ID: 1181694026

View in Genome Browser
Species Human (GRCh38)
Location 22:24584122-24584144
Sequence TGAACACCCTGTTCCAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 108}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181694024_1181694026 -6 Left 1181694024 22:24584105-24584127 CCTCACTCTGGGGAGCCTGAACA 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694012_1181694026 20 Left 1181694012 22:24584079-24584101 CCCCTCCCACCATCTACCCCATT 0: 1
1: 0
2: 3
3: 53
4: 550
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694020_1181694026 4 Left 1181694020 22:24584095-24584117 CCCCATTTTGCCTCACTCTGGGG 0: 1
1: 0
2: 4
3: 16
4: 179
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694016_1181694026 14 Left 1181694016 22:24584085-24584107 CCACCATCTACCCCATTTTGCCT 0: 1
1: 0
2: 1
3: 26
4: 250
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694015_1181694026 15 Left 1181694015 22:24584084-24584106 CCCACCATCTACCCCATTTTGCC 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694017_1181694026 11 Left 1181694017 22:24584088-24584110 CCATCTACCCCATTTTGCCTCAC 0: 1
1: 0
2: 0
3: 24
4: 241
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694022_1181694026 3 Left 1181694022 22:24584096-24584118 CCCATTTTGCCTCACTCTGGGGA 0: 1
1: 0
2: 3
3: 23
4: 173
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694013_1181694026 19 Left 1181694013 22:24584080-24584102 CCCTCCCACCATCTACCCCATTT 0: 1
1: 1
2: 3
3: 40
4: 458
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694023_1181694026 2 Left 1181694023 22:24584097-24584119 CCATTTTGCCTCACTCTGGGGAG 0: 1
1: 0
2: 0
3: 24
4: 189
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108
1181694014_1181694026 18 Left 1181694014 22:24584081-24584103 CCTCCCACCATCTACCCCATTTT 0: 1
1: 0
2: 1
3: 31
4: 382
Right 1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181694026 Original CRISPR TGAACACCCTGTTCCAGAGT AGG Intronic
901450478 1:9333673-9333695 TGAACAGCCTCATCCAGTGTAGG + Intronic
906191551 1:43902452-43902474 AGAACAGCCTGTGCCAGAGCTGG + Intronic
914802818 1:150973519-150973541 TGCACAGTCTGTTCCAGAGAGGG - Intronic
917484221 1:175440675-175440697 TGAAGACCATGTTTCAGTGTCGG + Intronic
922852470 1:228745278-228745300 TGAACACTCAGTTGCAGGGTCGG + Exonic
923070325 1:230558499-230558521 TACACACCCTGTTTCAGGGTGGG + Intergenic
1063966359 10:11349355-11349377 TAAAGACCATGTTCCAGAGTTGG + Intergenic
1065096421 10:22285220-22285242 TGGACACCATGTTGCAAAGTTGG + Intergenic
1065735705 10:28750183-28750205 TGAACAACCTGCTCCTGAATTGG - Intergenic
1066789619 10:39048235-39048257 TTAACACCATGTTCCTGATTTGG - Intergenic
1070500574 10:77069233-77069255 TGAACAGCATGTTCCAGGGCTGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1077994257 11:7439703-7439725 TGAATAACATGTTCCAGGGTGGG - Intronic
