ID: 1181695394

View in Genome Browser
Species Human (GRCh38)
Location 22:24590424-24590446
Sequence CTTTGGATAAGTAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181695382_1181695394 24 Left 1181695382 22:24590377-24590399 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 197
1181695379_1181695394 28 Left 1181695379 22:24590373-24590395 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 197
1181695381_1181695394 25 Left 1181695381 22:24590376-24590398 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 197
1181695385_1181695394 -3 Left 1181695385 22:24590404-24590426 CCACTCAGCCTTGGAGGACCCTT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181695394 Original CRISPR CTTTGGATAAGTAGAGGGGA GGG Intronic
901163716 1:7199525-7199547 CTTCGGAGAAGGACAGGGGAAGG - Intronic
901775482 1:11557724-11557746 CTTTGTAAAACCAGAGGGGATGG - Intergenic
903141790 1:21343672-21343694 CTGTGGGGAAGTGGAGGGGATGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903681189 1:25098415-25098437 ATTTGGATAAGTAGAGAAGAAGG + Intergenic
906773107 1:48502768-48502790 CTGAGGATGAGTAGAGTGGATGG + Intergenic
907862659 1:58368445-58368467 TGTAGAATAAGTAGAGGGGAGGG + Intronic
909140469 1:71858202-71858224 CTTTGGATAAGTGTAGGAGAAGG - Intronic
911038694 1:93575457-93575479 CTTTTCATGAGAAGAGGGGAGGG + Intronic
911855935 1:102874713-102874735 CTTTTGTTAGGTAGAGTGGAAGG + Intergenic
914577120 1:148983159-148983181 CTTTCCATAAGTAAAGAGGAAGG + Intronic
915897360 1:159822670-159822692 CTGGGGATAAGTAGAGGGAGTGG - Intergenic
921111376 1:212041192-212041214 GATTGCATAAGTAGAGGGGTAGG + Intronic
922050358 1:221983479-221983501 ATTTGGAGAGGCAGAGGGGAGGG - Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
923777245 1:236990592-236990614 CTTTGGATAATTCGGGGGTAGGG + Intergenic
1063549509 10:7016779-7016801 CTTTGGGTAACTATATGGGAAGG - Intergenic
1064838430 10:19561792-19561814 CCATGGAGAACTAGAGGGGATGG + Intronic
1069345092 10:67459343-67459365 CTTTGCATTAGTAGTGGGGATGG + Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070280639 10:75045691-75045713 GTTTGGAAAGGTAGAGGGGCTGG + Intronic
1071927630 10:90428849-90428871 CTTTGTATAAGAAGAGGGAGTGG + Intergenic
1073511211 10:104043704-104043726 TTTTGGATCAGTAGCGGGGGAGG - Intronic
1074837941 10:117316777-117316799 CTTTGTAGAAGTAGAAGGCAAGG - Intronic
1075496334 10:122922564-122922586 CTTTGTTTGAGTAGAGGAGAGGG + Intergenic
1075995540 10:126873568-126873590 CTTGAGATAAGCAGAGGGGTGGG - Intergenic
1076042064 10:127258900-127258922 CTTTGGATTTGTCGAAGGGAAGG - Intronic
1076394451 10:130128856-130128878 CTTGGGCTAAGGAGAAGGGACGG + Intergenic
1076462891 10:130658485-130658507 CTTTGTAGCAGTGGAGGGGATGG + Intergenic
1078215974 11:9312203-9312225 GTTTGGATAAGTAAAGAGAAGGG - Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1082005316 11:47415856-47415878 CTTTGGCTTAGAAGTGGGGAAGG - Exonic
1084790334 11:71471546-71471568 CTTTGCATGAGTCGAGGGAAAGG + Intronic
1085744693 11:79104757-79104779 CTTTGGCTAAGTAGTGAGAATGG + Intronic
