ID: 1181692198

View in Genome Browser
Species Human (GRCh38)
Location 22:24569872-24569894
Sequence CACAAGAGCTTCTAGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181692194_1181692198 21 Left 1181692194 22:24569828-24569850 CCACATGAAGAGATGCATAGGGT 0: 1
1: 1
2: 34
3: 144
4: 297
Right 1181692198 22:24569872-24569894 CACAAGAGCTTCTAGCCCCATGG 0: 1
1: 0
2: 2
3: 29
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181692198 Original CRISPR CACAAGAGCTTCTAGCCCCA TGG Intronic
901158190 1:7154719-7154741 CCCAAGAGCTTCCAGCCTCCGGG - Intronic
904916400 1:33973498-33973520 CAGAAAAGCTTCCTGCCCCAGGG + Intronic
907291246 1:53414222-53414244 CAAAAGAGCTCATAGCCTCATGG - Intergenic
907547646 1:55276051-55276073 CACAGGAGTTTTTAGCCACAGGG + Intergenic
907887743 1:58609062-58609084 CTCTAGAACTTCTAGTCCCATGG + Intergenic
910140045 1:84017053-84017075 CGCAAGAGCACTTAGCCCCAAGG + Intergenic
910667570 1:89741549-89741571 TACAGGAGCTTCTGTCCCCATGG + Intronic
911628889 1:100159992-100160014 TACAAGAGCTTCTAACCCTTGGG - Intronic
913366504 1:118045470-118045492 CACAAGAGCTTCTGTCCCCATGG - Intronic
913524369 1:119676880-119676902 CACAAGTGCTTTTTGGCCCATGG - Intronic
915100436 1:153495318-153495340 CACAGGAGCTCCTAGTCTCACGG - Intergenic
916444266 1:164857352-164857374 CACAGGAGCCTCTAACCCCATGG + Intronic
918145789 1:181754407-181754429 CACAGGACAATCTAGCCCCACGG - Intronic
918686870 1:187428213-187428235 CACAGGAGCTTCTGTCCCTATGG + Intergenic
919207568 1:194437218-194437240 CACAAGAGAGTTTAGCCCTAGGG + Intergenic
919435310 1:197551679-197551701 TATAAAAGCTACTAGCCCCACGG + Intronic
920808144 1:209254465-209254487 GACAGGAGCTTCTGTCCCCATGG - Intergenic
922601383 1:226857385-226857407 CACAGGAGCTTCTGTCTCCATGG - Intergenic
923500042 1:234557022-234557044 CACATGAGCCTCTGTCCCCATGG + Intergenic
924408977 1:243783347-243783369 CAGAAGTTCTTCAAGCCCCATGG - Intronic
1063006021 10:1971319-1971341 CACATGGGATTCTAGCTCCATGG + Intergenic
1066842175 10:39938318-39938340 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066842380 10:39942389-39942411 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066842755 10:39949858-39949880 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066842821 10:39951217-39951239 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843030 10:39955286-39955308 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843094 10:39956644-39956666 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843166 10:39958004-39958026 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843446 10:39963435-39963457 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843579 10:39966150-39966172 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843645 10:39967505-39967527 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066843884 10:39972255-39972277 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066844097 10:39976330-39976352 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066845033 10:39994676-39994698 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846049 10:40014691-40014713 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846118 10:40016049-40016071 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846413 10:40021821-40021843 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846482 10:40023179-40023201 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846538 10:40024198-40024220 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846606 10:40025556-40025578 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846745 10:40028273-40028295 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066846951 10:40032347-40032369 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066847502 10:40043211-40043233 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066847575 10:40044567-40044589 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066847777 10:40048642-40048664 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066847982 10:40052716-40052738 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066848049 10:40054074-40054096 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066848114 10:40055432-40055454 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066848180 10:40056790-40056812 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066848248 10:40058148-40058170 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066848591 10:40064939-40064961 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066849343 10:40079879-40079901 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066849773 10:40088363-40088385 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066849840 10:40089721-40089743 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066849907 10:40091079-40091101 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066849975 10:40092436-40092458 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066850045 10:40093794-40093816 