ID: 1181694976

View in Genome Browser
Species Human (GRCh38)
Location 22:24588484-24588506
Sequence GTGCCAGGCCACAGCCGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181694976_1181694984 2 Left 1181694976 22:24588484-24588506 CCAACCCGGCTGTGGCCTGGCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1181694984 22:24588509-24588531 AGCCAGGGGAGGCTGCCCTCTGG 0: 1
1: 0
2: 4
3: 47
4: 380
1181694976_1181694988 14 Left 1181694976 22:24588484-24588506 CCAACCCGGCTGTGGCCTGGCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1181694988 22:24588521-24588543 CTGCCCTCTGGGAGCTGGACAGG 0: 1
1: 0
2: 1
3: 50
4: 396
1181694976_1181694991 18 Left 1181694976 22:24588484-24588506 CCAACCCGGCTGTGGCCTGGCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1181694991 22:24588525-24588547 CCTCTGGGAGCTGGACAGGCTGG 0: 1
1: 0
2: 4
3: 67
4: 405
1181694976_1181694987 9 Left 1181694976 22:24588484-24588506 CCAACCCGGCTGTGGCCTGGCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1181694987 22:24588516-24588538 GGAGGCTGCCCTCTGGGAGCTGG 0: 1
1: 0
2: 4
3: 56
4: 494
1181694976_1181694982 -9 Left 1181694976 22:24588484-24588506 CCAACCCGGCTGTGGCCTGGCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1181694982 22:24588498-24588520 GCCTGGCACAGAGCCAGGGGAGG 0: 1
1: 0
2: 9
3: 86
4: 613
1181694976_1181694985 3 Left 1181694976 22:24588484-24588506 CCAACCCGGCTGTGGCCTGGCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1181694985 22:24588510-24588532 GCCAGGGGAGGCTGCCCTCTGGG 0: 1
1: 0
2: 2
3: 34
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181694976 Original CRISPR GTGCCAGGCCACAGCCGGGT TGG (reversed) Intronic
900989911 1:6093699-6093721 TTGCCAGGGGACAGGCGGGTTGG + Intronic
901635463 1:10668249-10668271 GGGTCAGACCACAGCGGGGTGGG - Intronic
901814405 1:11785594-11785616 GTGCCAGGCCACTGCAGGTCCGG + Intronic
905890815 1:41517206-41517228 ATGCCAGTCCACTGCCTGGTGGG - Intronic
907271383 1:53293393-53293415 GTGCCAGGCCAGAGCCAGAGTGG - Intronic
907385537 1:54123054-54123076 GTGCCAGGCCAAAGGCTGGGTGG - Intergenic
909079188 1:71088726-71088748 GTGCCATGCCACAGCAGGTATGG + Intergenic
920088801 1:203437775-203437797 GTGCCAAGCCACTGCAGGATGGG - Intergenic
922382928 1:225051068-225051090 GTGCCAGTCCACGGCCTGTTAGG - Intronic
1066164488 10:32772073-32772095 GTGGCAGGGCAAAGCCAGGTGGG + Intronic
1067763537 10:49068833-49068855 GTGCCAGGCCACAGCCCACGGGG - Intronic
1067798863 10:49342939-49342961 GTACCAAGCCACTGCCGGGGTGG - Intergenic
1069807057 10:71132648-71132670 GTGCAAGGCCAGAGCTGGCTGGG - Intergenic
1072970065 10:100009805-100009827 GGGCCAGGCCGGAGCCGGGCGGG - Intronic
1073176393 10:101560033-101560055 GAGCCAGGCCAGAGCCAGGGTGG - Intergenic
1077250805 11:1559809-1559831 GTCCGAGGCCACAGGCTGGTGGG + Intronic
1082911110 11:58375613-58375635 GTGCCATGCCACAGCAGAGTAGG - Intergenic
1084652147 11:70495606-70495628 GAGCCAGGGCACTGCGGGGTGGG + Intronic