1080877693 11:36291516-36291538 TGAACACCATTTTACAGAGGTGG - Intergenic
1082269593 11:50155593-50155615 TGAATACTCTTTTCCAGAGGAGG - Intergenic
1085775313 11:79360392-79360414 TCAACACGCTGATCCTGAGTGGG - Intronic
1088302743 11:108376357-108376379 TGAACAACCTGCTCCTGAATGGG + Intronic
1088370259 11:109081340-109081362 TGAACAACCTGCTCCTGAATGGG - Intergenic
1098033922 12:66282950-66282972 TGGTCACCCTTTTGCAGAGTAGG + Intergenic
1099310656 12:81017696-81017718 AGAACACCATGTTCCTGAATTGG + Intronic
1105658466 13:22466419-22466441 TGAAAAACCAGTTCCAGAGAAGG + Intergenic
1109807498 13:67462964-67462986 TGAACACTCTATTTTAGAGTTGG + Intergenic
1110053158 13:70930362-70930384 TAAAAACTCTGCTCCAGAGTTGG - Intergenic
1110251568 13:73386303-73386325 TGAACAAAATGTTACAGAGTGGG + Intergenic
1113443622 13:110348541-110348563 TGAGAACCTTGTTCCCGAGTTGG + Intronic
1116264233 14:42665924-42665946 TGAACACCATGTTCCTGAAATGG - Intergenic
1117953125 14:61102571-61102593 CTACCACCCTGTCCCAGAGTGGG - Intergenic
1119363878 14:74074598-74074620 TGCACACACTGTACCACAGTAGG - Intronic
1121305348 14:92903140-92903162 TGAACAGCCTGTGCCTGAGCTGG - Intergenic
1122071053 14:99205574-99205596 TGAGCTCCCTTTTCCAGAGGAGG + Intronic
1125606738 15:40943732-40943754 TTAACACTCTGGTCAAGAGTGGG + Intergenic
1126697166 15:51336097-51336119 TGAAGAGCCTGTCCTAGAGTTGG - Intronic
1133337744 16:5017159-5017181 GGAACTGCCTGTTCCAGAGGCGG + Exonic
1134643575 16:15848858-15848880 TGAACACACTGGACCAGAGACGG + Intronic
1138129806 16:54470033-54470055 TTTACACCCTCATCCAGAGTGGG + Intergenic
1138461977 16:57154536-57154558 TCATCACCCTTTTCCAAAGTTGG + Intronic
1138773473 16:59692339-59692361 TGCACACCCAGTTCCAAAGCAGG + Intergenic
1139431668 16:66914061-66914083 TGAACACCCCAGTCCACAGTGGG + Intronic
1141662329 16:85448131-85448153 TGCACATCCTTTTCCAGAGAAGG - Intergenic
1142224241 16:88869896-88869918 AATACACCCTGTTCCAGAGCCGG + Intergenic
1143251665 17:5527529-5527551 TGAAGACCCTCTTCCAGAGTTGG - Intronic
1148943961 17:51241912-51241934 TGATCATACTGTCCCAGAGTAGG + Intronic
1149166577 17:53759430-53759452 TGAACAACCTGCTCCTGAATGGG - Intergenic
1149497453 17:57128458-57128480 TTAACACGAAGTTCCAGAGTAGG - Intergenic
1151654951 17:75491489-75491511 TAAACAGCCTGGCCCAGAGTCGG - Intronic
1155658066 18:28214344-28214366 TGATTTCTCTGTTCCAGAGTGGG + Intergenic
1155958269 18:31972418-31972440 TGAACACGCAGTTCCAGATGAGG + Intergenic
1157947087 18:51992499-51992521 TCACCACCCTGTACCAGGGTTGG - Intergenic
1159526695 18:69601516-69601538 TGAACACCCTGGTCCTCTGTTGG - Intronic
1163242846 19:16075123-16075145 TGATCACCCTAATCCAGAGTTGG + Intronic
1202645052 1_KI270706v1_random:131714-131736 TGTACACCCTGTTCCATATTGGG - Intergenic