1086936416 11:92750191-92750213 CTTTTGATAATGAGAGGGGGAGG + Intronic
1087266067 11:96062683-96062705 CTTTGGATAAGGAGAGCTGCTGG - Intronic
1089160527 11:116433615-116433637 TTTTGGATAACTGGAGGGAAAGG + Intergenic
1091761823 12:3092689-3092711 ATTTGGATAAGCAGTGGGTAAGG - Intronic
1092219848 12:6705525-6705547 AATTGGAGAAGTAGAGGAGATGG - Intergenic
1095946267 12:47755558-47755580 CTTTGGAAAATAAGAGGGGGAGG - Intronic
1096403980 12:51329479-51329501 CTGTGGGTATGTGGAGGGGAGGG + Intronic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097541247 12:60946311-60946333 CTTTGGAGAGGGAGAAGGGATGG + Intergenic
1102556760 12:113731829-113731851 CTTTTGAAAAGTGGAGGGCAGGG - Intergenic
1102640282 12:114361026-114361048 CTTGGGATAAGTGGAGGACATGG - Intronic
1103152850 12:118656383-118656405 ATTTTGCTAAGCAGAGGGGAAGG + Intergenic
1103285581 12:119798590-119798612 ATTTGGATCAGTGGAGAGGAAGG - Intronic
1106668701 13:31881400-31881422 CTGTGGATGAGTAGTGGTGATGG + Intergenic
1109388082 13:61658579-61658601 TTTTGTATAGGTAGAGGGAAGGG + Intergenic
1109921873 13:69074577-69074599 CGTTGAATAAGTTGAGGAGAAGG + Intergenic
1112111788 13:96308587-96308609 CTCTGGAAAGGTAGAGGTGAAGG + Intronic
1118127933 14:62929804-62929826 CTGTGGATTACTAGAGGGGGAGG - Intronic
1118277096 14:64394909-64394931 CTCTGGATCATCAGAGGGGAAGG - Intronic
1118553647 14:66987047-66987069 CCAAGGATAAGAAGAGGGGATGG + Intronic
1120504174 14:85334057-85334079 CTTTGGATAAGTAGAGATGTTGG + Intergenic
1121602844 14:95218798-95218820 GTTTGAAAAAATAGAGGGGATGG + Intronic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1124724068 15:32139363-32139385 CTTTGGATAAATACAAGGGAAGG + Intronic
1125271925 15:37948967-37948989 CTTGAGAAAAGTAGAGGGAAAGG + Intronic
1125759173 15:42085270-42085292 CTTTGCAGGAGGAGAGGGGAGGG + Intronic
1127540963 15:59938638-59938660 CTGTAGAAAAGTAGAGGGAAGGG - Intergenic
1128032487 15:64493482-64493504 CTTTGGGTAAATACAGGGTATGG + Intronic
1129490864 15:75924300-75924322 CTTTGCATTAGCAGAAGGGAGGG - Intronic
1131330747 15:91497128-91497150 CTTTGGACATTTAGAGTGGAGGG - Intergenic
1134361329 16:13533643-13533665 CTTTGCATAAGTGGAGGGGTTGG - Intergenic
1137001323 16:35233283-35233305 CTTGGGAGAAGCAGAGGGAATGG - Intergenic
1137485731 16:48889180-48889202 CTTAGGATAAAGAGAGGGGCAGG - Intergenic
1137560094 16:49496938-49496960 CTTTGGACACCCAGAGGGGAAGG - Intronic
1138242407 16:55437934-55437956 CTTTAATTAAGTAGAGGGAAAGG + Intronic
1138765763 16:59601417-59601439 CTTTGGTTAAGTAGTTGGAAAGG - Intergenic
1139595406 16:67954885-67954907 TTGTGGATGAGTAGAGGGGCTGG + Intronic
1142145887 16:88492823-88492845 CTTGGGAGAAGGAGAGGGGCTGG - Intronic
1144063087 17:11600334-11600356 ATTTGTATAAGTAGAGAGCAAGG + Intronic
1144085777 17:11807354-11807376 TTTTGGGCAAGAAGAGGGGACGG - Intronic
1144776750 17:17788651-17788673 CCTTGGGTAAGTAGGTGGGATGG + Intronic
1151840390 17:76613321-76613343 CTTTGGTCAAGTAAAGGGGCGGG + Intergenic
1156781525 18:40856265-40856287 CTTTATATAAGTAGACGGGTGGG - Intergenic
1157971751 18:52277814-52277836 CCTTGGATAAGAAGAGGGTATGG + Intergenic
1158542965 18:58373506-58373528 CTTTGGATTAGAAGAGGTGCTGG - Intronic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1164922661 19:32101056-32101078 CTGAGGATTACTAGAGGGGAGGG - Intergenic
1165008412 19:32824804-32824826 CTTTGGAAAAGCAGAGGCCATGG + Intronic
1168549048 19:57278211-57278233 CTTTGGGTAAGTGGTGGGGTCGG - Intergenic
925620862 2:5791466-5791488 CTTGGGATAGGTAGAGGGGCAGG - Intergenic
926333838 2:11848739-11848761 TTTTGGGTAAGTGGAGGGGCAGG + Intergenic
926782340 2:16484875-16484897 ATTTGGATAAGCAAAGAGGAAGG + Intergenic
927768212 2:25833377-25833399 CTTTGCAGAAGAAGAGGGAATGG - Intronic
928581169 2:32709129-32709151 TTTTGGATAAATGGAGGAGAGGG + Intronic
930111611 2:47683381-47683403 CTTTGTTAAGGTAGAGGGGAGGG + Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931292606 2:60888347-60888369 CTTTAAATAAGTAGTGGGCAGGG + Intronic
931777912 2:65555980-65556002 CTTTGGACAAGGAGAGACGAGGG - Intergenic
933124885 2:78592872-78592894 CTTGGCATAAGTAGAAGGGCAGG - Intergenic
939014115 2:136881318-136881340 CTTTGTCTGAGTAGAAGGGAGGG + Intronic
939675876 2:145071388-145071410 CATTGGATAAGCACTGGGGAGGG + Intergenic
940439427 2:153696736-153696758 CTGCAGATAAGTGGAGGGGAGGG + Intergenic
941719827 2:168801134-168801156 CTTTGGATAAGCAAAGAGGGAGG + Exonic
942403851 2:175631902-175631924 ATTTGGATAATTAGAAGGAATGG - Intergenic
942797440 2:179838546-179838568 CTTTGGAGTTGCAGAGGGGAAGG - Intronic
945683131 2:212937445-212937467 CTGTGGCTAAGTTGAGGGGCGGG + Intergenic
946805938 2:223471390-223471412 CTTTAGATCAGTAGATGGGATGG + Intergenic
947897451 2:233688886-233688908 CTTGGGAGAAGTTGGGGGGATGG + Intronic
947989391 2:234474781-234474803 CTTAGAACAAGAAGAGGGGAGGG - Intergenic
948179638 2:235969646-235969668 CTCTGGATATGTGGACGGGATGG - Intronic
1170479117 20:16747382-16747404 CAATGGATAAGAACAGGGGAAGG + Intergenic
1170924198 20:20707944-20707966 ATCTGGGAAAGTAGAGGGGAAGG - Intronic
1172531733 20:35635745-35635767 CTGAGGATCAGTATAGGGGAGGG - Intronic
1173341962 20:42161059-42161081 CTTTGGATAATGAAAGGGGAAGG + Intronic
1174444188 20:50579617-50579639 CTTTGCATGAGCAGAGGTGACGG - Intronic
1174985664 20:55448738-55448760 CTCTGGATAAGAAGAAGAGAGGG - Intergenic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182181113 22:28349110-28349132 CTTTGGAAAAGCAGAGCAGAAGG + Intronic
1183652989 22:39169717-39169739 CTTGGGAGAAGAAGAGGGCAGGG - Intergenic
1183806955 22:40219739-40219761 CTTCGGATAAGGTGAGGGAAGGG - Intronic
1184526917 22:45029487-45029509 ATTGGGATAAGTAGAGAAGAGGG + Intergenic
1184931015 22:47681444-47681466 CTGAGGATGAGTACAGGGGATGG + Intergenic
949482707 3:4509313-4509335 TTTTGGACATGTGGAGGGGATGG + Intronic
952043958 3:29294874-29294896 CTTTGGATAGGTATATGGCATGG - Intronic
953365878 3:42344591-42344613 CTTTGCATAAGAAGAGGGGCTGG + Intergenic
953687497 3:45089558-45089580 CCTTGAACAAGTAGAGAGGATGG - Intronic
957958650 3:87222327-87222349 ATTTGGATAAGTTGAGAGAAGGG + Intergenic
959277248 3:104292078-104292100 CTTTGTATAACTTGAGAGGAAGG + Intergenic
960614034 3:119580646-119580668 GTTTAGATAAGTGGAGGGGAGGG + Intronic
961217188 3:125168790-125168812 CTTTGGAGCTGTAGAAGGGATGG - Intronic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
965744599 3:171911633-171911655 CTTTCAAAAAGTAGAGGAGAAGG - Intronic
971510401 4:27417049-27417071 ATTTGGATAAGTAATGAGGAGGG + Intergenic
973641251 4:52905066-52905088 CTTTGGATAGTAAGAGGTGATGG + Intronic
974717354 4:65685240-65685262 CTTTTGATAAGTAGGAGTGATGG + Intergenic
974770379 4:66403879-66403901 CTTTAGAAAAGTAGAGGGAAGGG - Intergenic
976284623 4:83359544-83359566 CTTTAGATAAGCAGTGAGGAGGG + Intergenic
979572909 4:122251506-122251528 CTTTGGAAATGTTTAGGGGATGG + Intronic
984933556 4:184869714-184869736 CTTTGGCTAAGTACAGTGGATGG + Intergenic
985324501 4:188753015-188753037 CTTTGGTTAAGTAAAAGGAAAGG + Intergenic
986730118 5:10629113-10629135 TTTCGGATGAGTAGTGGGGATGG + Intronic
988454120 5:31372523-31372545 CTTTGGAGAGCTAGAGGGGGAGG - Intergenic
988848942 5:35159466-35159488 ATTTGTATCAGTAGAGTGGAGGG - Intronic
998389846 5:141780399-141780421 ATTTGGTTAGGTAGAGGGGGAGG - Intergenic
998531393 5:142888556-142888578 CTCTGGATAATCAGAGTGGAAGG - Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000377929 5:160601366-160601388 CTTTGCATAAGTAAAAGGGGAGG - Intronic
1000454987 5:161437811-161437833 CATTGGATAAGGGGAGGGAAGGG + Intronic
1003089507 6:3090160-3090182 CTGTTGCTAAGTACAGGGGAAGG - Intronic
1003675286 6:8198583-8198605 TTTTGTATAAGTTGAGGAGATGG + Intergenic
1004162955 6:13230620-13230642 ATTTGGATAAATAAAGGAGAGGG - Intronic
1004510046 6:16277873-16277895 CATTGGAGAAGCAGTGGGGAGGG + Intronic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1005614435 6:27559103-27559125 CTTTGGAAAACAGGAGGGGAAGG + Intergenic
1006581273 6:35079135-35079157 CTCTGGACAGGTAGAAGGGACGG - Intronic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007652833 6:43433828-43433850 CTTTGGGTAGGCTGAGGGGAAGG + Intronic
1007983304 6:46181248-46181270 GTTTTAATAAGTAGTGGGGAAGG + Intergenic
1009267663 6:61575937-61575959 CTTTGGCGAATTAGAGGGAAGGG + Intergenic
1010404140 6:75483631-75483653 CATTGGGAAAATAGAGGGGAAGG + Intronic
1010891577 6:81318902-81318924 CTGTGGACTACTAGAGGGGAAGG + Intergenic
1012988128 6:105896870-105896892 GTTTGAATAGGAAGAGGGGAGGG - Intergenic
1013785903 6:113780182-113780204 GTTTGGATAGGCAGAAGGGAAGG + Intergenic
1017324458 6:153130421-153130443 CTTTGACTAAGGGGAGGGGAAGG + Intronic
1018824708 6:167400326-167400348 CTTTTGATAGGAAGAGTGGATGG + Intergenic
1021213546 7:17886777-17886799 ATTTGGATAGATAGAGAGGAAGG - Intronic
1022538228 7:31111489-31111511 CTTGGCATAAGTGGAGGGAAGGG + Intergenic
1023423374 7:40007929-40007951 GTTTGGATAGGTATAGTGGAGGG + Intronic
1023683590 7:42713534-42713556 ATTAGGCTAAGTAGAGGAGAAGG - Intergenic
1023882085 7:44326294-44326316 CTTTGGAGAAGTGAGGGGGAAGG - Intronic
1024435743 7:49352965-49352987 CTCTGGATCAGTAGATAGGATGG + Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1025087403 7:56034368-56034390 CTTAGGATAAGGATAGGTGAGGG + Intronic
1028313903 7:89375509-89375531 CTTTGGAGACTTGGAGGGGAAGG - Intergenic
1030424338 7:109354679-109354701 TTTTGGAGAAGTAGAGGGTGAGG - Intergenic
1031800175 7:126233322-126233344 CTTTGGAAAAACAGAGAGGAAGG + Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1034140613 7:148812115-148812137 CTTGGGGAAAGTAGAGGGAAAGG - Intronic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034872312 7:154695583-154695605 GTTTGGAGAAGGAGAGGTGAAGG + Intronic
1034944606 7:155253814-155253836 TTTTCGGTAAGCAGAGGGGAGGG - Intergenic
1038224974 8:25647195-25647217 GTGTGGATCTGTAGAGGGGAGGG - Intergenic
1048042769 8:130747154-130747176 CTTTGGCTACCTAGAAGGGAAGG + Intergenic
1050206525 9:3202122-3202144 GTTTGGTTAAAAAGAGGGGAAGG + Intergenic
1051083926 9:13325055-13325077 CTTTGGACAAGTGGAGGAGAAGG - Intergenic
1051834770 9:21323268-21323290 CTATGTAGAAGTAGAAGGGAGGG + Intergenic
1052420254 9:28234344-28234366 CTTTGACTATGTAAAGGGGAAGG + Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1054351618 9:64021385-64021407 CTTTGGAGGAGAAGAGGGGTGGG + Intergenic
1055394799 9:75862695-75862717 CTGTGGGTAAGTAGAGGTTAGGG + Intergenic
1055789170 9:79903176-79903198 CTTTGGATTAGTATAAGGTATGG + Intergenic
1056178917 9:84062621-84062643 CCTTGGAGGAATAGAGGGGAGGG + Intergenic
1057832490 9:98417950-98417972 CTTTGGAGGAGTAGAAAGGAGGG + Intronic
1058467008 9:105238765-105238787 CTTTGGATAAGTGAAGATGATGG - Intergenic
1059151187 9:111951074-111951096 ATTTGGAGAAGTTGAGGGGGAGG - Intergenic
1059853503 9:118369119-118369141 AATTGGATATCTAGAGGGGAGGG + Intergenic
1060698634 9:125731462-125731484 CCCTGGGGAAGTAGAGGGGATGG - Intergenic
1061066267 9:128279493-128279515 CTTTGGCTACCTAGAAGGGAAGG - Intronic
1062434330 9:136540002-136540024 CTTGGGAGAAGGAGAGGGGCAGG + Intronic
1186925883 X:14332972-14332994 ATTTGGCTAAGGAGAAGGGATGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187266084 X:17735511-17735533 TTTTGGCTAAGTAGAGGACATGG + Exonic
1187678283 X:21739977-21739999 GTTTTAATAAGTAGAGAGGAAGG - Intronic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1188371198 X:29371596-29371618 CTGTGGATTACTAGAGGGAAAGG - Intronic
1188518340 X:31011226-31011248 TTTAGGAAAAATAGAGGGGAAGG + Intergenic
1190963264 X:55273158-55273180 CTTTGTATAGCTAGAGGGCATGG - Intronic
1190963407 X:55274537-55274559 CTTTGTATAGCTAGAGGGCATGG - Intronic
1191807321 X:65148624-65148646 CTTGGGAGAAGAAGAGGGAAAGG - Intergenic
1192243783 X:69357005-69357027 CTATGCATGAGGAGAGGGGAGGG + Intergenic
1194040804 X:88940031-88940053 CTTTGCATAGTTAGAGGGCATGG + Intergenic
1194632468 X:96302332-96302354 CTGTGGATAAGTAAGGGGGCAGG - Intergenic
1195263507 X:103157486-103157508 TTTTGCATAAGTAAATGGGAAGG + Intergenic
1195447475 X:104970911-104970933 CTCTGGGTCAGTAGATGGGATGG + Intronic
1195903846 X:109825127-109825149 CGTTGGAGGCGTAGAGGGGATGG - Intergenic
1196920709 X:120582675-120582697 CTTGGAATAAGTTGGGGGGAAGG - Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1199546722 X:149013942-149013964 CTCAGGATTTGTAGAGGGGAGGG - Intergenic