1085054967 11:73398087-73398109 CTGGCAGGCCATAGCTGGGTGGG + Intergenic
1087691701 11:101327678-101327700 GTACCAGTCCACAGCCTGTTAGG - Intergenic
1089514949 11:119026497-119026519 GTCCCAGGGCACAGGCAGGTTGG - Intronic
1090346750 11:126077635-126077657 GTTCCAGGACACATCCAGGTGGG - Intergenic
1091303116 11:134520309-134520331 GTGACAGGAGACAGCAGGGTTGG + Intergenic
1093389666 12:18602719-18602741 GTACCAGCCCAAAGCCAGGTAGG + Intronic
1096078272 12:48818177-48818199 GTCCCAGGCGACAGCAGGGCGGG - Intronic
1096191597 12:49623508-49623530 TGGCCAGGCCGCAGCCGGGAGGG - Exonic
1098606673 12:72398941-72398963 GTGCCAGTCCATGGCCTGGTAGG + Intronic
1101881570 12:108629370-108629392 GAGCCAGGCCACAGCTGAGCAGG + Intronic
1103004311 12:117409077-117409099 CAGCCAGGCTACAGCCTGGTTGG + Intronic
1103158262 12:118706215-118706237 GTGCCAGGGCAGAGCAGGGGAGG - Intergenic
1105292307 13:19060878-19060900 GTGTCAGGGCAGAGCAGGGTTGG - Intergenic
1105303469 13:19154234-19154256 GTCCCAGGCAGCAGCTGGGTGGG + Intergenic
1107446179 13:40472061-40472083 GTACCTGGCCACAGCCTGGGGGG - Intergenic
1107534221 13:41311856-41311878 GTGCCCGGGCACAGCCGCCTCGG + Intronic
1112768581 13:102772855-102772877 GTGCCAGGCCACTGTCGTCTGGG + Intronic
1115835420 14:37397269-37397291 GTACCAGCCCAGAGCCGGGTAGG - Intronic
1118764103 14:68898746-68898768 GGGCAAGGTCACAGCTGGGTTGG - Intronic
1122782891 14:104151036-104151058 GGGCAAGGCCAGAGCCTGGTGGG + Intronic
1122830515 14:104393423-104393445 GTGTCAGGCCACAGCAGGCCAGG + Intergenic
1122986416 14:105213742-105213764 GTGCCAGGCCTCACCCTGGGGGG + Intronic
1126136157 15:45394097-45394119 CTGCCAGTCCACAGCCTGTTAGG + Intronic
1126392975 15:48178551-48178573 GTGCCAAGCGACAGGCGGGCTGG - Intergenic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1132418451 15:101642683-101642705 GTGACTGGCCACAGCTGGGGTGG - Intronic
1132484185 16:181615-181637 ATTCCAGGCCACAGCCGCGGCGG - Intergenic
1132519155 16:379464-379486 TTATCAGGCCACAGCCTGGTGGG - Intronic
1132543858 16:524176-524198 CTGCCAGGCCAGAGCCAGGGAGG + Intergenic
1132879924 16:2157586-2157608 GTGCCAGGCCCCATGCGGGAGGG - Intronic
1132885452 16:2180251-2180273 CTGCCAGCCCAGAGCCGGGCCGG - Exonic
1135544312 16:23355507-23355529 GTGCCAGGGCCTGGCCGGGTGGG - Intronic
1139043919 16:63033384-63033406 GTTCCAGGCCATGGCCGGATGGG + Intergenic
1139448723 16:67014230-67014252 GCGCCAGCCCAGAGCCGGGGCGG + Intergenic
1139958159 16:70703094-70703116 CTGCCAGGCCTCCGCCGGGCAGG - Intronic
1141428360 16:83957743-83957765 GTGTCAGGCCCCAGCCAGGGAGG + Intronic
1141925723 16:87167714-87167736 GTCCCAGGACACAGCCTGATAGG - Intronic
1142068246 16:88074786-88074808 GAGCCCGGCCACAGCTGGGAAGG - Intronic
1142490561 17:275934-275956 GTGCCAGTCCACAGCGGGAATGG + Intronic
1142772375 17:2107793-2107815 GTGCCAGGGCCAAGCGGGGTGGG + Intronic
1143030343 17:3964077-3964099 CTGCCCGCCCAGAGCCGGGTGGG + Intronic
1143501518 17:7342156-7342178 GTTCCAGGCCACAGCAGGGCTGG + Intronic
