGGACAGG + Intergenic
917454660 1:175175876-175175898 TGGGGTCAGGGGAGGGGGAAGGG + Intronic
917581954 1:176388021-176388043 GTGGGGTAGGGGAGGGGGAAGGG - Intergenic
917684115 1:177398549-177398571 GTGTGTCTGTGGGAGGGGACAGG - Intergenic
917779182 1:178373467-178373489 ATGTGTCAGGGGAGGGGAATGGG - Intronic
918339441 1:183555911-183555933 GTGGGTGAGGAGATGGGGACAGG - Exonic
920048040 1:203146154-203146176 CAGTGTCAGGGGTGGGGGAGGGG + Intronic
920252452 1:204630712-204630734 GTGGGACTGGGGAGGGGCACAGG - Intronic
920371837 1:205484082-205484104 GTGTTTGAGGGAGGGGGGACAGG - Intergenic
920531389 1:206705245-206705267 GTGTGGCAGAGGAGGGGCCCCGG + Intronic
920590515 1:207214266-207214288 GTGGGCCAGGGGAGAGGGCCAGG - Intergenic
921152682 1:212414574-212414596 GTGCGTCAGGGGAGGGCTCCCGG - Intronic
921435052 1:215108832-215108854 GTGTGTGAGGGGTTGGGGAGAGG + Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922424763 1:225482498-225482520 ATTTGGCAGGGCAGGGGGACCGG + Intergenic
923021949 1:230171914-230171936 GTGGGACAGGGGTGGGGGGCAGG - Intronic
923089500 1:230729090-230729112 CTGGGTCAGGGGAGAGGGTCAGG - Intergenic
923092653 1:230751855-230751877 GTGGGGGAGGGGAGGGGGAGGGG + Intronic
923874956 1:238037253-238037275 GTGCGTCGGGGGAGGGGGGAGGG - Intergenic
924432287 1:244007455-244007477 ATGTGGCAGGGGTGGGTGACAGG - Intergenic
924498545 1:244613931-244613953 GGGTTTCATGGGAGTGGGACCGG + Intronic
924615288 1:245607264-245607286 GTGTGTCAGCAGAGGGTGAGTGG + Intronic
1063022547 10:2144249-2144271 GTGTGTCTGGGGTGGGGGCAGGG - Intergenic
1063410448 10:5833022-5833044 GGGTGGCAGGGGTGGGGGAGCGG - Intronic
1064220636 10:13437553-13437575 GTGCATCACCGGAGGGGGACGGG + Intergenic
1064463816 10:15559815-15559837 GCCTGTCAGGGTAGGGGGGCGGG + Intronic
1064769756 10:18711371-18711393 GTGTGTAGAGGGAGGGGGAGGGG - Intergenic
1065116789 10:22490893-22490915 GAATTGCAGGGGAGGGGGACTGG + Intergenic
1065471479 10:26086342-26086364 ACGTGTCAGGGGAGGGGGCCTGG - Intronic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1067061779 10:43081478-43081500 GTGTGGCAAGGGGCGGGGACTGG + Intronic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067477761 10:46578002-46578024 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
1067682171 10:48448190-48448212 GAGAGTCAGGGGCTGGGGACTGG - Intronic
1068065545 10:52126181-52126203 GTGGGGCAGGGGAGGGCTACTGG + Intronic
1068151606 10:53139449-53139471 TAGTTTCAGGGGAGGGGGAAGGG + Intergenic
1068841484 10:61619702-61619724 GGGGGTCAAGGGAGAGGGACAGG - Intergenic
1068886892 10:62107152-62107174 GTGGGGCAGGGGTGGTGGACTGG + Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069934030 10:71902771-71902793 ATGTGGCAGGGGTGGGGGATGGG - Intergenic
1070161340 10:73868366-73868388 AGGTGGGAGGGGAGGGGGACAGG + Intronic
1070689870 10:78516559-78516581 GTGTGCCAGGGGAGGGGCTATGG - Intergenic
1071559266 10:86632533-86632555 GTGTGTGGGGGGATGGGGAATGG - Intergenic
1072001106 10:91196597-91196619 GTGGGTCAGAGGTGGGGGATGGG - Intronic
1072201947 10:93168181-93168203 ATGTGTCAGAGGAGGGGTATGGG - Intergenic
1072909910 10:99491178-99491200 CTGTGTCAGGGGAGGGGTTGGGG - Intergenic
1073207603 10:101776841-101776863 GTGTGTGTGGTGAGGGGCACAGG - Intronic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073484232 10:103806491-103806513 AGGTGACAGGGAAGGGGGACAGG + Intronic
1074008591 10:109454362-109454384 GTATGGCAGGAGATGGGGACGGG - Intergenic
1074061224 10:109967615-109967637 GTGTGGCGGGGGAGGGGAAATGG + Intergenic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074722436 10:116274165-116274187 GTGTGTCAGGCGTGGGGGGCGGG - Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1074881708 10:117664832-117664854 GTGTGCCAGGGGAGGAGGGATGG - Intergenic
1075022013 10:118959135-118959157 GGGTGGCTGGGGAGGGGAACGGG - Intergenic
1075282377 10:121150603-121150625 GGGAGTCATGGGAGTGGGACTGG + Intergenic
1075530048 10:123221420-123221442 GTTTGTGAGTGGAGGGGGGCAGG + Intergenic
1075558139 10:123448065-123448087 ATGAGTCTGGGGAGGGGGCCTGG + Intergenic
1075647696 10:124107440-124107462 GGGTGTGAGGGGAGGTGGCCAGG + Intergenic
1075714054 10:124545638-124545660 GTGTGTCAGGGGGCGGGGTGGGG + Intronic
1075794613 10:125110164-125110186 GTGTGACAGGTGAGAGAGACAGG + Intronic
1076178383 10:128386360-128386382 GGTTGTCAGGGGCCGGGGACGGG + Intergenic
1076405186 10:130207125-130207147 GTGTGTGTGTGGGGGGGGACAGG - Intergenic
1076450024 10:130551023-130551045 ATGTGTCAGGGGAGGGGCTGAGG - Intergenic
1076762375 10:132611906-132611928 GTGTGGGAGGTGAGGGGGGCAGG + Intronic
1076865895 10:133166117-133166139 CTGGGGCAGGGTAGGGGGACCGG + Intronic
1076879810 10:133234685-133234707 GGGTGTCAGGGAAGGGGGCGTGG + Intergenic
1076901139 10:133338402-133338424 GTGTGTCTGGGGTGTGGGTCAGG - Intronic
1077133446 11:986591-986613 GGATGTCAGGGGTGGGGGTCGGG + Intronic
1077248129 11:1548930-1548952 GTGGGCGGGGGGAGGGGGACGGG - Intergenic
1077328966 11:1975696-1975718 GTGTCTCAGTGGCGGGGGATAGG + Intronic
1077933676 11:6760128-6760150 GCCTGTCATGGGTGGGGGACTGG - Intergenic
1078284396 11:9936794-9936816 GCCTGTCAGGGGTGGGGGTCTGG + Intronic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1079107545 11:17581189-17581211 GGGCGTCGGGGGAGGGAGACAGG + Intronic
1079430904 11:20387701-20387723 GCGTGTCTGGGGGCGGGGACCGG - Exonic
1079492937 11:21009931-21009953 GTGGGTGGGGGGAGGGGGAGGGG - Intronic
1079687772 11:23382637-23382659 GCCTGTCAGGGGTGGGGGAAGGG + Intergenic
1080179664 11:29409662-29409684 GGTTGTCAGGGGACTGGGACAGG - Intergenic
1080574092 11:33582685-33582707 GTGTCTCAGGGCAAGGGGGCTGG - Intronic
1081226445 11:40528973-40528995 CAGTGTCAGGGGAGAGGGAGAGG + Intronic
1081605489 11:44524825-44524847 GTGTGTCGGGGGCGGGGGTTGGG + Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081715840 11:45249741-45249763 GCATGTCAGGGGTGGGGGCCTGG + Intronic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082132379 11:48506250-48506272 GTGTGGAAGGGAAGGGGGAAGGG - Intergenic
1082244424 11:49905176-49905198 GTGTGGAAGGGAAGGGGGAAGGG + Intergenic
1082565842 11:54676870-54676892 GTGTGGAAGGGAAGGGGGAAGGG - Intergenic
1083640690 11:64143727-64143749 GTGTGTCGGGGTTGGGGGAAGGG - Intronic
1083686506 11:64379267-64379289 GTGGCCCAGGGAAGGGGGACCGG - Intergenic
1083777102 11:64899425-64899447 GAGTGTCAGAGCAGGGGGCCAGG - Intronic
1083778351 11:64905707-64905729 GTGGGCCAGGGGCTGGGGACGGG - Intronic
1083853721 11:65382006-65382028 GTGGGCCAGGGGAGGGAGAGGGG - Intronic
1083935623 11:65868422-65868444 CTGTGCCAGGGGAGAGGGGCTGG + Intronic
1084264274 11:67996907-67996929 GTGTCTCAGGGGCGGGGCCCTGG - Intronic
1084518637 11:69649755-69649777 GTGGGTCATGGGCGAGGGACGGG + Intronic
1084523826 11:69683849-69683871 CTGAGCCATGGGAGGGGGACAGG + Intergenic
1084601204 11:70146953-70146975 TTGAGTCAGTGGAGGGGGAGAGG - Intronic
1084863343 11:72036898-72036920 GTGTGGCAGGAGATGGGGGCAGG - Intronic
1085026951 11:73241980-73242002 GTGTGGGGTGGGAGGGGGACAGG - Intergenic
1085179373 11:74520663-74520685 GTGTGTCAGGGAGAGGGGAGAGG + Intronic
1085281157 11:75331676-75331698 GAGAGTCAGTGGAGGGGGATAGG - Intronic
1085751369 11:79164661-79164683 GTGTGTTATGGGAGGGACACAGG + Intronic
1086242397 11:84711409-84711431 GTGTGTGGGGGGTGGGGGAGGGG - Intronic
1086443466 11:86850644-86850666 TAGTTTCAGGGGAGGGGGAAGGG - Intronic
1087183390 11:95160822-95160844 GTGTGTTGGGGGCGGGGGATGGG - Intergenic
1087717820 11:101629400-101629422 TTGAGTCAGGGGAGTGGGAGAGG - Intronic
1088613038 11:111597258-111597280 GTGTGCCAGGAGCGGGGGGCTGG - Intergenic
1088884276 11:113994763-113994785 GTGTGTGATGGGGTGGGGACTGG - Intergenic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089157018 11:116410283-116410305 CTGTGGCAGGGAAGGAGGACAGG - Intergenic
1089315573 11:117588810-117588832 GTGGCTTAGAGGAGGGGGACAGG - Intronic
1089318990 11:117612440-117612462 GTGTGTTAGGGGCGGGGGTAGGG - Intronic
1089430293 11:118418009-118418031 ATGAGTCAGGGGTAGGGGACTGG + Intronic
1089490494 11:118880433-118880455 GTGTGCCTGGAGAGGGGGACAGG - Intergenic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089697981 11:120227514-120227536 AGGTGTCAGTGGAGGGGGGCAGG - Intronic
1089939965 11:122406005-122406027 GTATTTTAGGGGAGAGGGACAGG + Intergenic
1090004180 11:122985083-122985105 CTGTGGCAGGGAACGGGGACAGG + Intergenic
1090022288 11:123138605-123138627 TGGTGGCAGGGGAGGGGGAGGGG - Intronic
1090032996 11:123223350-123223372 GGTTGTCATGGGAGTGGGACTGG + Intergenic
1090240297 11:125176875-125176897 GGATGGCAGAGGAGGGGGACAGG - Intronic
1090492193 11:127174523-127174545 GGCTGTCATGGGAGGGGGATGGG - Intergenic
1090907353 11:131088531-131088553 GTGTGTAAGGTTGGGGGGACAGG + Intergenic
1091345186 11:134847585-134847607 ATGTGTGAGGGGAGGGGTCCCGG + Intergenic
1202811945 11_KI270721v1_random:30875-30897 GTGTCTCAGTGGCGGGGGATAGG + Intergenic
1091774989 12:3178747-3178769 GTGTGTCTGGGTGGGGGTACAGG + Intronic
1092065876 12:5589333-5589355 GGGTGGCAGGAGAGGGAGACAGG + Intronic
1092214596 12:6672280-6672302 GTGTGTCCGGGGCGGGGGTGGGG + Intronic
1092560038 12:9603102-9603124 CTGTATCAGTGGAGGGGGGCAGG + Intronic
1092839689 12:12528124-12528146 GTGGGTCAGGGAAGGGGAAGCGG - Intronic
1093533329 12:20193559-20193581 GGTTGCCTGGGGAGGGGGACTGG - Intergenic
1094311412 12:29087426-29087448 GTGTGTCAGGGCTAGGGGAGGGG - Intergenic
1095085797 12:38056531-38056553 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095916002 12:47479332-47479354 GTGGGTGGGGGGAGGGGGGCAGG + Intergenic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1095986548 12:48003288-48003310 GTGTGTCAGGGAAGGGGAGCAGG - Intronic
1096464059 12:51838507-51838529 CTGAGTCATGGGAGGGGGAAGGG - Intergenic
1096597975 12:52709255-52709277 GTGTGTCAGGGGCGTGGGGCTGG + Intergenic
1096665440 12:53161011-53161033 GAGGCTGAGGGGAGGGGGACTGG - Intronic
1096896326 12:54823897-54823919 TGGGGTCAGGGGAGGGGGAAGGG - Intergenic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1097334815 12:58370272-58370294 GTGAGTAAGGGGATGGAGACAGG + Intergenic
1097459560 12:59843995-59844017 ATGGGACAGAGGAGGGGGACAGG - Intergenic
1098024303 12:66186601-66186623 GCCTGTCAGGGGAGGGGGTAGGG - Intergenic
1098384422 12:69903863-69903885 GGGTGTCAGAGGAGGGGCCCAGG - Intronic
1099170630 12:79359675-79359697 GTGGGTGGAGGGAGGGGGACAGG - Intronic
1099360127 12:81690493-81690515 GTGTGTTGGGGGAGGAGGAGTGG - Intronic
1099566622 12:84256780-84256802 GTGTGTGAGGGTAGGGGGAGTGG + Intergenic
1100465608 12:94842121-94842143 GTGTGTGTGTGTAGGGGGACTGG - Intergenic
1100820742 12:98427260-98427282 GCCTGTCGGGGGAGGGGGAGGGG - Intergenic
1101299478 12:103463740-103463762 GTCTGTCAGGGGCTGGGGGCAGG - Intronic
1101519625 12:105469322-105469344 GAGTGCCAGGGGCTGGGGACAGG + Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102259767 12:111436899-111436921 GTGTGTGGCGGGAGGGGGGCGGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103479989 12:121244677-121244699 GTGTCTCAGGGTGGGGGAACGGG - Intronic
1103763773 12:123268312-123268334 GTGGGTGAGGGGAGGGGCAGAGG + Intronic
1103846745 12:123907288-123907310 GTGTGTCAGGGGTAGAGTACTGG + Intronic
1104053294 12:125210625-125210647 GGGTGGCAGGGGAGGTGGAGGGG + Intronic
1104273392 12:127303109-127303131 GTGTGTGGGGCGAGGGGGAAGGG - Intergenic
1104810391 12:131616957-131616979 CTGTGTCCTGGGAGGCGGACAGG - Intergenic
1105007309 12:132729463-132729485 GGGTGGGAGGGGAGGGGGAGGGG + Intronic
1105433552 13:20358509-20358531 GTGTGTCACAGGAGTGGGACAGG - Intergenic
1105691074 13:22839686-22839708 GACTGTCATGGGAGAGGGACTGG + Intergenic
1106079111 13:26485891-26485913 GGATGTCACGGGAGGGGGAGAGG + Intergenic
1106240506 13:27908616-27908638 GTGTTTTGGGGGAGTGGGACGGG + Intergenic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1106813630 13:33383902-33383924 GAGTGTCGGGGGAGGGGAAGTGG + Intergenic
1107092202 13:36493866-36493888 GTGTGTCAGGCGGGGGAAACTGG + Intergenic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1108728794 13:53210429-53210451 GTGTGCTAGGTGAGGGGGAGAGG + Intergenic
1108867720 13:54941884-54941906 TAGTTTCGGGGGAGGGGGACGGG + Intergenic
1110480900 13:75974772-75974794 ATTTGTCGGGGGTGGGGGACAGG + Intergenic
1111397229 13:87678645-87678667 GTGGGGCAGGGGCGGGGGAGGGG - Exonic
1112297264 13:98198911-98198933 GTTTGTGGGGGGAGGGGGAAAGG - Intronic
1112715067 13:102174772-102174794 GAGGGTGAGGGGAGGGGGAGTGG + Intronic
1112836636 13:103522789-103522811 GCCTGTCAGGGTAGGGGGAAAGG + Intergenic
1113088847 13:106596423-106596445 GTGTGTCGGAGGAGAGGGAGTGG - Intergenic
1113292644 13:108923403-108923425 TTATTTCAGAGGAGGGGGACAGG + Intronic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113499639 13:110763327-110763349 TGGGGTCAGGGGAGGGGGACAGG - Intergenic
1113657069 13:112073567-112073589 GTGAGAGAGGGGAGGGGGAGGGG + Intergenic
1113798566 13:113074711-113074733 GTGTGGGAGGGGAGGGGTACAGG - Intronic
1114346990 14:21806876-21806898 GCCTGTCGGGGGAGGGGGAGTGG + Intergenic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1116124074 14:40758931-40758953 GAGAGTCAGGGAAGGGAGACAGG + Intergenic
1117236619 14:53783970-53783992 GTGTGTCTGGGGTGCGGGAAGGG - Intergenic
1117252654 14:53952224-53952246 GTGTCTCTGGGGAGGGGGAGGGG + Exonic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1117495418 14:56297253-56297275 GTTTATCAGAGGAGGGTGACAGG + Exonic
1117750792 14:58921711-58921733 GTGTGGCAGGGGAGGGCGGCAGG - Intergenic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118495085 14:66300450-66300472 GCCTGTCAGGGGTGGGGGCCTGG + Intergenic
1119603025 14:75990103-75990125 GTGAGTTAGGGCAGGGGGACTGG + Intronic
1120189397 14:81426659-81426681 ATGTTTCGGGCGAGGGGGACTGG - Intronic
1120729497 14:87986669-87986691 GTGTGTCTGGGGTGGGGGTGGGG - Intronic
1121117866 14:91356302-91356324 ACGTGTCAGGGCTGGGGGACGGG - Intronic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121311097 14:92935536-92935558 GTGTGGCTGGGGACGGGGAGAGG - Intergenic
1121331967 14:93055433-93055455 GTGAGGTGGGGGAGGGGGACTGG - Intronic
1121442370 14:93957138-93957160 GGTTGGCTGGGGAGGGGGACCGG - Intronic
1121624520 14:95374504-95374526 GTGTGTCAGGGGCCTGGGGCAGG + Intergenic
1121747080 14:96305230-96305252 GTGTGTCAGGAGGTGGGGTCGGG - Intronic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1122075097 14:99230771-99230793 GTGTGTGAGGGGTGGGGGCGGGG - Intronic
1122077631 14:99246180-99246202 GAGTGTCAGGGGAGGAAGAAAGG + Intronic
1122270197 14:100565536-100565558 GTGTGGGAGAGGAGGGGGCCAGG + Intronic
1122406195 14:101502499-101502521 GTGTTTCATGGCAGGGAGACAGG - Intergenic
1122602826 14:102929907-102929929 CTGAGGCTGGGGAGGGGGACGGG - Exonic
1122603636 14:102933436-102933458 GGTTGTCAGGGGTGGGAGACAGG + Exonic
1122738741 14:103858648-103858670 GCCCGTCAGGGGAGGGGGCCGGG - Intergenic
1122740586 14:103869591-103869613 GTGTGGCAGGGGTGGGGGATGGG + Intergenic
1122782239 14:104148652-104148674 GCGTGGCCGGGGAGGGGGAGGGG + Intronic
1123187570 14:106535052-106535074 TAGTTTCAGGGGAGGGGGAATGG + Intergenic
1202902401 14_GL000194v1_random:51338-51360 GGGTGCCAGGGGAGGGGGCCTGG - Intergenic
1123419203 15:20117739-20117761 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1123446660 15:20335760-20335782 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1123528425 15:21124282-21124304 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1123684295 15:22786554-22786576 GCGGGGGAGGGGAGGGGGACGGG - Intronic
1123996481 15:25721327-25721349 GTGTGGCAGAGCAAGGGGACCGG + Intronic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124441458 15:29689003-29689025 GTGGATGAGGGGAGGGGGAAGGG + Intergenic
1124899075 15:33805901-33805923 GGGTGAAAGGGGAGGGGGAGAGG - Intronic
1125057476 15:35378817-35378839 GCCTGTCAGGGGTGGGGGGCTGG + Intronic
1125482905 15:40092838-40092860 GTCTGCCAGGGCAGGAGGACTGG + Intronic
1127194261 15:56567410-56567432 GCTTGTCAGGGGTGGGGGACTGG + Intergenic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127354734 15:58187460-58187482 GTGTGTCAGGGCTGGGGGTGGGG + Intronic
1127507638 15:59611032-59611054 GAGGGTGAGGGGAGGGGGAGGGG - Intronic
1127770227 15:62224623-62224645 GTGAGTAAGGGCAGAGGGACGGG - Intergenic
1128064433 15:64755584-64755606 GTTTGTGAGGGCAGGGGGAGCGG + Intronic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1128761054 15:70216192-70216214 GGATGTCAGGGTAGGGGGTCAGG + Intergenic
1129252325 15:74315842-74315864 GTGTGGAGGGGGAGGGGGACAGG + Intronic
1129689456 15:77705158-77705180 GTGTGTCATGGCAGGGGGAGGGG - Intronic
1129787763 15:78320755-78320777 GTATGTCAGGGGGTGGGGGCGGG + Intergenic
1130060987 15:80569805-80569827 GTGTGTGAGTGGAGAGGGCCAGG + Intronic
1130984077 15:88833404-88833426 GTGAGGCAGAGGAAGGGGACGGG - Intronic
1131086470 15:89579697-89579719 GGGTGTCATGGGAGTGGGATTGG + Intronic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1132049127 15:98592337-98592359 GTCGGTCAGGTGAGCGGGACTGG - Intergenic
1132144981 15:99424358-99424380 GGGAGGCAGGGGAGGGAGACAGG + Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132221627 15:100109476-100109498 GGGTGTGAAGGGAGGGGGAGGGG + Intronic
1133036474 16:3036648-3036670 GTGCGGAAGGGGAGGGGGAGCGG - Intronic
1133109151 16:3535318-3535340 TTGTGTGAGGGGAGAGAGACAGG + Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133826434 16:9282169-9282191 GTGTGGCAGGGGAGAGGCTCTGG + Intergenic
1134037558 16:11042391-11042413 GTGGGCCAAGGGAGAGGGACAGG + Intronic
1134444878 16:14323168-14323190 GGGGGTCAGGGAAGGGGTACTGG - Intergenic
1135315167 16:21438832-21438854 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135368093 16:21871100-21871122 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135443724 16:22500049-22500071 GTGTGGTGGGGGAGGGGGAAGGG - Intronic
1136067915 16:27771090-27771112 GGGTGACAGGGCAGAGGGACTGG - Intronic
1136151923 16:28356707-28356729 GAGGGGCAGGGGAGGGGGAGGGG + Intronic
1136211155 16:28758575-28758597 GAGGGGCAGGGGAGGGGGAGGGG - Intronic
1136255876 16:29038527-29038549 GAGGGGCAGGGGAGGGGGAGGGG - Intergenic
1136311832 16:29417493-29417515 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136325274 16:29519289-29519311 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136412818 16:30086690-30086712 GTGTGTCTGGGGAGAGGGAAGGG + Exonic
1136439961 16:30259271-30259293 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136491199 16:30609720-30609742 GGTTGTCAGGGGAGGTGGGCAGG - Intronic
1136776796 16:32876215-32876237 GGGTGCCAGGGGCTGGGGACAGG - Intergenic
1136778252 16:32882816-32882838 GGGTGGCAGGGGAGGTGGCCAGG - Intergenic
1136892368 16:33978698-33978720 GGGTGGCAGGGGAGGTGGCCAGG + Intergenic
1136893821 16:33985298-33985320 GGGTGCCAGGGGCTGGGGACAGG + Intergenic
1137592332 16:49701260-49701282 GTGTGTGTAGGGTGGGGGACAGG + Intronic
1137730002 16:50682368-50682390 GCCTGTCAGGGGTGGGGGCCAGG - Intergenic
1137731656 16:50694357-50694379 AGGGGTCAGGGGAGGGTGACAGG - Intronic
1138027574 16:53534435-53534457 GTGAGTGAGTGGAGGGGGAGGGG + Intergenic
1138271096 16:55696381-55696403 GTGTGTTGGGGAAGGGGGTCAGG - Intronic
1138323443 16:56139426-56139448 GCTTGTCAGGGGTGGGGGAAGGG - Intergenic
1138374149 16:56551202-56551224 GTGTGCCGGGGCAGGGGGGCAGG - Intergenic
1138389191 16:56657939-56657961 GATAGTCAGGGGAGGGGGCCGGG - Exonic
1138455604 16:57119051-57119073 GAGTCTGAGGGGAGGGGGCCAGG + Intronic
1139470579 16:67176115-67176137 GTGTGTAATGGGAGTGGGGCTGG + Exonic
1140011442 16:71135286-71135308 GAGTGTCAGGGGAGGTGAAGTGG + Intronic
1140419283 16:74804926-74804948 GAGGGACAGGGGAGGGGGAAGGG - Intergenic
1140478526 16:75250787-75250809 GAGTGTCGCGGGAGGGGGCCAGG - Intronic
1140796974 16:78447718-78447740 GGGAGTCAGTGGAGGGGTACTGG + Intronic
1141191846 16:81830787-81830809 GTGTGATAGTGGAGGGGGATGGG + Intronic
1141701931 16:85646608-85646630 CTGTGTCAGGGAAGGGGGCTTGG + Intronic
1141706115 16:85665653-85665675 GTGTGTGAGGGGCCGAGGACTGG - Intronic
1141916006 16:87097571-87097593 GTGTGTCAGGGGGGGCGGGGGGG + Intronic
1141997060 16:87642215-87642237 GCGTGTGAGTGGAGGGGGCCTGG + Intronic
1142229675 16:88893941-88893963 TGCTGACAGGGGAGGGGGACTGG + Intronic
1142367173 16:89656868-89656890 GAGTGCCAGGGGCGGGGGAAAGG + Intronic
1203079212 16_KI270728v1_random:1138324-1138346 GGGTGCCAGGGGCTGGGGACAGG - Intergenic
1203080674 16_KI270728v1_random:1144925-1144947 GGGTGGCAGGGGAGGTGGCCAGG - Intergenic
1203137893 16_KI270728v1_random:1740973-1740995 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1143013501 17:3879330-3879352 GTGTGTCATCGGAGGGTGAGAGG - Intronic
1143237170 17:5412809-5412831 GTGGGGTAGGGGAGTGGGACAGG - Intronic
1143356819 17:6335755-6335777 GTAGGTCTGGGGAGTGGGACAGG - Intergenic
1143483014 17:7238187-7238209 GTGTGTCTGGGGTGGGGGTGAGG - Intronic
1143617861 17:8064275-8064297 ATGGGTCAGGGGAGGGGGGCTGG + Intergenic
1143872340 17:9965961-9965983 GGGTGTCGGGGGATGGGGAAAGG - Intronic
1144022826 17:11252141-11252163 GTGGGTCTGGAGAGAGGGACAGG - Intronic
1144208042 17:12993081-12993103 GAGGGGCAGGGGTGGGGGACAGG + Intronic
1144720250 17:17464130-17464152 GTGTGTTAGGGGAGAGGTATTGG + Intergenic
1144735710 17:17554227-17554249 GTGGCTGAGGGGAGGGGGCCGGG - Intronic
1144756288 17:17682206-17682228 GTGCGTCCGAGGTGGGGGACGGG + Intronic
1144957675 17:19027320-19027342 GTGAGGCAGGGTAGGGGCACAGG + Intronic
1144967552 17:19087583-19087605 GTGTGGCAGGGGTGGGGGTGGGG + Intergenic
1144977481 17:19147196-19147218 GTGAGGCAGGGTAGGGGCACAGG - Intronic
1144980367 17:19164482-19164504 GTGTGGCAGGGGTGGGGGTGGGG - Intergenic
1144987855 17:19213750-19213772 GTGTGGCAGGGGTGGGGGTGGGG + Intergenic
1145014575 17:19387851-19387873 GGGGGGCTGGGGAGGGGGACTGG - Intergenic
1145257835 17:21337326-21337348 GTGTGTGTGTGGAGGGGGAGAGG + Intergenic
1145318798 17:21750681-21750703 GTGTGTGTGTGGAGGGGGAGAGG - Intergenic
1145795201 17:27651410-27651432 GTGTGGCGGGGGAGGGGGGTTGG - Intergenic
1145897134 17:28465698-28465720 GTGTGTATGGGGTGGGGGAAGGG + Intronic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146182550 17:30707437-30707459 GAGTTTTAGAGGAGGGGGACGGG - Intergenic
1146329652 17:31917084-31917106 GTGTGGTAGGGGACTGGGACAGG + Intergenic
1146507623 17:33418945-33418967 GCCTGTCAGGGGTGGGGGGCTGG + Intronic
1146508920 17:33429080-33429102 GTGTGTCAGGGTAAGGTGTCTGG + Intronic
1146762837 17:35493171-35493193 GTGTGTGAGGGGAGGAAGCCAGG - Intronic
1147365217 17:39954574-39954596 GTGTGTCCGTGGAGGGGAAGTGG - Intergenic
1147436513 17:40419868-40419890 GTGTGTCAAGGGAGGGCCAATGG + Intergenic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1147991812 17:44338682-44338704 GTGTGAGAGGGGAGAGGGATGGG - Intergenic
1148047284 17:44751887-44751909 GTGAGGAAGGGCAGGGGGACAGG - Exonic
1148151476 17:45398865-45398887 GTGTGTATGGGGAGGGGCAAGGG - Intronic
1148166907 17:45490304-45490326 GTGTGTCAGGGCGGGGCGAAGGG + Intronic
1148760277 17:49996348-49996370 GTGTGTCGGGGGCGGGGTGCAGG + Intergenic
1149212780 17:54322659-54322681 GCCTGTCAGGGGTGGGGGGCTGG + Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149570834 17:57671353-57671375 GCGTGTGAGGGGGCGGGGACAGG - Intronic
1149851893 17:60042267-60042289 GTGTGGCAGGGAAGGTGGTCAGG + Intergenic
1149863350 17:60136693-60136715 GTGTGTCGGGGGGGGGGGGGGGG - Intergenic
1150221373 17:63497487-63497509 GACTGGGAGGGGAGGGGGACAGG - Intronic
1150289132 17:63971665-63971687 GTGGGTGAGGGGAGGGGGCCAGG - Intronic
1150398084 17:64836708-64836730 GTGTGTCAGGGCGGGGCGAAGGG + Intergenic
1151173774 17:72270195-72270217 GGGTATCAGGGTCGGGGGACAGG - Intergenic
1151227997 17:72660895-72660917 ATGTCTCCGGGGAGGGGGAGGGG + Intronic
1151337300 17:73447508-73447530 GAGTGGCAGAGGAGGGGGACAGG - Intronic
1151534913 17:74733632-74733654 GTGTGTCTGGGGAGAGACACAGG + Intronic
1151698901 17:75732115-75732137 GTGCGTCGGGGGAGCAGGACCGG - Intronic
1151784070 17:76266403-76266425 GTGTGTGTGTGGAGGGGGAGGGG - Intronic
1151810982 17:76441778-76441800 GTTTATCAGTGGAGGGGGAGGGG - Intronic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1152336151 17:79701140-79701162 GTGGGGAAGGGGAGGGGCACAGG + Intergenic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152577708 17:81150095-81150117 GTGGCTGAGGGGAGGGGGATGGG + Intronic
1152648933 17:81483045-81483067 GTGAGTTAGTGGAGGGGGAGTGG + Intergenic
1152931171 17:83110816-83110838 GGGTGCTGGGGGAGGGGGACTGG - Intergenic
1154036370 18:10806176-10806198 GTGATTCGGAGGAGGGGGACTGG + Intronic
1154966538 18:21363284-21363306 GTGTGTGGGGGGGGGGGGGCGGG - Intronic
1156450187 18:37262387-37262409 GTGTGTGTGGGGTGGGGGAGGGG + Intronic
1157045250 18:44094999-44095021 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
1157299274 18:46467914-46467936 GTGTGGTTGGGGAGGGGGAGAGG - Intergenic
1157449092 18:47772201-47772223 GGGTGTCAGGGGAGGAGGCAAGG + Intergenic
1157517140 18:48318881-48318903 GGTTGCCAGGGGAGGGGAACAGG - Intronic
1157611972 18:48962802-48962824 GCCTGGCAGGGGAGAGGGACTGG - Intergenic
1157700660 18:49759930-49759952 GTGTGTAGGGGGTGGGGGGCTGG + Intergenic
1157776185 18:50398209-50398231 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
1157955698 18:52095190-52095212 GCCTGTCAGGGGTGGGGGGCTGG + Intergenic
1158599339 18:58843757-58843779 GAGTGGCAGGGGCGGGGGAGTGG - Intergenic
1158806932 18:60985192-60985214 GTGTGTCAGGGTAAGTAGACTGG - Intergenic
1158839291 18:61366720-61366742 GTGTGTGAGGGAAGAGGGAAGGG - Intronic
1160125685 18:76169437-76169459 GCGTGTCAGGGAAGAGGGACTGG + Intergenic
1160164392 18:76496577-76496599 GTGTGTCGGGGTCGGGGGGCGGG + Exonic
1160211116 18:76880746-76880768 GTGTGGGAGAGGAGGGGGGCAGG + Intronic
1160659096 19:290185-290207 GTGTGCCAGGGGTGGTGGCCAGG - Intronic
1160726752 19:620885-620907 GGGCGCCAGGGGAGGGGGAGGGG + Intronic
1160726771 19:620926-620948 GGGCGCCAGGGGAGGGGGAGGGG + Intronic
1160876948 19:1300804-1300826 CCGTGTGAGGCGAGGGGGACGGG - Intergenic
1160907610 19:1459030-1459052 GGGTGCCAGGGGCTGGGGACAGG - Intronic
1161349887 19:3785768-3785790 GTGTGCCGGGGGCGGGGGACAGG - Intronic
1161434032 19:4251194-4251216 GTGTGCTGGGGGAGAGGGACCGG - Intronic
1161471190 19:4457475-4457497 GAGGGTCAGGGGAGGGGGAGAGG - Intronic
1161739274 19:6010537-6010559 GGGTGCCAGGGGCTGGGGACAGG - Intronic
1162027264 19:7901456-7901478 GTGTTTCAGGGGAGGGGACTGGG - Exonic
1162199208 19:9008924-9008946 GTGACTCAGGGCTGGGGGACTGG + Intergenic
1162367272 19:10257098-10257120 GTGGGTCAGGAGAGGGTGACAGG - Intronic
1162760784 19:12887071-12887093 GTGTGTCCGGGAAGGGGCCCAGG + Exonic
1162809242 19:13154334-13154356 GTATGTCAGCGGAGGGGGAAGGG - Exonic
1162968803 19:14168044-14168066 GTGGGTCAGGGGTGGGTGGCAGG - Intronic
1162976272 19:14208368-14208390 GAGTTTTAGAGGAGGGGGACGGG + Intergenic
1163241879 19:16069004-16069026 GTCTGTGAGGGTAGCGGGACAGG + Intronic
1163611929 19:18306134-18306156 TTGTGTGTGGGGTGGGGGACAGG - Intergenic
1163784528 19:19267926-19267948 GTGGGTCAGGGAAGGGAGACTGG + Intronic
1163883056 19:19944417-19944439 GGGTGGCAGGAGAGGGGGAAAGG - Intergenic
1164557227 19:29263066-29263088 GTGTGTCCAGAGAGGGGCACGGG - Intergenic
1165782388 19:38442014-38442036 GTGTCTCAGGGGAGAGGCATGGG + Intronic
1166206303 19:41271783-41271805 GTCTGGCAAGGGAGGGGGAGAGG - Intronic
1166214480 19:41326236-41326258 TGTTTTCAGGGGAGGGGGACAGG - Intronic
1166764431 19:45244550-45244572 GTGAGTCAGGGGCTGGGCACTGG - Intronic
1166773427 19:45298096-45298118 GGGTGACAGGGGAGGAGGAAAGG - Intronic
1166914303 19:46184417-46184439 GCCTGTCGGGGGTGGGGGACTGG - Intergenic
1166999345 19:46736796-46736818 GTGTGCTCGGGGAGGGGGGCTGG - Intronic
1167044278 19:47040731-47040753 GTGTGTGTGGGGGGGGGGTCTGG + Intronic
1167135186 19:47611395-47611417 GTGTGTGAGGAGTGGGGGAGGGG + Intronic
1167569303 19:50276902-50276924 GTGGGTTGGGGCAGGGGGACAGG + Intronic
1167611717 19:50511024-50511046 TGGTGTCCGGGGAGGGGGCCTGG - Intronic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1167807716 19:51800071-51800093 GTGTGTCAGTGAAGGGGAGCTGG + Intronic
926108648 2:10168258-10168280 GGGTGTCAGGGGTGGGGGGAAGG - Intronic
926146483 2:10399673-10399695 GTGGGTCAGGTGATGGGCACTGG + Intronic
926195851 2:10763211-10763233 GGGTGTCAGGTGAGGAGGGCTGG - Intronic
926210282 2:10864177-10864199 GTGTCTCAGGAGAGGGGTTCAGG + Intergenic
926890403 2:17634592-17634614 GGGTGTCAGGGGACGGGAAGGGG - Intronic
926972596 2:18481891-18481913 GGGTGTCAGGAAAGGGGGCCTGG + Intergenic
927071777 2:19538042-19538064 GGGTTTCAGGGGAGAGGGAGAGG + Intergenic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
928020441 2:27700510-27700532 GTGTGTGGGGGGTGGGGGACAGG - Intergenic
930062937 2:47305867-47305889 GTGTGTGGGGTGAGGGGAACAGG + Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931232182 2:60384208-60384230 GTGTGTTTTGGGGGGGGGACAGG - Intergenic
931867421 2:66426854-66426876 GTGGCTCAGGGCACGGGGACCGG + Intergenic
932055278 2:68437124-68437146 AAGTGTTGGGGGAGGGGGACAGG - Intergenic
932312321 2:70753583-70753605 GTGTGTCAGGGGTTGGGGGGTGG + Intronic
933642834 2:84782574-84782596 GTGGGTGAGGGCAGGGGGCCAGG - Intronic
933764706 2:85698682-85698704 GGGAGTCAGGGGAGGGAGACTGG - Exonic
933858558 2:86441841-86441863 GTGTGGCGGGGGAGGGCGGCGGG + Intronic
933936234 2:87205874-87205896 GAGTCTCAGGGGATGGGGAAGGG - Intergenic
934067069 2:88350469-88350491 GTGGGTCTGGGGAGGAGGAGGGG + Intergenic
934504270 2:94879062-94879084 GGGTGCCAGGGGAGGGGGCCTGG + Intergenic
934601801 2:95663632-95663654 CTCCTTCAGGGGAGGGGGACGGG + Intergenic
934661191 2:96144612-96144634 GTGTGTTGGGGGAGGGGGTGGGG - Intronic
935330620 2:101974883-101974905 TGGAGTCAGGGGAGGGGGGCGGG + Intergenic
935828727 2:106977132-106977154 GGGTGTCAGGGGTGGGGTAAAGG + Intergenic
936356915 2:111759955-111759977 GAGTCTCAGGGGATGGGGAAGGG + Intergenic
936535153 2:113305787-113305809 CTCCTTCAGGGGAGGGGGACGGG + Intergenic
937229533 2:120389450-120389472 GTATGTCAGGAGACGGGGCCAGG - Intergenic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
937956821 2:127426412-127426434 GTGGGTGAGGGGAGGGGCATGGG + Intronic
938112013 2:128574227-128574249 GTGGGACAAGGGAGGGGTACAGG + Intergenic
939163877 2:138619538-138619560 GAGTGTCATGGGAGAGGAACTGG - Intergenic
939420212 2:141957378-141957400 GTGTGTGGGGGGGGGGGGGCGGG + Intronic
939983226 2:148805668-148805690 GTGGGGGAGGGGAGGGGGAGGGG - Intergenic
940098928 2:150010915-150010937 GTGGGGTAGGGGAGGGGGAGGGG + Intergenic
940586462 2:155658436-155658458 GTATATCCGGGGAGGGGGAAGGG + Intergenic
940951734 2:159682905-159682927 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
945038149 2:205721917-205721939 GTGCCTCAGGGGAGGGGCAAAGG - Intronic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946150738 2:217766725-217766747 GTGTTTCAGGGGAGCCAGACTGG - Intergenic
946252933 2:218424352-218424374 GTGAGTCAGGGGCAGGGGAGGGG + Intronic
946322272 2:218960949-218960971 GTGTGTCAGGGGCTGGGGCGGGG - Exonic
946419039 2:219554628-219554650 GTGTGACCGGGGAGTGGGCCCGG - Exonic
946847639 2:223873885-223873907 GTGTGTCAGGGATGGGAGAGTGG - Intronic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947724293 2:232387743-232387765 GTGTGTGCAGGGAGGGGGACAGG - Intergenic
947729480 2:232420103-232420125 GTGTGTGCAGGGAGGAGGACAGG - Intergenic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
948290047 2:236817963-236817985 GAGTGCCAGGGAAGGGGGGCTGG + Intergenic
948386839 2:237585843-237585865 GTGCGTGAGGGGAGGGGGTGAGG - Intronic
948519677 2:238527945-238527967 GTCTGTCTGGGGGGAGGGACAGG + Intergenic
948940442 2:241192897-241192919 GGGTGCCAGGGGCTGGGGACGGG + Intronic
1168977694 20:1980503-1980525 AGGTGGCTGGGGAGGGGGACGGG - Exonic
1170428699 20:16258921-16258943 GTGTGTCTGGGATGGGGAACGGG - Intergenic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171210282 20:23311183-23311205 GAGTGGGAGGGGAGGGGGACAGG - Intergenic
1171767221 20:29296931-29296953 GCCTGTGAGGGGAGGGGGAAGGG + Intergenic
1171769403 20:29310965-29310987 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1172122563 20:32607567-32607589 GCCTGGCAGGGGAGGGAGACTGG - Intronic
1172186492 20:33034295-33034317 GTGTGGCAGGGGAGGGGCAGCGG + Intronic
1172479781 20:35264216-35264238 GTGTGGAAGGGGAGGGGTAAAGG - Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172840866 20:37902207-37902229 GTGTGGCAGGGGAGGGGGATAGG - Intergenic
1172997606 20:39082812-39082834 GTGTGTGAGGGGATGTGGCCAGG + Intergenic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173202403 20:40963546-40963568 GTGGGACAGGGGAGGGGTGCTGG - Intergenic
1173285802 20:41670572-41670594 GTGTGTGAGGGGGGTGGGAGTGG + Intergenic
1173485558 20:43438553-43438575 GTGTGTGGGGGGATGGGGATGGG - Intergenic
1173585238 20:44177245-44177267 GGGTGTGGGGCGAGGGGGACAGG - Intronic
1173930866 20:46817221-46817243 ATGGGTCTGGGGAGGGGGAAAGG + Intergenic
1174386520 20:50191005-50191027 GGGTGCCCGGGGAGGGGGCCTGG - Exonic
1174710647 20:52701346-52701368 GTGGGTCTGGGGATGGGGCCTGG + Intergenic
1174814898 20:53678183-53678205 GTGTGTGCGGGGTGGGGGAAGGG + Intergenic
1174924500 20:54742762-54742784 GTGTGTGTGGGGAGGGGGTGGGG + Intergenic
1175504013 20:59469429-59469451 GTGTGGCAGGGCAGGGAGACTGG + Intergenic
1175653337 20:60748095-60748117 GAGTGTCAGTGGAAGGAGACTGG - Intergenic
1175806537 20:61832201-61832223 GTGGGTCAGAGCAGGGGCACTGG + Intronic
1175940125 20:62533917-62533939 GTGGGTGGGGGCAGGGGGACCGG + Intergenic
1176551852 21:8226565-8226587 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176570761 21:8409564-8409586 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176578670 21:8453711-8453733 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176621769 21:9066105-9066127 GGGTGCCAGGGGAGGGGGCCTGG - Intergenic
1177030653 21:15979705-15979727 GAGTGTCAGTGAAGGGAGACAGG + Intergenic
1177621352 21:23598927-23598949 GTGTGTATGAGGTGGGGGACAGG + Intergenic
1177769886 21:25502609-25502631 ATGTGTCAAGGGTGGGGGCCAGG - Intergenic
1178348700 21:31854350-31854372 GTGTGTCACAGCAGGGTGACTGG + Intergenic
1178690612 21:34746698-34746720 GGGGGTGAGGGGACGGGGACTGG + Intergenic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1178951984 21:36992806-36992828 TGGTGCCAGGGGAGGGGGAGTGG - Intergenic
1178976951 21:37228169-37228191 GGGTGGCAGTCGAGGGGGACAGG + Intronic
1179502557 21:41819456-41819478 GTGTGGCGGGGGCGGGGGCCGGG - Intronic
1179787048 21:43735883-43735905 GTGTGGCAGGGGCGAGGGAAGGG - Intronic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1179903581 21:44407604-44407626 GTGGCTGAGGGGAGGGGAACGGG - Intronic
1180094449 21:45549621-45549643 ATGTGGCAGGGGAGGGGCAGGGG + Intergenic
1180179419 21:46111395-46111417 GGGTGCCAGGGGAGAGGCACTGG + Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180552713 22:16553530-16553552 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1181182809 22:21079302-21079324 GCCTCTCAGGGCAGGGGGACTGG + Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1182221223 22:28760519-28760541 GTGTGTTGGGGGTGGCGGACAGG - Intergenic
1182351159 22:29700782-29700804 GCCTGGCAGGGGAGGGGGAGAGG - Intergenic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1182585909 22:31344297-31344319 GTGTGGCAGGGGAGGAAGAGGGG + Intronic
1182586026 22:31344814-31344836 GCCAGTCAGGGGAGGGGCACTGG + Exonic
1182868927 22:33628845-33628867 GTGGGTCTGGGGTGGGGGGCAGG + Intronic
1183037513 22:35151313-35151335 GTGAGGCAGGGGAGAGGGAGGGG - Intergenic
1183300540 22:37056935-37056957 ATGTGTGAGGGTTGGGGGACAGG + Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183423670 22:37726150-37726172 GAGAGTCAGTGGAGGGGGCCAGG - Exonic
1183750993 22:39720234-39720256 GGGTGTCATGGGACGGGGGCTGG + Intergenic
1184035449 22:41915681-41915703 AGGTGTGAGGAGAGGGGGACTGG + Intergenic
1184317813 22:43710847-43710869 GGGAGTCAGGGGAGGGAGATAGG + Intronic
1184571450 22:45327595-45327617 CGCTGTCAGGGGAGGTGGACAGG - Intronic
1184682440 22:46079530-46079552 GTCTGAGAGGGGAGGGTGACTGG + Intronic
1184690375 22:46114672-46114694 GGGTGTCAGGGTAGGGGTGCCGG - Intergenic
1184768402 22:46584568-46584590 GTGTGTCTGCGTAGTGGGACTGG + Intronic
1184846727 22:47092338-47092360 GTGTCTCAGTGAAGAGGGACAGG + Intronic
1184978641 22:48080868-48080890 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185138724 22:49088564-49088586 GTGTGACAGGGCAGGGGGTTGGG + Intergenic
1185197642 22:49482296-49482318 GTGTGTGAAGGGAGGCGGCCGGG - Intronic
1185330266 22:50249201-50249223 GTGGGGCAGGGGAGGGGCCCGGG + Intronic
1185427581 22:50781998-50782020 GTGTGTCAGGTGGAGGGGGCAGG - Intronic
1203256873 22_KI270733v1_random:143487-143509 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
949643510 3:6066968-6066990 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
950530278 3:13549059-13549081 CGGAGTCAGGGGAGGGGGCCGGG + Intergenic
950534135 3:13569604-13569626 GTGCTACTGGGGAGGGGGACAGG + Intronic
950573927 3:13819497-13819519 GTGGGGCAGGGGTGGGGGGCGGG - Intronic
951017441 3:17745836-17745858 GGGTGGCAGGGGAGGGGGAGCGG - Intronic
952748129 3:36801292-36801314 GTGTGTCAGGGTTGGGGGTAAGG + Intergenic
952996788 3:38890832-38890854 GTGTGTGAATGGAGGGGGATAGG + Intronic
953190893 3:40686949-40686971 GTGTGCCGGGGGAGGGAGACTGG + Intergenic
953534277 3:43765413-43765435 GTGTGTGGGGGAAGGGGTACAGG + Intergenic
954750579 3:52811224-52811246 AGGTGGAAGGGGAGGGGGACCGG - Intergenic
955903859 3:63786186-63786208 GGGGGTCAGGGGAGTGGGAATGG - Intergenic
956497111 3:69839877-69839899 GGGTGTGGGGGGAGGGGGATGGG - Intronic
956683419 3:71802815-71802837 GGGAGTCAGGGGAAGGGGAAAGG + Intergenic
957672818 3:83327582-83327604 GCCTGTCAGGGGTTGGGGACAGG + Intergenic
957916878 3:86696773-86696795 TAGTTTCAGGGGAGGGGGAAGGG + Intergenic
957917342 3:86703440-86703462 GCCTGTCAGGGGATGGGGGCTGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958661738 3:97077542-97077564 GCCTGTCAGGGGAGGGGGATGGG - Intronic
958902950 3:99909394-99909416 TTGGGTCAGGTGAGGGGGTCTGG + Intronic
959371587 3:105533693-105533715 GGGTGTGAGGGCAGGAGGACAGG + Intronic
959949172 3:112160411-112160433 GTGGGTGGGGGGAGGGGGAAGGG - Intronic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960505548 3:118489026-118489048 GTGTGTGAGGTGAGGGGGTGGGG + Intergenic
961091613 3:124117629-124117651 GTGTGTCGGGGGAGTGGGGTGGG + Intronic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961575971 3:127836776-127836798 GTGTGCCAGGAGAGGTGGCCAGG + Intergenic
961823784 3:129588351-129588373 GGGTGTCGGGGGTGGGGGAGGGG + Intronic
962319511 3:134378643-134378665 GGGGGTGAGGGGAGGGGGAGGGG + Intergenic
962370897 3:134820043-134820065 GTGGGTGAGGGGAGGGGAAGGGG - Intronic
962610806 3:137074587-137074609 GTGTGTGAGGTGAGGTGGAGTGG + Intergenic
962627729 3:137243402-137243424 GTGTTTTAGGGGAGGGGGTGCGG - Intergenic
963259763 3:143180094-143180116 GCCTGTCAGGGGAGGGGGTGGGG - Intergenic
964234622 3:154510850-154510872 GGGTGTCAGGGCAGGGGGAGGGG + Intergenic
964917369 3:161853788-161853810 TAGTTTCAGGGGAGGGGGAAGGG + Intergenic
965091499 3:164169187-164169209 GCCTGTCGGGGGAGGGGGGCTGG - Intergenic
965502207 3:169470564-169470586 GTGTATGAGGGGGAGGGGACAGG + Intronic
965809353 3:172576307-172576329 GCCTGTCAGGGGATGGGGAAGGG + Intergenic
966183144 3:177204784-177204806 GAGTGGCAGGAGACGGGGACAGG + Intergenic
966924577 3:184636000-184636022 GTGAGTCAGGGGTGGTGGGCAGG + Intronic
967006757 3:185391225-185391247 GGGTGTGTGGGGAGGGGGAATGG - Intronic
967115380 3:186332868-186332890 GTCTATCATGGGAGGGGAACTGG + Intronic
967573840 3:191066450-191066472 GTGTGTCAGAGGAGGAGTATGGG + Intergenic
967795171 3:193592129-193592151 GTGTGGCATGGGTGGGGGGCGGG + Intronic
968134746 3:196213163-196213185 GGGTGTGGGAGGAGGGGGACTGG + Intronic
968582677 4:1402302-1402324 GTGGGGCAGGGGAGTGGGACCGG + Intergenic
968739494 4:2320126-2320148 GTGGGGGAGGGGAGGGGGACAGG - Intronic
968913309 4:3486463-3486485 GTGTGGCGGGGAAGGGTGACTGG + Intronic
969045961 4:4336957-4336979 GTGTGCCAGGGGCTGGGGTCAGG + Intergenic
969153183 4:5187588-5187610 GTGTGTCGGGGCAGGGTGGCAGG + Intronic
969302351 4:6304545-6304567 GTGGCCCAGGGGAAGGGGACAGG - Intergenic
969370363 4:6727735-6727757 GAGGGGCAGGGGAGGTGGACGGG - Intergenic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
971234557 4:24829440-24829462 GTGGGTCTGGGGTGGGGGTCAGG + Intronic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
973362873 4:49181324-49181346 GTGTGTCAGGGGCAGACGACAGG - Intergenic
973398225 4:49615530-49615552 GTGTGTCAGGGGCAGAAGACAGG + Intergenic
974845599 4:67348136-67348158 TAGTGTCGGGGGAGGGGGCCGGG + Intergenic
974969364 4:68805204-68805226 TTGTTTCAGGGGAGGGGGAAGGG - Intergenic
974977371 4:68906937-68906959 TGCTGTCAGGGGAGGGGCACCGG + Intergenic
975001258 4:69225117-69225139 TAGTTTCAGGGGAGGGGGAAGGG + Intergenic
975004180 4:69267166-69267188 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
975004928 4:69272193-69272215 TAGTTTCAGGGGAGGGGGAACGG - Intergenic
975012590 4:69376130-69376152 TAGTTTCAGGGGAGGGGGAAGGG - Intronic
975472715 4:74788962-74788984 GTGTGTCGGGAGAGAGGGAGTGG + Intronic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
976973853 4:91142125-91142147 ACGTGTCAAGGGTGGGGGACAGG + Intronic
977002493 4:91521033-91521055 GCCTGTCAGGGGCGGGGGTCTGG - Intronic
977150254 4:93502703-93502725 GTGTGTGTGGGGGGGGGGAGTGG - Intronic
977323259 4:95546925-95546947 GGGTGGCGGGAGAGGGGGACGGG - Intronic
978659584 4:111108554-111108576 CTCTGGCAGGGGAGAGGGACCGG + Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980973384 4:139587776-139587798 GTGTTTGTGGGGAGGGGGACAGG + Intronic
981622126 4:146713136-146713158 GTGTGTAAGAGGTGGGGGAGGGG + Intronic
981823997 4:148918435-148918457 GTGTGTCGGGGCAGGGGGCTGGG + Intergenic
982329852 4:154169538-154169560 GTGGGGGAGGGGAGGGGGAGGGG - Intergenic
982439698 4:155421513-155421535 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
982844066 4:160226911-160226933 GTGTTTCAGGGGAGGGATATTGG + Intergenic
983153934 4:164320792-164320814 GTGTGTGGGGGGAGTGGGGCTGG + Intronic
983452005 4:167923198-167923220 GAGAGTCAGGGAAGGGAGACAGG - Intergenic
984013880 4:174403298-174403320 GACTGCCAGGGGAGGGGGACGGG + Intergenic
984290581 4:177789129-177789151 TAGTTTCAGGGGAGGGGGAAGGG - Intronic
985234188 4:187854944-187854966 GGGTGTAAGGGGAGGGGAAATGG + Intergenic
985544035 5:500393-500415 GGGTGGCAGGAGACGGGGACGGG + Intronic
985704472 5:1392457-1392479 GGGAGCCTGGGGAGGGGGACAGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986244353 5:5991930-5991952 GTGTGGCATGGCAGGGGGAGGGG + Intergenic
987391067 5:17375887-17375909 GCCTGTCAGGGGTGGGGGGCTGG - Intergenic
987435786 5:17892595-17892617 GTGTGTGAGGGGAGAGGAAACGG + Intergenic
988958000 5:36338469-36338491 GTGTGTCAAGTGAGGATGACAGG + Intergenic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
992121000 5:73592100-73592122 GTGTGTCAGGGGAGAGGATAGGG - Intergenic
992506875 5:77395733-77395755 GTGTGTCTGGTGAGGGGGTGGGG - Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992983512 5:82202814-82202836 GTGTTTCAGGCCAGGGGAACTGG - Intronic
993711095 5:91226135-91226157 GTGTGTTGGGGTAGGGGGAGGGG + Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
997529398 5:134572671-134572693 GTGTCTCAAGGGAGGGGGCTTGG + Intronic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998237925 5:140415928-140415950 TGGGGTCAGGGGAGGGGGAAGGG - Intronic
998951307 5:147395545-147395567 GCCTGTCAGGTGAGTGGGACAGG - Exonic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999939264 5:156522755-156522777 GTGTGTCGGGGGGTGGGGATGGG - Intronic
1000145502 5:158449539-158449561 GAGTGTCAGGTCAGGGAGACAGG - Intergenic
1000294525 5:159901439-159901461 GAGGGGGAGGGGAGGGGGACGGG + Intergenic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001652383 5:173325007-173325029 ATATGTCAGTGGATGGGGACTGG + Intronic
1001770477 5:174292404-174292426 ATTTGTCTGGGGAGGGGGAATGG - Intergenic
1001779103 5:174352219-174352241 GCCTGTCAGGGGTGGGGGATAGG + Intergenic
1001857245 5:175023578-175023600 ATGTGTGAGGCGAGGGAGACTGG - Intergenic
1002194529 5:177494883-177494905 TGGGGTCAGGGGAGGGGGAGGGG + Intronic
1002581812 5:180213175-180213197 GTGACTCAGGGAAGGGGCACCGG + Intergenic
1002783302 6:383127-383149 GCTTGTCAGGGGAGTGGGCCAGG + Intergenic
1002951402 6:1815978-1816000 GTGTGTCAGAGGTGGGGAAATGG - Intronic
1003013994 6:2453182-2453204 GTTAGTGAGGGGAGGGGGATAGG - Intergenic
1003460384 6:6323046-6323068 GGGAGTCAGTGGAGGGAGACTGG - Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1003951624 6:11121562-11121584 GTGTGTGTTGGGAGGGGGAGAGG - Intronic
1004247721 6:13996232-13996254 GTCTGTCGGGGGACGGGGAGGGG - Intergenic
1004934323 6:20492352-20492374 GTGTGTGAGGGGAGGAGGCCAGG - Exonic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006136212 6:31897613-31897635 GTGCGGAAGGGGAGGGGGAGAGG - Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006429904 6:33989038-33989060 GTGTCACAGGGGACGGGGACTGG - Intergenic
1006795130 6:36727313-36727335 TTGCCTCTGGGGAGGGGGACTGG + Intronic
1006984281 6:38167000-38167022 GTGTGGCGGAGGAGGGGGAGGGG - Intergenic
1007120741 6:39378659-39378681 ATGTGTCAGGTGAGAGGGACAGG - Intronic
1007701105 6:43767156-43767178 GTGTTCCAGGTGAGGGGGAAGGG - Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1009923004 6:70086265-70086287 GTGTGTCAGGGGGGTGGGGCAGG - Intronic
1010437441 6:75849975-75849997 TAGTTTCAGGGGAGGGGGAAGGG + Intronic
1011021350 6:82816601-82816623 GCCTGTCAGGGGTGGGGGGCTGG + Intergenic
1011055393 6:83198552-83198574 GTGTGTAGGGGGAGGGGGTTGGG - Exonic
1011071525 6:83390839-83390861 GGGTGGCTGGGGAGGGGGAGAGG - Intronic
1011442047 6:87397869-87397891 GAGTGTGAGGGGAGAGGGAGTGG + Exonic
1012313088 6:97752372-97752394 GTGAGACAGGGTAGGGAGACAGG + Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012641745 6:101626125-101626147 TAATGTCAGGGGAGGGAGACAGG - Intronic
1012946281 6:105469287-105469309 GTGTATCGGGGGAGGGTGAGGGG + Intergenic
1013115310 6:107099091-107099113 GTGTGTGGGTGGAGGGGGATGGG + Intronic
1013346555 6:109266015-109266037 GTGTGTGTGGGGTGGGGTACTGG - Intergenic
1015222776 6:130824015-130824037 GAGTGGGAGGGGTGGGGGACAGG + Intergenic
1016923317 6:149317362-149317384 GAGTGTCGGGGGAGGGGTACAGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017382745 6:153848936-153848958 GTATGGCAGGGGAGGAGGATGGG - Intergenic
1017464586 6:154682649-154682671 GTGTGGCAGGGGATGGGTTCGGG - Intergenic
1018037436 6:159893376-159893398 GTGTCTCAGGGTAGGGGGCAGGG + Intergenic
1018373144 6:163186862-163186884 GTGTGTGCGGTGAGGGCGACGGG - Intronic
1018468845 6:164079260-164079282 GTCTGTCAGAGGAGAGAGACGGG + Intergenic
1018705404 6:166460480-166460502 GTGTGGAGGGGGAGGGGCACTGG + Intronic
1018842695 6:167529594-167529616 GTTTGTCAGGGGCTGGGAACAGG + Intergenic
1018953048 6:168391485-168391507 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953081 6:168391621-168391643 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953146 6:168391864-168391886 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953162 6:168391918-168391940 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953190 6:168392027-168392049 GTGTGCTAGGGGATGAGGACAGG - Intergenic
1018953211 6:168392107-168392129 GTGTGCTAGGGGATGAGGACAGG - Intergenic
1018953217 6:168392134-168392156 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953246 6:168392241-168392263 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953267 6:168392324-168392346 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953302 6:168392433-168392455 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953312 6:168392460-168392482 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953322 6:168392487-168392509 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1019965962 7:4498866-4498888 GTGTGTAAGAGGAGGGAGTCAGG - Intergenic
1020244549 7:6420607-6420629 TTGTGTTAGGGGTGTGGGACTGG + Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1021272516 7:18608286-18608308 GAGTGGGAGGGGAGGGGGACTGG + Intronic
1021313326 7:19117764-19117786 GTGGGACGGGGGAGGGGGACTGG - Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021865393 7:24951594-24951616 GTGTGTGTGGGTAGGGGGAAGGG - Intronic
1022100377 7:27165800-27165822 GTGTGTATGGGGGGGGAGACGGG - Intronic
1022977789 7:35574920-35574942 GTGTCTCAGGGGAGTGTGGCAGG - Intergenic
1023141637 7:37108315-37108337 GTGTGTCAGGGAGGGGTGTCGGG - Intronic
1023177586 7:37448603-37448625 GCGCGGCAGGGGAGGGGGCCGGG - Intronic
1023329986 7:39104542-39104564 GAGAGACAGGGGAGGGGGAAGGG + Intronic
1023658302 7:42448379-42448401 GTGTGTCTGGGGAGGTGGGCTGG + Intergenic
1023739809 7:43269352-43269374 GTGTGTCAGGGAAAGGGATCGGG - Intronic
1024249316 7:47494481-47494503 GTCTTTCAGGGGAGGTGGAGTGG - Intronic
1024301486 7:47890549-47890571 CCGAGTCAGGGTAGGGGGACAGG + Exonic
1026438012 7:70416828-70416850 GTGTGTCAGAGGAGGGGAGCAGG - Intronic
1026848037 7:73708564-73708586 GAGTGTGTGGGGCGGGGGACGGG - Intronic
1026892311 7:73989400-73989422 GGGGGACAGGGAAGGGGGACAGG + Intergenic
1026909548 7:74084100-74084122 GTGGGGCACGGGAGGGGGCCGGG + Intronic
1029114945 7:98232002-98232024 GGGTGCCAGGGGAGGAGGGCGGG + Intronic
1029371637 7:100154565-100154587 CTGTCTCAGGGGTTGGGGACAGG - Exonic
1030320025 7:108156515-108156537 GGGTGTCAGAGTAGGGGCACAGG + Intronic
1031072688 7:117179700-117179722 GTGTGGGGGGGTAGGGGGACTGG + Intronic
1031382403 7:121103025-121103047 TTGTATCAGGGTAGGGGGAGCGG - Intronic
1032564916 7:132931816-132931838 GTGTGTCGGGGTAGGGGGAGGGG - Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033882588 7:145903283-145903305 GTGTGCTTGGGGAGGGGGATGGG + Intergenic
1034208373 7:149339559-149339581 GTCTGTCATGGGGTGGGGACTGG - Intergenic
1034285478 7:149880778-149880800 GTGGGTCTGGGGAGGGGAGCAGG + Intergenic
1034420245 7:150986776-150986798 GGGTGGCAGGAGAGGGAGACAGG + Intergenic
1035407614 7:158609832-158609854 GTGTGTGAGGGGAGTGTGAGGGG + Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037475501 8:19252923-19252945 ATGTGTCAGGGAAGTGGTACAGG - Intergenic
1037700209 8:21267070-21267092 CTCTGTCAGGGGAGGATGACAGG - Intergenic
1039290148 8:36085888-36085910 GTGTGGCAGGGGAAGGGAACAGG + Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1040112061 8:43570985-43571007 GTCTCCCAGGGGATGGGGACAGG - Intergenic
1040112117 8:43571202-43571224 GTCTTCCAGGGGAAGGGGACAGG - Intergenic
1040466903 8:47703869-47703891 GTGTGTCAGGGAGAGGAGACGGG + Intronic
1041094996 8:54341351-54341373 GTGGCTCAGGGGAGGGTGAGGGG + Intergenic
1041168834 8:55119599-55119621 GAGTGTCAGGGGAGGCTCACAGG + Intronic
1041474341 8:58247419-58247441 GTGTGTCAGGGGGGGCGGGGTGG - Intergenic
1041588400 8:59547372-59547394 GTGGGGCAGGGGAGGGGGAGGGG - Intergenic
1042155437 8:65840972-65840994 GTGTGTATGGGAAGGGGGACAGG + Intronic
1042684392 8:71421879-71421901 GTGTGCAAAGGGAGGGGGACAGG + Intronic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044184716 8:89237785-89237807 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
1044739520 8:95311941-95311963 ACGTGTCAGAGGAGGGAGACAGG - Intergenic
1045359670 8:101421300-101421322 GTATGTCACGGGATGGTGACAGG + Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045516226 8:102863420-102863442 CTGTTTCCGGGGAGGGGGCCCGG - Intronic
1045582780 8:103499352-103499374 GGGTGTCAGGGATGGGGGCCAGG - Intergenic
1046738740 8:117806293-117806315 AAGTGACAGGGGAGGAGGACAGG - Intronic
1047024392 8:120811127-120811149 GTGTGTTGGGGGGGGGGGAAGGG - Intronic
1047260219 8:123251043-123251065 GAGTGTCGGGGGAGGGAGCCTGG + Intronic
1047347329 8:124040790-124040812 GGCTGTCATGGGAGGGGAACTGG - Intronic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047704753 8:127486719-127486741 GTGTGTGGGGGTGGGGGGACAGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1047984906 8:130222516-130222538 GTGTGTCAGTGGAGAAGGATAGG - Intronic
1048483610 8:134827054-134827076 GGGTGTCCGGAGAGGGAGACAGG + Intergenic
1048645343 8:136413660-136413682 GTGTGTGAGGGAAGGTGGAAGGG - Intergenic
1049683730 8:143930965-143930987 GAGTGACAGGGAAGAGGGACTGG - Intronic
1049765317 8:144352682-144352704 GGGTGTCAGGGGCGCGGGCCTGG + Intronic
1050573185 9:6964230-6964252 GGGGGTCAGGGGAGGGGGGAGGG - Intronic
1050620018 9:7442541-7442563 GTGTGTCAGGGCGGGGGGGGGGG - Intergenic
1051679559 9:19593452-19593474 GGGAGACAGGGGAGGGGGAAAGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052078251 9:24171944-24171966 GTGTGGCAGGGGGAGGGGAGTGG + Intergenic
1052287722 9:26805839-26805861 GTGTGTCAGGGGACGAGGACTGG - Intergenic
1052370808 9:27662723-27662745 GTGTTTCGGGTGAGGGAGACAGG - Intergenic
1053348546 9:37395994-37396016 GTGTGGGAGGGGAGGGGGCCGGG - Intergenic
1053683443 9:40499917-40499939 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1053933422 9:43128232-43128254 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054280272 9:63125011-63125033 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054296546 9:63335415-63335437 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054356831 9:64070602-64070624 GTGTGTGCGGGTAGGGGGAGTGG - Intergenic
1054394564 9:64639920-64639942 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054429213 9:65145119-65145141 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054501171 9:65876416-65876438 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054862659 9:69969499-69969521 GAGTGCCAGGGGAGGGAAACAGG + Intergenic
1055318719 9:75060400-75060422 GTCTGTCGGGGGTGGGGGGCTGG + Intergenic
1056292428 9:85157153-85157175 GTGGGTCTGGGGTGGGGGAGTGG + Intergenic
1056488837 9:87085343-87085365 GGGCGCCAGGGGAGGGGGAGGGG - Intergenic
1057031171 9:91776263-91776285 GTGGGTCTGGGGATGGGGAGGGG - Intronic
1057501457 9:95599931-95599953 GTGTGTCGGGGGGGGGGCAGGGG + Intergenic
1057513758 9:95703441-95703463 GTGGGTCGGGGGAGGGGGGAGGG + Intergenic
1058099736 9:100905690-100905712 GTGTGTGGGGGGGGGGGGGCGGG + Intergenic
1058139429 9:101342358-101342380 GAGTTTGAGGGGAGGGGGAGAGG + Intergenic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1059165404 9:112072511-112072533 GTGTGTTGGGAGAGGGGGAGGGG - Intronic
1059300980 9:113313316-113313338 GGGTCCCAGGGAAGGGGGACAGG - Exonic
1059842035 9:118228420-118228442 GTGTGTGAGGGGACAGGGAATGG - Intergenic
1059940424 9:119353969-119353991 GTGGGTCAAGGGAGAGGGAGGGG - Intronic
1059965130 9:119606254-119606276 ATGTGTCAGGGGTGGGGGGCTGG - Intergenic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060419486 9:123457655-123457677 GAGGCTCAGGGGAGGGGGATTGG - Intronic
1060775933 9:126374531-126374553 GTGAGACAGGGGTGGGGGCCAGG + Intronic
1061060026 9:128245482-128245504 GTGTCCCAGGGGAGGGGTTCAGG - Intronic
1061163963 9:128911795-128911817 GTGTTCCAGGGGGTGGGGACAGG - Intronic
1061227574 9:129289577-129289599 GTGTGTCAGGGGCGCTGGGCGGG + Intergenic
1061471630 9:130831339-130831361 GTGTGTCAAGGGAAGGAGGCAGG - Intronic
1061489869 9:130938976-130938998 GTGTGTCGGGGGAGGCCGAGGGG - Intronic
1061519769 9:131111296-131111318 GTGTCTTGGGGGAGGGGCACGGG + Intronic
1061527307 9:131176870-131176892 CTGTTTCAGGGGTGGAGGACAGG - Intronic
1061601359 9:131672409-131672431 GTGTCACATGGGAGGGGGTCTGG + Intronic
1061604029 9:131694939-131694961 GTGGGTGGGGGGAGGGGGAAGGG - Intronic
1061728355 9:132594027-132594049 GTGGGTCGGGGGCGGGGGGCGGG + Exonic
1061943498 9:133895125-133895147 AAGGGGCAGGGGAGGGGGACAGG + Intronic
1062096367 9:134706022-134706044 CTCTGCCAGGGGAGGAGGACAGG - Intronic
1062099375 9:134720255-134720277 GCTTTTCAGGGGATGGGGACAGG - Intronic
1062105709 9:134753761-134753783 GGGTGGCAGGGGAGGGGCAGGGG - Intronic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1062645798 9:137547501-137547523 ATGAGCCAGGGGATGGGGACAGG + Intronic
1062712433 9:137983887-137983909 GTGTGTCTGGGGTGGGGGGTGGG + Intronic
1203744957 Un_GL000218v1:36519-36541 GGATGCCAGGGGAGGGGGCCTGG - Intergenic
1203473031 Un_GL000220v1:125169-125191 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1203565149 Un_KI270744v1:82965-82987 GGATGCCAGGGGAGGGGGCCTGG + Intergenic
1185459744 X:328715-328737 GGGGGAGAGGGGAGGGGGACGGG - Intergenic
1185532896 X:835845-835867 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1185652599 X:1659935-1659957 GTGTGTGAGAGGAGGGGCACAGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187128956 X:16482229-16482251 GGGTGTGGGGGGAGGGGGACTGG + Intergenic
1187429723 X:19211181-19211203 TGGTGTCAGGGCAGGGGGAGGGG - Intergenic
1189564133 X:42222256-42222278 GTGAGTAGGGGGAAGGGGACAGG - Intergenic
1189854017 X:45205099-45205121 GGGTGTCGGGGGAGGGGAAGTGG - Intergenic
1189983123 X:46530242-46530264 GTGTGCCAGAGGGCGGGGACAGG + Intronic
1190702207 X:52997468-52997490 GTGTGTCAAGGAAGTGGGGCGGG - Intergenic
1190887624 X:54543364-54543386 GTGTGACAGGGAAGGTGGGCAGG + Intronic
1190951086 X:55143466-55143488 TAGTTTCAGGGGAGGGGGAAGGG + Intronic
1191021825 X:55868510-55868532 GAGAGTCAGGGAAGGGAGACAGG - Intergenic
1191086113 X:56569033-56569055 GTGTGGGAGGGGAGGGGCAGGGG + Intergenic
1191879004 X:65825646-65825668 GTGGGTGGGGGGAGGGGGAGAGG + Intergenic
1192233423 X:69281251-69281273 GTGTGTAAGGGGTGGGAGAGAGG + Intergenic
1192301059 X:69903566-69903588 GTGTGTGTGCGGAGGGGGCCTGG - Intronic
1192630064 X:72770289-72770311 TAGTGTCGGGGGAGGGGGAATGG - Intergenic
1192651646 X:72950515-72950537 TAGTGTCGGGGGAGGGGGAATGG + Intergenic
1192707892 X:73546435-73546457 GCCTGTCAGGGGTGGGGGTCAGG + Intergenic
1192935090 X:75850672-75850694 GTGGCACAGGGGAGGGGCACTGG + Intergenic
1193427314 X:81355254-81355276 GAGGCTCAGGGGAGGGGGAGAGG + Intergenic
1194290331 X:92064133-92064155 GTGTGGTGGGGGTGGGGGACTGG + Intronic
1195493907 X:105507470-105507492 GTGTATGATGGGAGGGGGAAGGG - Intronic
1195949911 X:110259163-110259185 GTGTGTCAGGGGAGTTTGAGGGG - Intronic
1196243743 X:113373781-113373803 GCCTGTCAGGGGTGGGGGCCTGG + Intergenic
1196745774 X:119070615-119070637 GTATGTCAAGGGTGGGGGAAGGG + Intergenic
1196797790 X:119516016-119516038 GGGAGTTAGGGGAGGGGGAGAGG + Intergenic
1197096559 X:122603824-122603846 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1197447300 X:126566031-126566053 TGGGGTGAGGGGAGGGGGACGGG + Intergenic
1197575874 X:128210832-128210854 TAGTTTCAGGGGAGGGGGAAGGG - Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1199429958 X:147747612-147747634 GGTTGTCATGGGAGGGGAACTGG - Intergenic
1199828306 X:151522755-151522777 GTGTGTAGGGTGAGGGGGAAGGG - Intergenic
1200032034 X:153304627-153304649 GTGTTTCAGGGTAGTGGGCCTGG - Intergenic
1200049772 X:153422555-153422577 GTGGGGCGGGGCAGGGGGACAGG - Intergenic
1200052133 X:153439500-153439522 GTGTGTCAGGGGAGTGTGTGTGG + Intergenic
1200103062 X:153697816-153697838 GGGTGCCAGGGGCTGGGGACAGG + Intergenic
1200364005 X:155641839-155641861 CAGTTTCAGGGGAGGGGGAAGGG + Intronic
1200392571 X:155958578-155958600 CAGTTTCAGGGGAGGGGGAAGGG + Intergenic
1200607845 Y:5288737-5288759 GTGTGGTGGGGGTGGGGGACTGG + Intronic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201158289 Y:11151558-11151580 GGGTGCCAGAGGAGGGGGCCTGG - Intergenic
1201914541 Y:19168167-19168189 GAGTGTCAGAGGTTGGGGACAGG + Intergenic
1202110297 Y:21410020-21410042 GTTTGTCCAGGGAGGGGAACTGG + Intergenic