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066850182 10:40096513-40096535 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066850522 10:40103304-40103326 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066850707 10:40107040-40107062 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066850881 10:40110436-40110458 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066851054 10:40113827-40113849 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066851121 10:40115186-40115208 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066851187 10:40116544-40116566 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066851320 10:40119259-40119281 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066851526 10:40123333-40123355 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066851696 10:40126727-40126749 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066852004 10:40132841-40132863 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066852380 10:40140310-40140332 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066852499 10:40142689-40142711 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066852564 10:40144047-40144069 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066852945 10:40151517-40151539 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066853083 10:40154233-40154255 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066853814 10:40168840-40168862 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854144 10:40175299-40175321 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854211 10:40176657-40176679 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854279 10:40178014-40178036 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854345 10:40179372-40179394 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854500 10:40182428-40182450 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854570 10:40183786-40183808 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066854857 10:40189218-40189240 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066855077 10:40193636-40193658 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066855201 10:40196012-40196034 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066855270 10:40197370-40197392 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066855339 10:40198727-40198749 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066855410 10:40200085-40200107 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066856042 10:40212655-40212677 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066856110 10:40214013-40214035 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066856178 10:40215371-40215393 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066856688 10:40225562-40225584 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066856758 10:40226920-40226942 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066856875 10:40229297-40229319 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857064 10:40233031-40233053 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857117 10:40234050-40234072 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857185 10:40235408-40235430 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857353 10:40238804-40238826 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857522 10:40242199-40242221 CACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857660 10:40244917-40244939 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066857894 10:40249669-40249691 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066858031 10:40252386-40252408 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066858312 10:40257822-40257844 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066858379 10:40259183-40259205 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066858398 10:40259521-40259543 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066858468 10:40260878-40260900 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066858536 10:40262236-40262258 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066859099 10:40273443-40273465 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066859165 10:40274801-40274823 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066859233 10:40276159-40276181 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066859526 10:40281928-40281950 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860024 10:40291775-40291797 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860092 10:40293133-40293155 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860228 10:40295849-40295871 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860298 10:40297207-40297229 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860365 10:40298563-40298585 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860432 10:40299921-40299943 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860452 10:40300259-40300281 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860794 10:40307051-40307073 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860865 10:40308410-40308432 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066860932 10:40309767-40309789 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066861001 10:40311125-40311147 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066861133 10:40313841-40313863 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066861321 10:40317577-40317599 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066861459 10:40320291-40320313 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066862858 10:40348130-40348152 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066862924 10:40349488-40349510 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066862993 10:40350846-40350868 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066863115 10:40353222-40353244 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066863183 10:40354580-40354602 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066863388 10:40358654-40358676 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066864675 10:40384448-40384470 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066865499 10:40401100-40401122 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066865567 10:40402458-40402480 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066865636 10:40403816-40403838 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066865967 10:40410603-40410625 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066866430 10:40419772-40419794 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066866638 10:40423847-40423869 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066866986 10:40430639-40430661 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066867123 10:40433355-40433377 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066867631 10:40443199-40443221 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066867715 10:40444895-40444917 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066867965 10:40449988-40450010 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066868034 10:40451346-40451368 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066868905 10:40468666-40468688 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066868957 10:40469688-40469710 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066869170 10:40473762-40473784 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066869726 10:40484972-40484994 CTCAAGCGCTTCTAGGCCTATGG + Intergenic
1066869847 10:40487349-40487371 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066870073 10:40491759-40491781 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066870201 10:40494227-40494249 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066870532 10:40500675-40500697 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066871667 10:40523089-40523111 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066871685 10:40523427-40523449 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066871868 10:40527160-40527182 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066872004 10:40529876-40529898 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066872332 10:40536325-40536347 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066872976 10:40549225-40549247 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066873132 10:40552277-40552299 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066873269 10:40554994-40555016 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066873446 10:40558730-40558752 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066873702 10:40563823-40563845 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066873928 10:40568235-40568257 TACAAGGGCTTCTAGGCCTATGG + Intergenic
1066873999 10:40569594-40569616 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066874131 10:40572312-40572334 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066874389 10:40577404-40577426 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066874801 10:40585195-40585217 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066876605 10:40621179-40621201 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066876757 10:40624235-40624257 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066876823 10:40625593-40625615 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066877343 10:40636118-40636140 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066877410 10:40637477-40637499 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066877627 10:40641890-40641912 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066878230 10:40653781-40653803 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066879176 10:40672796-40672818 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066880276 10:40694511-40694533 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066880412 10:40697227-40697249 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066880478 10:40698585-40698607 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066880737 10:40703677-40703699 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066881217 10:40713186-40713208 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066881920 10:40725775-40725797 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066882415 10:40735624-40735646 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066882552 10:40738340-40738362 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066882832 10:40743772-40743794 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066884274 10:40772629-40772651 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066884480 10:40776706-40776728 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066884547 10:40778064-40778086 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066884603 10:40779084-40779106 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066884671 10:40780443-40780465 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066885808 10:40802863-40802885 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066887218 10:40830702-40830724 CTCAAGCGCTTCTAGGCCTATGG + Intergenic
1066889057 10:40867354-40867376 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066889183 10:40869731-40869753 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066890142 10:40888405-40888427 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066891233 10:40909794-40909816 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066891521 10:40915567-40915589 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066891674 10:40918621-40918643 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066891724 10:40919640-40919662 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066892045 10:40926094-40926116 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066892096 10:40927113-40927135 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066892768 10:40940168-40940190 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066893001 10:40944917-40944939 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066894726 10:40979221-40979243 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066895694 10:40998589-40998611 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066895969 10:41004018-41004040 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066896272 10:41009786-41009808 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066896414 10:41012500-41012522 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066897039 10:41024731-41024753 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066897360 10:41031180-41031202 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066897716 10:41038313-41038335 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066898548 10:41054610-41054632 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066899191 10:41067172-41067194 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066899601 10:41075664-41075686 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066901070 10:41104523-41104545 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066902075 10:41124220-41124242 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066902229 10:41127279-41127301 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066902452 10:41131695-41131717 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066902504 10:41132716-41132738 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066902899 10:41140529-41140551 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066903108 10:41144605-41144627 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066903212 10:41146642-41146664 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066903268 10:41147663-41147685 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066903322 10:41148683-41148705 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066903711 10:41156158-41156180 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066903935 10:41160572-41160594 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066905100 10:41183325-41183347 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066905737 10:41195887-41195909 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066905843 10:41197926-41197948 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066906230 10:41205401-41205423 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066906556 10:41211850-41211872 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066907131 10:41223399-41223421 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066908828 10:41256697-41256719 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066908879 10:41257716-41257738 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066909716 10:41274021-41274043 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066909813 10:41276057-41276079 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066910043 10:41280475-41280497 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066910705 10:41293384-41293406 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066910761 10:41294404-41294426 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066911164 10:41302210-41302232 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066911381 10:41306286-41306308 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066912024 10:41318853-41318875 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066912080 10:41319871-41319893 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066912486 10:41328021-41328043 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066912541 10:41329042-41329064 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066913109 10:41340255-41340277 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066913376 10:41345350-41345372 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066913478 10:41347388-41347410 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066913681 10:41351464-41351486 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066914024 10:41358256-41358278 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066914337 10:41364374-41364396 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066914515 10:41367767-41367789 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066914674 10:41370823-41370845 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066914726 10:41371843-41371865 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066915136 10:41379992-41380014 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066915188 10:41381012-41381034 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066915393 10:41385091-41385113 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066915754 10:41392224-41392246 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066915860 10:41394265-41394287 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066916121 10:41399364-41399386 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066916539 10:41407517-41407539 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066916728 10:41411251-41411273 TACAAGTGCTTCTAGGCCTATGG + Intergenic
1066917910 10:41434694-41434716 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066918692 10:41450324-41450346 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066919084 10:41457800-41457822 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066919137 10:41458819-41458841 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066919501 10:41465954-41465976 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066920073 10:41477172-41477194 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066920276 10:41481247-41481269 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1066920963 10:41494831-41494853 TACAAGCGCTTCTAGGCCTATGG + Intergenic
1069609575 10:69763859-69763881 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1069660296 10:70119129-70119151 CACAGGGGCTTCTGTCCCCATGG - Intronic
1070313732 10:75292491-75292513 CCCCAGAGCTTCTAGCAGCATGG - Intergenic
1071567642 10:86680021-86680043 GGCAGGAGCTTCTGGCCCCAGGG + Intronic
1072509192 10:96101361-96101383 CACTAGAGCTTCTACCTCCCAGG + Intergenic
1073232474 10:101983709-101983731 CCCAGGAGCTTCTGACCCCATGG - Intronic
1073933391 10:108601362-108601384 CACAAAAGCTTCTGTCCCCCTGG + Intergenic
1075875762 10:125804348-125804370 CACAGGAGCTTCTTCCCCCATGG - Intronic
1077126491 11:941010-941032 CACAAAAGCTCCGAGCTCCACGG - Intronic
1077128370 11:955578-955600 CACAACAGCTTCTGCCCTCAGGG - Intronic
1083084260 11:60126183-60126205 CACAGGAGCTTCTGTCCTCATGG + Intergenic
1083953418 11:65969387-65969409 CATAAGGGTTTCTAGCCCCGTGG + Intronic
1084695416 11:70750814-70750836 CAAATGAGCTTCTAACCCCTTGG - Intronic
1086944575 11:92832258-92832280 CACTAGAGCCTCTAGCTCCTGGG - Intronic
1087994896 11:104793297-104793319 CACAGGAGCTTCTGTGCCCAAGG - Intergenic
1089450037 11:118587993-118588015 CACAGGAGCTTCTGTCCCCAGGG + Intronic
1089852371 11:121510812-121510834 CACAAGAGCTGTTAGCCACTGGG + Intronic
1090835007 11:130448082-130448104 CCCAAGACCGCCTAGCCCCAAGG - Intergenic
1091099160 11:132854250-132854272 TGCCAGAGCTTCTGGCCCCATGG + Intronic
1092705427 12:11278979-11279001 CACCTTGGCTTCTAGCCCCAGGG + Intergenic
1092714206 12:11371564-11371586 CACCTTGGCTTCTAGCCCCAGGG + Intronic
1092717911 12:11410588-11410610 CACCCTGGCTTCTAGCCCCAGGG + Intronic
1094500956 12:31020472-31020494 CACGAGTGCTTCTAGCTGCATGG + Intergenic
1095519184 12:43041582-43041604 TGCAAGAGCTTCTGTCCCCATGG + Intergenic
1099859374 12:88208544-88208566 AACAGGAGCTGCCAGCCCCAGGG + Intergenic
1101576880 12:106005988-106006010 CACCACAGCTTCTAACTCCAGGG + Intergenic
1101839147 12:108315473-108315495 CACAGGAGCTTCTAGGCCAGAGG - Intronic
1106194304 13:27480253-27480275 CCCAAGAGCATATAGACCCAAGG + Intergenic
1110021490 13:70478892-70478914 CAGCACAGCTTCTAGCCCAAGGG - Intergenic
1110516659 13:76420767-76420789 ACCAAGAGCTTGTATCCCCATGG + Intergenic
1113404633 13:110026847-110026869 CAGAAGAGCTTATAGCTCCAGGG + Intergenic
1114540955 14:23457883-23457905 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1115196432 14:30805338-30805360 CACCAGATCTTCTAGGCCAAGGG + Intergenic
1117954737 14:61113736-61113758 CTCAAGTGCTTCAATCCCCAAGG - Intergenic
1120596151 14:86439969-86439991 CACAAGCCCTTCTAAGCCCAAGG + Intergenic
1125709018 15:41768680-41768702 CACAAGAGCTTCCAGTGCCTGGG + Exonic
1126136526 15:45397530-45397552 TACAGGAGCTTCTGTCCCCATGG - Intronic
1126323256 15:47447547-47447569 CACAAGAGCTTCTGCCCCTGTGG - Intronic
1128461186 15:67868943-67868965 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1128773283 15:70300020-70300042 CTCAAGAGTTTCCAGCCCGATGG - Intergenic
1129253263 15:74320136-74320158 CACAGGAGTTTCTAGAACCAGGG - Intronic
1131221561 15:90588858-90588880 CATAAGAGCTGCTTGTCCCAGGG - Intronic
1133136240 16:3714146-3714168 AACAAGAGCTGCTTGCCCCAGGG - Intronic
1133716906 16:8458672-8458694 CTCAAGAGCTACTTGCCCTAGGG - Intergenic
1133977557 16:10610598-10610620 CACTACAGCTTCAACCCCCAGGG + Intergenic
1134779496 16:16882899-16882921 CACAAGACCTCCAGGCCCCAGGG - Intergenic
1138847285 16:60581748-60581770 CACAAGAGCATATGGCTCCAAGG - Intergenic
1140687608 16:77448680-77448702 CACAAGAACTTCTTGCACCCAGG - Intergenic
1141078780 16:81032891-81032913 CACAGGTGCTTCTAGCTCTAAGG + Exonic
1142764913 17:2059364-2059386 CACAAGTGGCACTAGCCCCAGGG + Exonic
1144256189 17:13470818-13470840 CCCAGGGGCTTCTAGCGCCAAGG + Intergenic
1146684593 17:34832739-34832761 CCCAAGGGCTCCTAGGCCCATGG + Intergenic
1149796494 17:59525265-59525287 CACATGATGTTCTAGCCTCAAGG - Intergenic
1153467403 18:5404192-5404214 CAAAGGAGCTTCAAGTCCCAGGG - Intronic
1155132464 18:22951899-22951921 CACAGGAGCTTCTGTCACCATGG + Intronic
1155442372 18:25875731-25875753 CACAAGAGCTGCTTGCTCAAAGG + Intergenic
1156273013 18:35554717-35554739 CACAGCAGCTTCTGTCCCCATGG + Intergenic
1156875551 18:42006246-42006268 CACAGGAGCTTCTGTCCCCATGG + Intronic
1162256901 19:9498152-9498174 CCCAAGATCCTGTAGCCCCACGG - Exonic
925743315 2:7024689-7024711 CACAAAGGCTTCTGTCCCCATGG - Intronic
925939705 2:8805148-8805170 CACAGGAGCTTCTGTCCCCATGG + Intronic
926022909 2:9512916-9512938 TACAGGAGCTTCTGTCCCCATGG - Intronic
927555280 2:24026666-24026688 CACAAGAGTTTCTGTCCCCGTGG - Intronic
928943092 2:36747436-36747458 AACAAGTACTTCTAGTCCCATGG - Intronic
930009234 2:46923064-46923086 CACAGGTGCTTCTGTCCCCATGG + Intronic
939585871 2:144004888-144004910 CACAAGAGTTTTTTGCCCGAAGG + Intronic
941299885 2:163787985-163788007 CACAGGAGCTTCTGTGCCCAAGG + Intergenic
941330001 2:164168433-164168455 CTCAAGAGCTTCTACCCAAATGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
943957017 2:194205547-194205569 AACAAGTGCTTCTAGACCTATGG - Intergenic
946021814 2:216645364-216645386 AGCAAGACCTTTTAGCCCCAGGG - Intronic
946312838 2:218892468-218892490 AGCAAGAGCCTCCAGCCCCAAGG + Intronic
946728038 2:222681470-222681492 CACAGGAGTTTCTGTCCCCATGG + Intronic
948178670 2:235962990-235963012 CACGAGCACTTCTAGCCCCATGG - Intronic
1169881408 20:10351164-10351186 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1170125311 20:12956728-12956750 CACAGGAGCTCCTGTCCCCATGG + Intergenic
1170508993 20:17057817-17057839 CACAAAAGCTTCTTGCCCATAGG + Intergenic
1173011249 20:39184685-39184707 TACAGGAGCTTCTGTCCCCATGG + Intergenic
1178676297 21:34634439-34634461 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1179448337 21:41449730-41449752 CACAGAAGCTTCTGTCCCCACGG + Intronic
1181692198 22:24569872-24569894 CACAAGAGCTTCTAGCCCCATGG + Intronic
1182639263 22:31753776-31753798 CACTAGAGCCTCCCGCCCCACGG - Intergenic
1182746785 22:32612071-32612093 GACAGGAGCTTCTATCACCATGG - Intronic
1183866165 22:40705929-40705951 CACAAGAGCTTCCATCCCCTTGG + Intergenic
1184070675 22:42144444-42144466 CACCAGTGCTTCTAGCCCCATGG + Intergenic
1184072557 22:42154981-42155003 CACCAGTGCATCCAGCCCCATGG + Intergenic
1184611532 22:45606993-45607015 CACAGGAGCTTCTGTCCCCGTGG - Intergenic
1184689185 22:46109786-46109808 CGCAGGAGCTTCTGTCCCCAGGG - Intronic
1184843828 22:47068601-47068623 CACTAGAGTTTCTGGCCCCAGGG - Intronic
951487647 3:23231889-23231911 CACAGGAGCTTCTCTACCCATGG + Intronic
953181072 3:40595844-40595866 CACAACAGTTTCTTTCCCCAGGG - Intergenic
953780830 3:45869073-45869095 CACAAGACCTGCTAGCCTGAGGG - Intronic
954131684 3:48564310-48564332 CACACAAGCCTCTAGCACCAAGG + Exonic
959295605 3:104530942-104530964 CATAAGAGATTTTAGCCCTAGGG + Intergenic
960632954 3:119751806-119751828 TACAAGAGATTCCAGCCCCTGGG - Intronic
961005814 3:123404667-123404689 GACAAGAGCTCCCAGCCGCAGGG + Intronic
961492996 3:127268263-127268285 CACAGGAGCTTCTGTCCCCTTGG + Intergenic
963038397 3:141051475-141051497 CACAAAAGCACCCAGCCCCAGGG + Exonic
963192140 3:142484466-142484488 CACAGGAGCTTCTGTCTCCATGG - Intronic
964986248 3:162743340-162743362 CACAAGAGCTACTAGGCTCTGGG + Intergenic
966823841 3:183946874-183946896 CATAAAACCTTCTAGCCCCTAGG - Intronic
967277052 3:187786470-187786492 CAAAAGAGCTTCCATTCCCATGG - Intergenic
968956780 4:3723533-3723555 CAAAAGCGCTTCTGGGCCCAGGG + Intergenic
969517150 4:7654233-7654255 CACCAGAGCTGCGGGCCCCATGG - Intronic
969612075 4:8232942-8232964 CCCCAGAGCTTCTGGCTCCACGG - Intronic
970180166 4:13383811-13383833 CACAGGAGATTTTAGCCCTAGGG + Intronic
974723800 4:65773944-65773966 CACAGGAGATGCTAGCCCTAGGG - Intergenic
976677495 4:87719489-87719511 CACAGGAGCTTCTGTCCCCATGG + Intergenic
977175863 4:93818570-93818592 CTCAAGTGCTTCTAGCATCATGG - Intergenic
977781641 4:100987481-100987503 GACAGGAGCTTCTGTCCCCATGG + Intergenic
978923657 4:114217083-114217105 CACAAGAGCTTGGGGCCCCAAGG - Intergenic
982788656 4:159565093-159565115 AACAGGTGCTTCTAGCTCCAAGG - Intergenic
986345870 5:6834631-6834653 CACAAGTGCTTCTATCCTCATGG + Intergenic
986774536 5:11001975-11001997 CTCCAGTGCTTCTTGCCCCATGG + Intronic
987139341 5:14929507-14929529 CACAGGAGCTTCTGTCCCCGTGG - Intergenic
989412299 5:41134081-41134103 GACAACAGCTTCTAGTCTCATGG + Intergenic
990925254 5:61014351-61014373 CACAAGAACTTCTGTCCCCATGG - Intronic
997935083 5:138103429-138103451 CATAAGATCTTTTAGCCCCTTGG + Intergenic
1000560432 5:162780648-162780670 AACAACAGCTTCTAGCATCATGG - Intergenic
1001755269 5:174163791-174163813 TACAGGAGCTTCTGTCCCCATGG + Intronic
1002676220 5:180915238-180915260 ACCAAGAGGTTCTAGCCACAGGG - Intronic
1003283946 6:4717919-4717941 CACAAGAGCCTCAACCCCCTGGG + Intronic
1003446749 6:6191838-6191860 TACAAGAGCTTCTACCTTCATGG + Intronic
1003828098 6:9974833-9974855 CACAGGAGCTTCTGTCTCCATGG + Intronic
1003946428 6:11080299-11080321 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1004513066 6:16298170-16298192 CTCAAGACCTTCCAGCCTCAAGG - Intergenic
1006041705 6:31261463-31261485 CACAGGAGCCTCTGTCCCCATGG - Intergenic
1006051366 6:31347370-31347392 CACAAGAGCCTCTGTCCCCACGG - Intronic
1008182419 6:48347967-48347989 CACAAAAGCTACTAGCTACATGG - Intergenic
1010547170 6:77172931-77172953 CATAAGAGACTTTAGCCCCAGGG - Intergenic
1012098190 6:94993283-94993305 AATAAGTGCTTCTAGGCCCACGG + Intergenic
1012831119 6:104204529-104204551 CACAGGAGCTTCTCTTCCCATGG + Intergenic
1013709016 6:112875326-112875348 CACAGTAGCTTCTGTCCCCATGG - Intergenic
1013844122 6:114428517-114428539 CCCAAGAGCCTCTAGGCACATGG + Intergenic
1023658938 7:42453904-42453926 CAGACGAGCTTCTAAACCCAAGG + Intergenic
1024103356 7:46056585-46056607 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1027473064 7:78596409-78596431 CCCAAGAGCTTCTATCCTGAAGG + Intronic
1027489548 7:78805765-78805787 CACAAGAGTTTCTTACCTCATGG - Intronic
1027852617 7:83467712-83467734 AACTAGAGCTTCTAGGCCGAAGG - Intronic
1028008839 7:85614683-85614705 CATATGAGATTTTAGCCCCAGGG + Intergenic
1033226566 7:139567681-139567703 CACAAGACATTCCAGCCCCAGGG - Exonic
1035788199 8:2279119-2279141 CACAGGAGCATCTGGCCCCATGG - Intergenic
1035804608 8:2442586-2442608 CACAGGAGCATCTGGCCCCATGG + Intergenic
1036790356 8:11713784-11713806 CACAAGTGCTTCCAGCGCCCAGG - Intronic
1038167556 8:25100506-25100528 CACAGAAGCTTCTGTCCCCATGG + Intergenic
1038589677 8:28825149-28825171 CCCAGGAGGTTCAAGCCCCAGGG - Intronic
1038850198 8:31268309-31268331 CACAGGAGCTTCTGTCCCCGTGG + Intergenic
1043839403 8:85084687-85084709 CATCAGAGCTTCTGTCCCCATGG + Intergenic
1046754034 8:117955158-117955180 CACAGAGGCTTCTATCCCCATGG + Intronic
1048345208 8:133570771-133570793 CACCAGAGCGCCTCGCCCCAGGG + Intronic
1049345397 8:142136012-142136034 CACAAGGGCCTCCTGCCCCAGGG + Intergenic
1049451111 8:142662050-142662072 CACAAGGGATTCCAGCCACAAGG + Intronic
1049802702 8:144525558-144525580 CAGAGGAGCTACGAGCCCCAGGG + Intronic
1056220932 9:84450182-84450204 CACAAGAGCCTCTGTCCCCATGG - Intergenic
1057098864 9:92338813-92338835 TACAAGATCATCCAGCCCCAAGG - Intronic
1057122877 9:92593033-92593055 AACCAGAGCTGCTGGCCCCAGGG + Intronic
1058672195 9:107369015-107369037 CACGGGAGCTTCTGTCCCCATGG - Intergenic
1186363799 X:8870991-8871013 TACCAGAGATCCTAGCCCCAGGG - Intergenic
1186499566 X:10040548-10040570 CACAGGAGCTTCTGTCCCTATGG + Intronic
1189636664 X:43017986-43018008 CACAGGAGCTTCTTTCCCCACGG + Intergenic
1191155316 X:57266899-57266921 CACAAGAGGCTTTAGCCCTAGGG + Intergenic
1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG + Intergenic
1191797957 X:65042891-65042913 CAGAAGACCCTATAGCCCCAGGG - Intergenic
1193483693 X:82059849-82059871 CATAGGAGATTTTAGCCCCAGGG + Intergenic
1193606990 X:83581141-83581163 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1196594065 X:117522631-117522653 AATAAGAGCATCTAGCCACATGG - Intergenic
1197611921 X:128649087-128649109 CAGAAAAGCTTCTAACCTCAAGG + Intergenic