1144750451 17:17644697-17644719 GTGCCTGGGCACATCTGGGTTGG - Intergenic
1147951367 17:44109814-44109836 GTGCCAAGCCACTGCCAGGAGGG + Intronic
1151517729 17:74607014-74607036 GTGCCAGTTCTGAGCCGGGTGGG - Intergenic
1156242631 18:35268117-35268139 GAGCCAGGGCACAGCGGGGCGGG + Intronic
1156484779 18:37457747-37457769 CTGCCAGGCCACAGCCTCCTGGG - Intronic
1161033405 19:2070602-2070624 GTCCAAGGCCACAGCGGGCTAGG + Intergenic
1161119659 19:2518322-2518344 GTGCCAGCCCCCAGCCCGGGCGG - Intronic
1161334936 19:3708037-3708059 GCGCCAAGCCACAGCCTGATGGG + Intergenic
1162796890 19:13091733-13091755 GTGCCAGCCCAGAGCTGGGAGGG - Intronic
1163008882 19:14412610-14412632 GTGCCAGGCCAAGTCCGGGATGG - Exonic
1163144303 19:15370246-15370268 GTCCCTGGCCACTGCCTGGTGGG + Intronic
1164703378 19:30302284-30302306 GCTCAAGGCCACAGCCAGGTGGG + Intronic
1166317890 19:41998905-41998927 GGGCCAGGCCGCGGCCGGGGCGG + Exonic
1166561962 19:43738850-43738872 GACCCAGACCACAGCCGGTTTGG + Intronic
1167272414 19:48513482-48513504 GTGCCAGGCCGCCGCCGTCTCGG + Intergenic
925970941 2:9106155-9106177 GGGTCAGGCCTGAGCCGGGTGGG - Intergenic
926094635 2:10073219-10073241 CTGGCAGCCCACAGCCGGGGGGG - Intronic
926159492 2:10477624-10477646 GTTCCAGGCCACAGCCTGGCAGG - Intergenic
927847572 2:26479437-26479459 GGGCCAGGCCACAGGAGGATGGG + Intronic
927950605 2:27165989-27166011 GTGCTAAGCCACAGTCAGGTTGG - Intergenic
931250710 2:60528585-60528607 GTGCCAGGCAACAACTGGGCAGG - Intronic
932081921 2:68723344-68723366 GGGCCATGCCACATCCTGGTGGG + Intronic
935281503 2:101521869-101521891 GTTCTTGGCAACAGCCGGGTGGG + Intergenic
935926406 2:108074479-108074501 TGGCCAGGCCCCAGCCGGCTTGG - Intergenic
937927196 2:127176465-127176487 GTGCCAGCACACGGCCGGGTAGG + Intergenic
940427310 2:153545169-153545191 GTGGCAGTCCACAGCCGGTGAGG + Intergenic
940834967 2:158510986-158511008 GTGCCAGACCACAGAGTGGTAGG + Intronic
941395436 2:164968038-164968060 GTGCCAAACCACAACCAGGTTGG + Intergenic
941523793 2:166581619-166581641 CTGCGAGGCAACAGCCTGGTGGG + Intergenic
943717929 2:191172794-191172816 GAGCCAGGACACTGCTGGGTGGG - Intergenic
943719135 2:191184643-191184665 GTGCCAGGGCACACCGTGGTTGG - Intergenic
946294468 2:218772973-218772995 CTGCCAGGCAATAGCCTGGTGGG - Intergenic
946865793 2:224039727-224039749 GTGCCAGGACGCGGCCGGGAAGG + Intergenic
948805208 2:240450962-240450984 GTGGCAGGTCACAGCTGGGTGGG + Intronic
948856199 2:240731827-240731849 GGGCCAGGACACAGCCTGCTTGG + Intronic
1172358657 20:34297088-34297110 CTGACAGGCCACAGCCTTGTTGG - Intronic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1175550167 20:59812407-59812429 GTGGGAGGCCACAGCCCGGGAGG - Intronic
1176359574 21:5983362-5983384 GTGCCATGCCACAGCAGCTTAGG + Intergenic
1179763944 21:43555188-43555210 GTGCCATGCCACAGCAGCTTAGG - Intronic
1179982496 21:44903606-44903628 GTGCCAGTGCACAGCCCGCTCGG - Intronic
1180953007 22:19729197-19729219 GTGCCAGGCCACCGCTGGGGAGG - Intergenic