925513921 2:4658498-4658520 AGAACACCCTGTTCAAGAAATGG - Intergenic
927034644 2:19161873-19161895 TGAACAACCTGCTCCTGAATGGG - Intergenic
927629086 2:24755467-24755489 TGAATACTCTGGCCCAGAGTGGG - Intronic
931251820 2:60538107-60538129 TGCACACCCTTTTCCAGATAGGG - Intronic
938066419 2:128284178-128284200 TGAGCACCTAGTTGCAGAGTTGG - Intronic
940865686 2:158815756-158815778 GGAACAACCTTTTCCAGAGCAGG - Exonic
941156313 2:161982309-161982331 TTCACACCATGTTCCAGAGAGGG - Intronic
941343455 2:164337216-164337238 TGTACATCTTGTTACAGAGTTGG - Intergenic
941772508 2:169360702-169360724 TGAACACCCTTTCTCAGTGTTGG - Intronic
942654881 2:178204906-178204928 TTAAGACCCTGGTGCAGAGTAGG - Intronic
943312479 2:186344030-186344052 TAAATACCCTATTCCACAGTTGG + Intergenic
943640236 2:190349789-190349811 TAAACTCCCTTTTCCATAGTTGG - Intronic
945903683 2:215567133-215567155 TAAATACCCTGTTCTAGAGCAGG - Intergenic
947084617 2:226437049-226437071 TGAGCATCTTTTTCCAGAGTAGG - Intergenic
947474422 2:230430391-230430413 TGAAGACTGTGTTCCACAGTTGG + Intronic
1170344268 20:15366121-15366143 TGAATACTCTGTTCCAGAGATGG - Intronic
1171895012 20:30750635-30750657 TGTGCACCCTGTTCCATATTGGG - Intergenic
1173885176 20:46451172-46451194 CCAGCACCCTGTTCCAGAGAAGG - Intergenic
1176606843 21:8841029-8841051 TCTACACCCTGTTCCATATTGGG + Intergenic
1180356910 22:11850730-11850752 TGTACACCCTGTTCCATATTGGG + Intergenic
1180381352 22:12141601-12141623 TGTACACCCTGTTCCATATTGGG - Intergenic
1180867795 22:19129398-19129420 TGAACATCCTGTTTCAGTGCTGG - Intergenic
1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG + Intronic
952023079 3:29046342-29046364 TCAACACCATGTTCTAGAGCAGG + Intergenic
953957073 3:47239968-47239990 TGAACCACCTGTCCCAGAGTTGG + Intronic
953970146 3:47340978-47341000 TGAACAGCATGTTCCAAAGTGGG + Intronic
954087434 3:48256418-48256440 TGAACGCCCTGTTCCAGGGGAGG + Intronic
955687091 3:61559802-61559824 TGAACACCCTCCCCCAGGGTGGG - Intergenic
956647243 3:71468379-71468401 TGACTGTCCTGTTCCAGAGTCGG + Intronic
956701197 3:71960341-71960363 TTAACACCCTGTTCAAGGCTTGG - Intergenic
958920980 3:100105086-100105108 TGAACACCCTTTCCAAGACTAGG - Intronic
959948303 3:112150142-112150164 TGAACACCCTGTTCTGGAGCAGG - Intronic
963391958 3:144675863-144675885 TGAAGCCCCTGTTCCAGGTTAGG + Intergenic
964600566 3:158496537-158496559 TTACCACCCTTTCCCAGAGTTGG + Intronic
973371270 4:49250128-49250150 TCTACACCCTGTTCCATATTGGG - Intergenic
973389736 4:49545183-49545205 TGTATACCCTGTTCCATATTGGG + Intergenic
974181682 4:58391811-58391833 TCAACACCCTGTTACAGCTTTGG + Intergenic
976111137 4:81674972-81674994 TTCACACCATGTTCTAGAGTGGG - Intronic
984833848 4:184000642-184000664 TGAACCCAGTGTTCAAGAGTAGG - Intronic
985293492 4:188410000-188410022 TGAGCACACAATTCCAGAGTCGG - Intergenic
995759949 5:115552294-115552316 GGAACACCCTGTGCCTGTGTAGG - Intergenic
997119623 5:131160837-131160859 TCAACACTCTGTTACAGAATAGG + Intronic
999499953 5:152136971-152136993 TCAAGACCCTGCTCCAGAGGTGG + Intergenic
1001206795 5:169771021-169771043 TGAACACTCTTTTCCAAAGGTGG + Intronic
1007686787 6:43671833-43671855 TGCGCACCCTGTTCCAGCGGGGG + Exonic
1008065928 6:47048111-47048133 TGAACACACTGTGCCACAGAAGG + Intergenic
1015716004 6:136192426-136192448 TGAACCCCCTGTTCAAGTTTGGG - Exonic
1017939256 6:159036747-159036769 TGAAGACCCATTTCCAGAGGAGG - Exonic
1018729135 6:166635912-166635934 TGACCACCCTGGTCTAGAGTAGG - Intronic
1018764959 6:166925745-166925767 TCAACACCCAGTTCCATGGTTGG - Intronic
1018936191 6:168275438-168275460 TGAACATCCTGTTTCAGAGAAGG + Intergenic
1020925788 7:14322305-14322327 TGAACACTGTATTCCACAGTAGG - Intronic
1021402872 7:20229827-20229849 GAAACACCCTGTTCCTCAGTGGG - Intergenic
1021906566 7:25339646-25339668 TGAATACCCTGTTCTAGGGCTGG + Intergenic
1025615770 7:63114682-63114704 TGCACACCCTGTTCCACATCTGG - Intergenic
1028586975 7:92461903-92461925 TGTTCACACTGTACCAGAGTTGG - Intergenic
1035663667 8:1364849-1364871 TGATCAGCCTTTTCCAGAGGAGG + Intergenic
1037578166 8:20227588-20227610 TGAACACCCAGTGCTAGAGAGGG - Intergenic
1037705979 8:21315576-21315598 TTAACTCCCTGTTCCATAGAGGG - Intergenic
1039042134 8:33418010-33418032 TGACCACACTGTTTCAGAGAGGG + Intronic
1041977966 8:63821020-63821042 GGAACTCCCTGGACCAGAGTTGG - Intergenic
1044685455 8:94822081-94822103 TGAACTCCCCTTTTCAGAGTGGG - Intronic
1048412247 8:134187214-134187236 TTAATACTTTGTTCCAGAGTTGG - Intergenic
1051422042 9:16898279-16898301 TGAACATCCTGCTTCAGAGTAGG + Intergenic
1052686542 9:31764659-31764681 TGATGACACTGTTCCAGAGGTGG - Intergenic
1054353638 9:64042135-64042157 TGTACACCCTGTTCCATATTGGG + Intergenic
1054905469 9:70411161-70411183 TGGAAACCCTATTCCTGAGTCGG + Intronic
1056950312 9:91036285-91036307 TGAAACCCCTGTTTCAGAGCAGG + Intergenic
1061713477 9:132503622-132503644 TGAAAACCTTGTGCCAGAGGTGG + Intronic
1062304230 9:135893969-135893991 AGAACACCCTGTTGCTGTGTTGG - Intronic
1203695696 Un_GL000214v1:95070-95092 TGTACACCCTGTTCCATATTGGG - Intergenic
1203741970 Un_GL000218v1:11243-11265 TGTACACCCTGTTCCATATTGGG + Intergenic
1203702165 Un_KI270742v1:5833-5855 TGTACACCCTGTTCCATATTGGG + Intergenic
1203640577 Un_KI270751v1:8993-9015 TGTACACCCTGTTCCATATTGGG + Intergenic
1186134607 X:6505848-6505870 CTAAGACCCTGTTCCAGAGAGGG - Intergenic
1186260821 X:7777178-7777200 TGAAAACCCTGTCCCATATTTGG - Intergenic
1192153073 X:68724005-68724027 GGAACAACCTGTGCCAGAGTCGG + Exonic
1194731562 X:97461481-97461503 TGAACACGCTGTTACAGAACTGG + Intronic