1181493335 22:23274376-23274398 GTGCCAGGCCACACCTAGGAAGG - Intronic
1181694976 22:24588484-24588506 GTGCCAGGCCACAGCCGGGTTGG - Intronic
1182477896 22:30586366-30586388 GTGACAGCCCACAGCCAGGTTGG + Intronic
1182487746 22:30649474-30649496 GGGCCAGCCCACGGCGGGGTGGG + Intronic
1182723396 22:32422895-32422917 TTCCCAGTCCACAGCCTGGTGGG - Intronic
1184251691 22:43264235-43264257 CTCCCAGGCCACAGCCAGGAAGG - Intronic
950003540 3:9676355-9676377 GGGGCAGGCCACAGCCCGGGGGG + Intronic
953989804 3:47475586-47475608 GTGCAGGGACACGGCCGGGTTGG + Intronic
954213296 3:49110355-49110377 GCGCCAGCCTACAGCAGGGTGGG + Exonic
954383993 3:50234956-50234978 GGGACAGGCCACAGGAGGGTGGG + Intronic
954698153 3:52438377-52438399 GTGCCAGGACACAGAAGGGATGG + Intronic
961447881 3:126989547-126989569 GGGCCAGGGCACGGCCGGGCCGG - Exonic
961821624 3:129578298-129578320 AAGCCAGGCCAGCGCCGGGTGGG - Intronic
962645121 3:137430897-137430919 CTGCCAGGCGACAGCCTGGCTGG + Intergenic
969306235 4:6327722-6327744 GTGCCAGCCCAGCCCCGGGTCGG + Intronic
969336782 4:6515371-6515393 GTGCCAGGCCAAAGGCTGGGAGG + Intronic
969570274 4:8004279-8004301 ATGCCAAGCCACAGGCAGGTTGG + Intronic
969700565 4:8765478-8765500 GGCACAGGCCACAGCCAGGTTGG + Intergenic
969877286 4:10145176-10145198 GTTCCAGGTCACAGATGGGTAGG + Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
972314380 4:37912363-37912385 GTGCCATGCCATAGCAGGATGGG + Intronic
979137109 4:117123986-117124008 GAGACAGGCCACACCCAGGTGGG - Intergenic
982845491 4:160247033-160247055 GTGGCAGGGCAAAGCCAGGTAGG + Intergenic
983755577 4:171330523-171330545 GCTCCAGGCCAGTGCCGGGTGGG - Intergenic
986592628 5:9387082-9387104 GTGACAGGCCACATCAGGATGGG + Intronic
986644521 5:9903633-9903655 GTACCAGCCCAGAGCCTGGTAGG - Intergenic
986795990 5:11212705-11212727 GAGCCAGGCCTCAGCCATGTGGG - Intronic
990210931 5:53480799-53480821 GCGCGAGGCACCAGCCGGGTGGG + Exonic
992080696 5:73232895-73232917 GTTCCAGGCCTCAGCCTGGGTGG + Intergenic
992197515 5:74354589-74354611 ATGCCTGGCCACAGCCGAGCTGG - Intergenic
995528939 5:113073805-113073827 CTGCAAGGCCACAGCGAGGTTGG + Intronic
996325475 5:122267864-122267886 GTACCAGCCCAGAGCTGGGTAGG + Intergenic
997361900 5:133300487-133300509 GTACCAGGCCACAGCTGGGGAGG - Intronic
1001490130 5:172149225-172149247 GTGCTAGGCCTGTGCCGGGTGGG - Intronic
1006583539 6:35090368-35090390 GGGCCAGGCCACATCCAAGTGGG + Exonic
1008205762 6:48654379-48654401 GTGCCTGGTCACAGCCTGATGGG + Intergenic
1010046631 6:71451579-71451601 GTGCCAGGCCAAAATCTGGTTGG + Intergenic
1011394504 6:86891902-86891924 GTGGCAGGGCAAAGCCAGGTAGG - Intergenic
1013316803 6:108951156-108951178 GTCCCAGGTCACAGCCAGGCAGG - Intronic
1013368545 6:109452191-109452213 GAGCCAGGCCACAGTCAGGCAGG + Intronic
1013709764 6:112883120-112883142 GTGCCAGGCAACAGGGGAGTCGG - Intergenic
1015025823 6:128531200-128531222 ATGCCAGGTCACAGGAGGGTAGG + Intergenic
1018441731 6:163820106-163820128 GAGCCAGCCCACAGCCGAGGTGG - Intergenic
1019278140 7:186857-186879 GTGCCAGGCCTGAGCTGGGTGGG + Intergenic
1019452047 7:1104043-1104065 GTGCCATGGCAGAGCCTGGTGGG - Intronic
1023985015 7:45089111-45089133 GAGGGAGGCCACAGCCGGGTGGG - Intergenic
1026809132 7:73447590-73447612 CTGCCAGGCCACAGACAGTTTGG + Intronic
1026888291 7:73967331-73967353 GGCCCTGGCCACAGCCGGGAAGG - Intergenic
1027251303 7:76400448-76400470 GTGCCAGGCCACAGCCCAGCTGG + Exonic
1029157012 7:98524591-98524613 TCCCCAGGCCACAGACGGGTAGG - Intergenic
1034102300 7:148460118-148460140 ATGCCAGGCCTCAGGCAGGTTGG + Intergenic
1034399503 7:150852729-150852751 GTGGCAGGCAACAGCCGGCCAGG + Intronic
1034425305 7:151010828-151010850 AGGCCTGGCCACAGCAGGGTTGG + Intronic
1034649224 7:152676192-152676214 GCGCCAGGCCGCGGCCGGGGAGG + Intergenic
1035224037 7:157423981-157424003 GTGGGAGGCCTCAGCCGTGTGGG + Intergenic
1037772571 8:21811119-21811141 GGGCCAGGACACAGCCGGCATGG + Intronic
1037876657 8:22551945-22551967 GCGCCAGGCAGCAGCCGGGCAGG + Exonic
1038437782 8:27548550-27548572 ATGCCAGGCCAGTGCTGGGTTGG - Intergenic
1039273272 8:35906652-35906674 GAGCCAGGACACAGCTGGGCTGG - Intergenic
1040005732 8:42619211-42619233 GTGCCAGGACCCAGCAGGGCTGG - Intergenic
1048232779 8:132660039-132660061 GTGCCAGGGCACACAGGGGTTGG + Intronic
1049099155 8:140567024-140567046 GTGCCAGGGCACAGCACTGTAGG - Intronic
1049695918 8:143984227-143984249 GCGCCTGGCCACAGCCACGTTGG - Exonic
1051662921 9:19442535-19442557 GTGCCAGGACAGGGCCGGCTTGG - Intronic
1056101101 9:83301315-83301337 GTGTCAGGCCACAGCTCTGTAGG - Intronic
1056755102 9:89376824-89376846 CTGCCAGGCCACAGGTGAGTTGG - Exonic
1057082220 9:92181456-92181478 GGGCCAGGCCACAGCCAGAAAGG + Intergenic
1058275671 9:103038270-103038292 ATGGCAGGACAAAGCCGGGTGGG - Intergenic
1058426790 9:104882397-104882419 TTGCCAGGCCACTGCCTGGAAGG + Intronic
1058646098 9:107132701-107132723 GTACCAGTCCACAGCCTGTTAGG + Intergenic
1060743500 9:126114605-126114627 ATGCTTGGCCCCAGCCGGGTAGG - Intergenic
1061947913 9:133919183-133919205 GTGCCAGGGCACAGCAGTGAGGG - Intronic
1062407704 9:136404787-136404809 GTGAAGGGCCACAGCCAGGTTGG - Intronic
1062434354 9:136540142-136540164 ATGCCAGGCCACCACCGGGCCGG + Intronic
1062518048 9:136945852-136945874 AGTCCAGGCCACAGCCGGGGTGG - Intronic
1062525900 9:136978022-136978044 GTGCCAGGACACGGGCGGGTGGG + Intronic
1062590471 9:137272369-137272391 GTGCCTGGGCACAGCTGGGGAGG + Intronic
1188094221 X:26002471-26002493 GTGGCAGGACAAAGCCAGGTGGG - Intergenic
1190280453 X:48925842-48925864 GTCCGAGGCCCCAGCCAGGTGGG - Exonic
1194556625 X:95368164-95368186 GTGGCAGGGCAAAGCCAGGTGGG - Intergenic
1197713132 X:129686625-129686647 CTGGGAGGCCACAGCCGGGGAGG - Intergenic
1199332804 X:146581940-146581962 GTGACAGGGCAAAGCCAGGTGGG + Intergenic
1199575844 X:149312880-149312902 GTGATAGGCCACAGCAGTGTAGG - Intergenic
1199939611 X:152612319-152612341 CTGCGAGGCCACAGCCTGGCTGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic