ID: 1181699027

View in Genome Browser
Species Human (GRCh38)
Location 22:24609517-24609539
Sequence CTGTGTGTGGGGAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 3, 1: 4, 2: 7, 3: 55, 4: 628}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181699011_1181699027 26 Left 1181699011 22:24609468-24609490 CCAAGCCTGGGGAGGTGGCCACC 0: 6
1: 1
2: 1
3: 30
4: 319
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699016_1181699027 5 Left 1181699016 22:24609489-24609511 CCCTTCCATGATGGCATTTGGAT 0: 4
1: 3
2: 1
3: 29
4: 338
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699017_1181699027 4 Left 1181699017 22:24609490-24609512 CCTTCCATGATGGCATTTGGATG 0: 4
1: 3
2: 2
3: 22
4: 213
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699012_1181699027 21 Left 1181699012 22:24609473-24609495 CCTGGGGAGGTGGCCACCCTTCC 0: 6
1: 1
2: 2
3: 33
4: 311
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699018_1181699027 0 Left 1181699018 22:24609494-24609516 CCATGATGGCATTTGGATGTTCC 0: 4
1: 3
2: 1
3: 11
4: 123
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699009_1181699027 30 Left 1181699009 22:24609464-24609486 CCCACCAAGCCTGGGGAGGTGGC 0: 6
1: 1
2: 1
3: 17
4: 293
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699014_1181699027 8 Left 1181699014 22:24609486-24609508 CCACCCTTCCATGATGGCATTTG 0: 4
1: 3
2: 2
3: 14
4: 169
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628
1181699010_1181699027 29 Left 1181699010 22:24609465-24609487 CCACCAAGCCTGGGGAGGTGGCC 0: 6
1: 1
2: 0
3: 28
4: 347
Right 1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG 0: 3
1: 4
2: 7
3: 55
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181699027 Original CRISPR CTGTGTGTGGGGAGGGCACA GGG Intronic
900092641 1:927101-927123 TTGTGTGTCAGGTGGGCACATGG - Intronic
900400799 1:2472120-2472142 CTGCCTGTGGGGAGGGCTCGAGG + Intronic
900740581 1:4328529-4328551 CCGGGTGTGTGGAGGGCACCTGG + Intergenic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901161148 1:7177463-7177485 GTGTGTGTGGGGGGGCCTCAGGG - Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
901800493 1:11705364-11705386 CAGTGTGGAGGGAGGGCACTGGG + Intronic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
901927358 1:12574771-12574793 CGGTGTGTGGGATGGGGACACGG + Intronic
902736933 1:18407422-18407444 CGGTGACTGGGGAGGGCCCACGG + Intergenic
902935573 1:19762425-19762447 GTGTGTCTGGGGTGGGCACCAGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903617442 1:24671237-24671259 GTGTGAGTGGGGAAGGCCCAAGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904130841 1:28274047-28274069 CTGGGTGTGGAGAGGGCTCCAGG - Exonic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904289390 1:29474471-29474493 CAGTGAATGGGGAAGGCACACGG - Intergenic
904496263 1:30888522-30888544 ATGTGTGTGGGGAGGGCTTTGGG - Intronic
904568897 1:31445769-31445791 GTGTGTGGTGGGAGGGCACTTGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905858192 1:41328969-41328991 CTGTGTGTGGGCAGGAGCCACGG + Intergenic
906033957 1:42739647-42739669 CTGTGGGAGGGGAGGGCTCTAGG - Intronic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
909236715 1:73161975-73161997 CTGTGTGAGGGGGTGGTACAGGG + Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
911147474 1:94566806-94566828 ATGTGTATGTGCAGGGCACAGGG + Intergenic
912344627 1:108953170-108953192 CTGTTTATGGGCAGGGCCCAGGG - Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
915321232 1:155057487-155057509 CTGTCTGTGGGGACAGCACATGG + Intronic
915526822 1:156481100-156481122 CTGTCAGTGGGGAGGGGCCAGGG - Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
917634035 1:176917842-176917864 CTGTGTTTGGTGAAGGCACGTGG - Intronic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
918273852 1:182931673-182931695 TTGTGTGTGCGGGGGGAACAAGG - Intronic
919643970 1:200073958-200073980 CTGTCTGTGGAGGGGGCACCAGG + Intronic
919741325 1:200983167-200983189 CAGTGTGTGGGGTGGTCAGAGGG + Intronic
920105984 1:203553972-203553994 CTGGGTGTGGTGGTGGCACACGG + Intergenic
920248872 1:204608888-204608910 CTGCTTGTGGGGAGGTCACTAGG + Intergenic
920387503 1:205579263-205579285 TCCTGTGTGGGGAGGACACAGGG + Intronic
920507258 1:206525305-206525327 GTGTTTGGGAGGAGGGCACAGGG + Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921031638 1:211339695-211339717 CTGTATGTGGGCAGGGCACCTGG + Intronic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922905754 1:229172395-229172417 CTGTGTGTGGGCTGGGCATGTGG - Intergenic
923048028 1:230369622-230369644 CTGTGTGTGTGCTGGGGACAGGG + Intronic
923514117 1:234680305-234680327 GTGTGTGTGGGGGGGGCATATGG + Intergenic
1062831412 10:608358-608380 CTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062842027 10:679425-679447 CTGGGTGTGGGGAGTACAGATGG - Intronic
1063121448 10:3107705-3107727 CTGGGTTATGGGAGGGCACAGGG - Intronic
1063185653 10:3648728-3648750 CTGTGTGTGGTGGGCACACATGG - Intergenic
1063238307 10:4141975-4141997 GTGCCTGTGGGGAAGGCACAAGG - Intergenic
1063268341 10:4478665-4478687 GTGTGTGTGGTCGGGGCACAGGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063688524 10:8261363-8261385 CCGAGTGCTGGGAGGGCACAAGG + Intergenic
1064977634 10:21135272-21135294 CTGGGTGGGGCGAGGCCACAGGG + Intronic
1066040520 10:31544497-31544519 CTGTTTCTGGGGAGGCCTCAGGG - Intergenic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066383425 10:34921126-34921148 CAGTGTGTGCGGAGATCACATGG + Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067055486 10:43047463-43047485 CTGGGTGTTTGGTGGGCACATGG - Intergenic
1067267210 10:44756696-44756718 GTGTGTGTGTGTATGGCACATGG - Intergenic
1067311165 10:45114901-45114923 CTGCTTGTGGGGAGGCCTCAGGG + Intergenic
1067727033 10:48778276-48778298 TTATGTGATGGGAGGGCACATGG + Intronic
1068818149 10:61341646-61341668 CTGTCTCTGGGGAGGCCTCAGGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069982256 10:72260830-72260852 CTGGGTGGGGGCAGGGCGCAGGG - Intergenic
1070453219 10:76582580-76582602 GTGTGCATGGGGAGGGCCCATGG - Intergenic
1070612907 10:77946439-77946461 GTGTGTGTGGTGAGGGCATTAGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070844835 10:79513472-79513494 GGATGAGTGGGGAGGGCACAAGG - Exonic
1070928970 10:80246835-80246857 GGATGAGTGGGGAGGGCACAAGG + Intergenic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071211375 10:83345410-83345432 CTTTGTGGGGGGAGGCCAAATGG + Intergenic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071436021 10:85648802-85648824 CAAGGTGTGGAGAGGGCACAGGG - Intronic
1073050198 10:100662137-100662159 CTGGGTGTGGGGAGGCCACTCGG + Intergenic
1073113297 10:101075706-101075728 CTGTGTTTGGGAAGGACGCAGGG + Intergenic
1073515448 10:104071742-104071764 CTCAGTGTGGTGAGGGAACAGGG - Intronic
1074713004 10:116193003-116193025 CTGTGTGTGTGGAGGGGCCTGGG - Intronic
1074718947 10:116248179-116248201 CTGGGTGTGGCAAGGGCAAAAGG + Intronic
1074777825 10:116779271-116779293 TTGTGTTTGGGGTGGGCACCCGG - Intergenic
1075102394 10:119515672-119515694 CTGTGTGTGCAGATAGCACAAGG - Intronic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1076020784 10:127070915-127070937 GTGTTTGTGGGTAGGGCACCTGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076131580 10:128017514-128017536 GCCTGTGTGGGGAGGGCATATGG - Intronic
1076699805 10:132265503-132265525 CTGGGTGTGAGGAGAGGACACGG + Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1077315431 11:1917530-1917552 CTGGGTGGGGGCAGGGCACAAGG - Intergenic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1077417932 11:2433529-2433551 CTGTGTGTGGAGCGGGCACTGGG + Intergenic
1077494595 11:2880765-2880787 GTGTGTGTGAGGCCGGCACACGG - Intergenic
1077522817 11:3046343-3046365 CTGTGTCTTGGAATGGCACATGG + Intronic
1077528907 11:3086163-3086185 CTGTCTCTGGGCAGGGCACCTGG + Intergenic
1077533400 11:3107748-3107770 GTGAGTGGGGCGAGGGCACAGGG - Intronic
1077938129 11:6812485-6812507 CTGGGAGTGGGGAGGTCTCAGGG + Intergenic
1078173439 11:8949032-8949054 GTGTGTGTGTTGAGGGTACAGGG - Intronic
1078216204 11:9314255-9314277 CTGTGTGTCGGGTGGGGAAAAGG - Intronic
1078265770 11:9755575-9755597 CTGTATGTAGGGGTGGCACATGG - Intergenic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1081287126 11:41284615-41284637 CTGTCTGTGGGGAGGGCTGCTGG - Intronic
1081413437 11:42786054-42786076 CTGTCAGTGGGGAGGAAACAGGG + Intergenic
1081702524 11:45161194-45161216 CTGTGTGTCTGCATGGCACATGG - Intronic
1082206585 11:49442729-49442751 CTGTGTTTGGGGCTTGCACATGG + Intergenic
1083661967 11:64255615-64255637 GGGTGTGTGGGGTGGGGACAGGG + Exonic
1083744930 11:64730121-64730143 CTCTGTGTTGGGGGGGCGCATGG - Exonic
1084128919 11:67118874-67118896 GTGTGTGGGGGGAGGGCGCGCGG + Intergenic
1084421435 11:69062568-69062590 CTGTGTCCTGGGTGGGCACAGGG + Intronic
1084647285 11:70465823-70465845 GTGTGTGTTGGGAGGGCTCTGGG + Intergenic
1084670220 11:70602194-70602216 CTGCTTCTGGGGAGGGCTCAGGG - Intronic
1084680496 11:70663676-70663698 CTGTCTCTGGGGAGGGGGCAAGG - Intronic
1085034940 11:73293965-73293987 CTGTGTGAGGAGAGGGGTCAGGG + Intronic
1085150249 11:74246691-74246713 CTGGGTGTGGGGAGGAGAAAAGG - Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085899685 11:80684056-80684078 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086648684 11:89259039-89259061 CTGTGTTTGGGGCTTGCACATGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087996561 11:104816788-104816810 CTTGGTGTGGGGAGGGGACTGGG - Intergenic
1088269571 11:108019910-108019932 CTGTGTGTGTAGAGATCACACGG + Intronic
1088351343 11:108891832-108891854 CACTTTGTGGGGAGGGCACCGGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089990035 11:122850466-122850488 GTGAGTGTGGGGTGGGGACATGG - Intronic
1090260307 11:125314563-125314585 CAGTCAGTGGGGAGGGGACAAGG + Intronic
1090482731 11:127082299-127082321 CAGAGTGAGGGAAGGGCACAAGG - Intergenic
1090874456 11:130776425-130776447 CTCTGTGTGTTGAGGGTACAAGG + Intergenic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091189857 11:133682185-133682207 CTGGCTGTCGGGAGGGCACGGGG + Intergenic
1091348522 11:134873261-134873283 CTGTGTGTGCAGAGACCACATGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092535235 12:9380402-9380424 CTGTGTCTGGAGGGGGCACTTGG + Intergenic
1092784493 12:12015219-12015241 GTGGGTGTGTGGTGGGCACAGGG - Intergenic
1093798100 12:23337597-23337619 ATGAGTGGGGGGAGGGTACACGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094216921 12:27952292-27952314 CCCTGTGTGGGCAGTGCACAGGG + Intergenic
1096244926 12:49979186-49979208 CTGGGTGGGGGCAGGGGACATGG + Intronic
1096752682 12:53772052-53772074 TTGTGTGTGGTGAGGGCAGGGGG - Intergenic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097261145 12:57720863-57720885 CTCCAGGTGGGGAGGGCACAGGG + Exonic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1100272420 12:93039095-93039117 CTGTTTCTGGGGAGGCCTCAGGG + Intergenic
1102241699 12:111328502-111328524 CTGTGTATGGGGACAGGACAGGG - Intronic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1102771500 12:115481233-115481255 CTGGGGGCTGGGAGGGCACATGG - Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103600459 12:122051286-122051308 CTGCCCGTGGGAAGGGCACAAGG + Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1103859958 12:124004238-124004260 CTGGGTGGAGGGAGGGCATAAGG + Intronic
1104003437 12:124875228-124875250 ATGTGAGTGGGGCGGGCTCAGGG + Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104463707 12:128973943-128973965 GTGTGTGTGGGGGGGGCGCTTGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104849082 12:131862679-131862701 CTGTGTGTGCGGGAGACACACGG - Intergenic
1104908074 12:132225951-132225973 CAGTGTGTGGGGTGTGCATATGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105016482 12:132788882-132788904 CTGTGTCTGGGGTGGGGCCAAGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105415151 13:20205547-20205569 CTGTTCATGGGGAGGGAACAGGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106097493 13:26660930-26660952 CTGTGTGTGCAGAGGTCACATGG + Intronic
1106183504 13:27387974-27387996 TTCTGTGTGAGGAGGGCTCAGGG - Intergenic
1107167964 13:37305341-37305363 CTGAGCCTGGGGAGGTCACAAGG - Intergenic
1107172990 13:37365376-37365398 GTGTGTGTGGGCAGGGCAGGGGG + Intergenic
1107895566 13:44959179-44959201 CTGAGTCTTGGGTGGGCACATGG - Intronic
1107978937 13:45715908-45715930 CTGGGGTTGGGGAGAGCACAGGG - Intergenic
1108210865 13:48138623-48138645 CTGTTTCTGGGGAGGCCTCAGGG - Intergenic
1109301244 13:60592405-60592427 CTCTGTATGGGGAGGACGCAGGG - Intergenic
1110366443 13:74691587-74691609 CTGTGTGTGGGAAGGGGATGTGG + Intergenic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1113082839 13:106535577-106535599 TTGTGTGCGGGGAGGGCGCCGGG + Intergenic
1113372575 13:109736655-109736677 TTGGATGTGGGGAGGGCCCAAGG + Intergenic
1113578801 13:111413880-111413902 CTGGGTGTGTGGTGGGCATATGG + Intergenic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1114534925 14:23416843-23416865 GTGTGTGTGTGCAGGGCACGGGG - Intronic
1115501888 14:34057510-34057532 CTGTGTGTGGGTGGGGCCCGGGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117383029 14:55184520-55184542 CAGTGTGAGGGGATGACACAGGG - Intronic
1118012970 14:61628800-61628822 CTGAGTGTAGGGAGTGCACTGGG - Intronic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119796883 14:77406580-77406602 GTGTGTGTGTGTAAGGCACAAGG - Intronic
1120506232 14:85356056-85356078 CTGTGTGTGCAGAGATCACATGG - Intergenic
1121210403 14:92204084-92204106 CTGTGTGTGCAGAGATCACATGG - Intergenic
1121323188 14:93004773-93004795 GTGTGGGTGCGGGGGGCACAGGG + Intronic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122412697 14:101534020-101534042 CTGGGGGTGGGGGGGGCACTGGG + Intergenic
1122452565 14:101822075-101822097 GTGTGTGTGGGGGGGGGGCAGGG - Intronic
1122692720 14:103538805-103538827 CTCCGCGTGGGGAGGGCCCATGG - Intergenic
1122774647 14:104111813-104111835 GTGTGTGTGGGCTGGGGACAGGG + Intronic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123116597 14:105897589-105897611 CAGTCTGTGGGAAGAGCACAGGG - Intergenic
1124651824 15:31479682-31479704 CTGTCTCTGGGGAGGGGTCATGG - Exonic
1125333488 15:38604865-38604887 GTGTGTGTCGGGGGGGCATATGG + Intergenic
1125551020 15:40544599-40544621 CTGTGTGTTGGTATAGCACAGGG - Intronic
1127051427 15:55088242-55088264 CTGTGTCTGGCTAAGGCACATGG - Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129061377 15:72863083-72863105 TGGAGTCTGGGGAGGGCACAGGG + Intergenic
1129518184 15:76169654-76169676 GTGGGAGTGGAGAGGGCACAGGG + Intronic
1129583108 15:76832829-76832851 CTGTTTCTGGGGAGGCCTCAGGG - Intronic
1129759374 15:78120662-78120684 CTGGGTGGGGGCAGGGCAGAGGG + Intronic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1129821156 15:78602835-78602857 ATGGGGGTGGGGAGGGTACAGGG - Intronic
1131165291 15:90137950-90137972 ATGTATATGTGGAGGGCACAGGG - Intergenic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1132487868 16:205509-205531 CTGTCTGAGGAGAGGGTACATGG + Intronic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133130813 16:3675169-3675191 CTGGGTGTGGGGATGAGACAGGG - Intronic
1133682937 16:8137632-8137654 GTGTGTGTTAGGGGGGCACATGG - Intergenic
1134384850 16:13762143-13762165 TTGTGTGTGGGGAGAGTAAAGGG - Intergenic
1135975722 16:27108095-27108117 CTGTGTGTGGGGGTGCCCCAGGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136187544 16:28597017-28597039 CTGCGGGCGAGGAGGGCACAAGG - Intronic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136774626 16:32865201-32865223 CTGTGTGCTGGGAGGCTACAAGG + Intergenic
1136895986 16:33996313-33996335 CTGTGTGCTGGGAGGCTACAAGG - Intergenic
1137008046 16:35296839-35296861 CTCTCTGTGGGGAGGTCCCAGGG - Intergenic
1137014738 16:35363776-35363798 CTGTCTGTGGGGAGAGTCCAGGG - Intergenic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1137710864 16:50565990-50566012 CAGTGTGTGTCGGGGGCACAGGG - Intronic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1138214766 16:55193934-55193956 GTGTGTGTGGGCAGGGGACAGGG - Intergenic
1138442501 16:57043440-57043462 CTCTTTGTGGTCAGGGCACAGGG - Intronic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1139160335 16:64498365-64498387 ATGTGTGTGGGGAGGGAATGGGG + Intergenic
1140138002 16:72225246-72225268 TGGGGTGTGGGGAGAGCACATGG - Intergenic
1140974216 16:80043742-80043764 CAGGGTGTGGGCAGGGCCCAGGG + Intergenic
1141466376 16:84208494-84208516 GGGTGTGTGGAAAGGGCACAGGG - Intergenic
1141558159 16:84849495-84849517 CTGTGTGTAGTGCGTGCACATGG - Exonic
1141579690 16:84988740-84988762 GTGAGTGTGGGGTAGGCACATGG - Intronic
1141936030 16:87238407-87238429 GTCTGTCTGGGGAGGTCACAGGG - Intronic
1203077053 16_KI270728v1_random:1127337-1127359 CTGTGTGCTGGGAGGCTACAAGG + Intergenic
1142480085 17:213755-213777 GGGTGTCTGGTGAGGGCACAAGG + Exonic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142635411 17:1254077-1254099 CTGGGTGTGCAGAGGTCACACGG + Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143004300 17:3817956-3817978 GTGTGTGTGTGTATGGCACAGGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143495823 17:7312173-7312195 GGATGAGTGGGGAGGGCACAAGG - Exonic
1143532214 17:7512115-7512137 CTGTGTGTGGAGGGGTCTCATGG + Intronic
1143575782 17:7792357-7792379 CTGGGTGTGAGGAGGGCATGGGG + Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144021765 17:11244332-11244354 CTGTGTGTGGTAGGGGGACAGGG + Intronic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144780666 17:17806891-17806913 CTGGGTGCGGGGAGGGGACTGGG + Intronic
1144834183 17:18148344-18148366 CTGTGTGTGGGGGTGGGACCTGG + Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146668284 17:34719578-34719600 CTGCGAGCGGGGAGGGGACAGGG - Intergenic
1146926871 17:36751486-36751508 AAATGTGTGGGGAGGGGACAAGG - Intergenic
1147169065 17:38607506-38607528 CTCTGTGTGGGGGAGGCTCAGGG + Intergenic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1147788123 17:42995050-42995072 CTGTGTTTGTTGAGGGCACGGGG - Intergenic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148198118 17:45729372-45729394 TTGTGTGTTGGGAGGGCCAAGGG + Intergenic
1148244758 17:46023460-46023482 CTGTCTCTGGGGAGGGTACCTGG + Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148855064 17:50574557-50574579 GTGGGGGTGGGGGGGGCACATGG - Intronic
1149423599 17:56533645-56533667 CTCAGGGTGGGGAAGGCACATGG - Intergenic
1149435882 17:56632904-56632926 GTGTATGTGGGGAGGGGGCAGGG - Intergenic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150822845 17:68449694-68449716 CTGCTTCTGGGGAGGGCTCAGGG - Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151660786 17:75516909-75516931 CTGTGAGAGGGGCGGGCCCAGGG + Exonic
1152075778 17:78158861-78158883 GGATGAGTGGGGAGGGCACAAGG - Intronic
1152123869 17:78434893-78434915 CTGTGTGGGGGGAGGGCTTCAGG + Intronic
1152145599 17:78566907-78566929 GGGTGTGATGGGAGGGCACACGG - Intronic
1152264568 17:79286852-79286874 CAGTGTCTGAGGAGGGCACCAGG - Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1152699230 17:81810953-81810975 CTGTGGGGGGGGCGGGCCCAGGG + Intronic
1154059127 18:11042369-11042391 CTGTGTGTATGAAGTGCACATGG - Intronic
1154961148 18:21309897-21309919 GTGTGTGTGGGGAGGGGATGGGG - Intronic
1156276548 18:35589071-35589093 AGGTTGGTGGGGAGGGCACATGG + Intronic
1156365066 18:36418531-36418553 AAGTGTGTGTGGAAGGCACATGG + Intronic
1157535678 18:48455707-48455729 CTGTGTGTGGGCAGCTCAAAGGG + Intergenic
1158668781 18:59456128-59456150 CTGTGAGTGGGAGGGACACACGG - Intronic
1158714036 18:59862289-59862311 CTGTGAGTGGCAGGGGCACATGG - Intergenic
1158876296 18:61737615-61737637 CTGGATATGGGGAGGGCACGGGG - Intergenic
1160297435 18:77650863-77650885 ATGTTTGTGTGGAGAGCACACGG + Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160828104 19:1090014-1090036 GTGTGTGTGGGGGGGGAACGCGG + Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161332464 19:3694835-3694857 ATGAGTGTGGTGAGGGCACCTGG - Intronic
1161354943 19:3813752-3813774 CTGGGTGTGGGGAGCGCCCTGGG + Intronic
1161564124 19:4990281-4990303 CTTTTTGTGGGGCGGGGACAGGG - Intronic
1161788073 19:6340572-6340594 CTGTGTGTGGGTGGAGCAGATGG + Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162134091 19:8544581-8544603 TTGGGGGTGGGGAGGGCACCAGG + Intronic
1162528902 19:11224051-11224073 GTGTGTGTGGGGCGGGGGCAGGG + Intronic
1162799067 19:13101151-13101173 CTGTGCCTGAGGCGGGCACATGG + Exonic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163241969 19:16069998-16070020 GTGTGTGTGGTGGGGGCCCAGGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163869687 19:19809700-19809722 CTGTGGCAGGGGAGGGCACCTGG - Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165704469 19:37965931-37965953 CTTTGTGTGCGGTGGGCACTTGG + Intronic
1165810075 19:38606837-38606859 CTGTGTGTGGCGCCAGCACAGGG - Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166836679 19:45671410-45671432 TTGTGTCTGGGGAGGGCTCCGGG - Intronic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167408997 19:49334027-49334049 CTGGGAGTGGGGAGGGCGCTGGG - Intergenic
1167502638 19:49856383-49856405 CCCGGTGTGGGGAGGGGACATGG + Intronic
1167640490 19:50678859-50678881 CAGGGTGTGGGGAGGGGTCAGGG + Intronic
1167640506 19:50678896-50678918 CAGGGTGTGGGGAGGGGTCAGGG + Intronic
1167640536 19:50678970-50678992 CAGGGTGTGGGGAGGGGTCAGGG + Intronic
1167640544 19:50678988-50679010 CAGGGTGTGGGGAGGGGTCAGGG + Intronic
1167640590 19:50679101-50679123 CAGGGTGTGGGGAGGGGTCAGGG + Intronic
1167867566 19:52340591-52340613 CTGTAAGTGGGGCTGGCACATGG - Intronic
1168120300 19:54248265-54248287 CTGTGTTTGTGGATGGCACTGGG + Intronic
1168123955 19:54272553-54272575 CTGTGTTTGTGGATGGCACTGGG + Intronic
1168178409 19:54642981-54643003 CTGTGTTTGTGGATGGCACTGGG - Intronic
1168191286 19:54740445-54740467 CTGTGTGTGCGGGGGTCACAGGG - Intronic
1168193547 19:54757049-54757071 CTGTGTGTGCTGGGGTCACAGGG - Intronic
925388494 2:3479896-3479918 GGGTGTGTGGGGAGGGCAAGAGG - Intronic
925422082 2:3720536-3720558 CTGCATGTGGGAAGGGTACATGG - Intronic
925541692 2:4974330-4974352 TTGTGTGTGGGGAGGGTGCCAGG - Intergenic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
925858938 2:8156601-8156623 CTGAGTGTGGGCAGGGAGCAGGG + Intergenic
925966438 2:9071356-9071378 CTGAGTGTTAGCAGGGCACATGG - Intergenic
926099205 2:10103307-10103329 GTGGGTGTGGGGAGGGCACAGGG + Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
928288235 2:30012148-30012170 CTGTGTGTGCAGAGGTCTCATGG - Intergenic
929546060 2:42855848-42855870 CTGTGTGTGGCCAGGCCAGAGGG - Intergenic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
931803126 2:65778164-65778186 CTGTGTGTGCAGAGACCACAGGG + Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932265677 2:70365314-70365336 CTGTGTGTGGAAAGGGCCCCTGG - Intergenic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
933074066 2:77900542-77900564 ATGTGTGTGTGCAGGTCACAGGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934940639 2:98499314-98499336 CTGTTTGAGGGGAGGAAACAGGG - Intronic
935209239 2:100924152-100924174 GTGTGTCTAGGGAGGGCTCAGGG - Intronic
936540815 2:113349523-113349545 CTGTGTGGGGGTAGAGCAGATGG - Intergenic
936986643 2:118317318-118317340 CTATTTGTGTTGAGGGCACAGGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937055306 2:118929667-118929689 CAGTTTCTGGGGAGGCCACAGGG - Intergenic
937355621 2:121196440-121196462 GGGTGTGTGGGCAGGGGACAGGG - Intergenic
937718267 2:125060319-125060341 CTGTGCATGGGGAGGGTTCAGGG + Intergenic
937882647 2:126880224-126880246 CTGTGTGTTGGGGGGGCACTTGG + Intergenic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938248920 2:129798816-129798838 CTGTGTGCAGGGAGGACACAGGG - Intergenic
938595497 2:132783768-132783790 CTGCTTCTGGGGAGGGCATAGGG + Exonic
941060045 2:160836708-160836730 CTCTGCCTGGGGAGGACACAGGG - Intergenic
941753001 2:169152927-169152949 CTGTGCGAGGGGAGGGCTCTAGG - Exonic
945451285 2:209999462-209999484 CAGTTTGTGGGGAGGGGTCACGG - Intergenic
946044428 2:216809932-216809954 CTCTGTGTGACGGGGGCACAGGG - Intergenic
946044441 2:216809982-216810004 CAGTGTGTGGGGTGGTGACATGG + Intergenic
946174274 2:217913044-217913066 CTGAGCGAGGGGAGAGCACAGGG - Intronic
946307853 2:218866152-218866174 CTGTGGGTGGGGGTTGCACAGGG - Intronic
947549429 2:231036181-231036203 GTGTGTGTGAGGGTGGCACATGG - Intergenic
947718026 2:232351591-232351613 ATGTGTGCAGGGAGGGGACAGGG - Intergenic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
947993997 2:234511834-234511856 CTGTCTGGGGGGAGAGGACATGG - Intergenic
948004922 2:234600196-234600218 CTGTGTGTGTGGTGGGCGTAGGG - Intergenic
948492288 2:238320995-238321017 CCGGGTGTGGGCCGGGCACAGGG + Intronic
948687344 2:239677530-239677552 CTGTGTGTGTGCAGGGGCCAGGG - Intergenic
948813684 2:240499081-240499103 CTGTGTGCTGGGAAGGCACCTGG + Intronic
948846904 2:240687610-240687632 CTGTGGGTGGGGGGTGCACACGG + Intergenic
948901927 2:240960515-240960537 CTGTGTGTGGCAAGGGCAGGAGG + Intronic
948936180 2:241166468-241166490 CTGTGTGGGCGGTGGGCACCAGG + Intronic
1169073440 20:2748001-2748023 CTGTGTCTGAGGAGTGTACATGG + Intronic
1170416271 20:16146040-16146062 CTGTGTGGTAGGATGGCACATGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171159480 20:22908543-22908565 ATGGGAGTGGGGAGGGCACCAGG - Intergenic
1171171432 20:23019081-23019103 CTGTGTGTGTCGAGAACACAAGG - Intergenic
1172463235 20:35135889-35135911 CTGGGGCTGGGGTGGGCACAGGG - Intronic
1172523203 20:35582468-35582490 CTAGGTGTGGGGAGGGGATATGG + Intergenic
1172843112 20:37913877-37913899 TTCTGAGTGGGGAGGGCGCACGG + Intronic
1173429012 20:42968957-42968979 CTGTGTGTGTGGATTCCACATGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1174040757 20:47697728-47697750 ATGTGTGTGGGCAGGAAACAGGG + Intronic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175855608 20:62119344-62119366 CTGGGTGTGCTGAGGGCACTGGG - Intergenic
1175922672 20:62457432-62457454 CTGTGTGTGGGGAGGGTCCCCGG - Intergenic
1176163642 20:63661557-63661579 CTGAGGGTGGGGTGGGCCCATGG + Intronic
1176180292 20:63746700-63746722 GTGAGTTGGGGGAGGGCACAGGG - Exonic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1179152061 21:38817702-38817724 CTGATACTGGGGAGGGCACAGGG + Intronic
1179236342 21:39550402-39550424 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1179266754 21:39810325-39810347 CTGGGGGTTGGTAGGGCACAGGG - Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179722392 21:43323111-43323133 CTGTGCGTGGGAAGGGCTCTTGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180166025 21:46029609-46029631 GTGTGTGTGGAGGGGGGACAGGG - Intergenic
1180558454 22:16596537-16596559 CTGTGAGTGGGGAAAGCACAAGG + Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1180790459 22:18572975-18572997 CTGTCTCTGGGGTGGGCCCAAGG - Intergenic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181007196 22:20019518-20019540 CTGGGGGTGGGGATGGCCCAAGG + Intronic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181231279 22:21422340-21422362 CTGTCTCTGGGGTGGGCCCAAGG + Intronic
1181247372 22:21512528-21512550 CTGTCTCTGGGGTGGGCCCAAGG - Intergenic
1181494639 22:23281150-23281172 CTGTGTATGAAAAGGGCACAGGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182084561 22:27552389-27552411 CTGCTTCTGGGGAGGCCACAGGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183735447 22:39642417-39642439 CTGTATGTGGGGAGCCCACCTGG - Intronic
1184035584 22:41916354-41916376 CTGTCTTTGGCCAGGGCACAAGG - Intergenic
1184232967 22:43168465-43168487 CTGTGTGGGGGTCTGGCACAGGG + Intronic
1184280187 22:43433058-43433080 CTGTGTGTGGGGGGGCGGCAGGG + Intronic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
1184572624 22:45335876-45335898 CTGTGTGTGCGCTGGGCACCAGG + Intronic
1184804147 22:46781615-46781637 CTGTTTTTGGGGAGGGCATGGGG + Intronic
1185032081 22:48449504-48449526 CAGTGTGTGGGCAGAGCACCTGG - Intergenic
1185209679 22:49563657-49563679 CTGCTTGTGGGGAGGCCTCAGGG + Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949733704 3:7145759-7145781 CTGTCTGAGTGGAGGCCACAAGG - Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950421428 3:12901879-12901901 CTGTGTGTGGCGAGTGCAGAGGG + Intronic
950558298 3:13708001-13708023 TTGTGTGTGGTGGGGGCACATGG + Intergenic
950703860 3:14768170-14768192 AGGGGAGTGGGGAGGGCACAGGG + Intronic
950704124 3:14769560-14769582 AGGGGAGTGGGGAGGGCACAGGG + Intronic
950709981 3:14807122-14807144 TTGTGTGTGGGGAGGGTCCTGGG + Intergenic
950918583 3:16669819-16669841 CTGTGAGTGGAAATGGCACATGG - Intronic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
952851304 3:37732201-37732223 CAGGGTGTGGGGAGGGTACAAGG - Intronic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953230157 3:41057763-41057785 CCGTGAGTGGAGAGGGAACATGG - Intergenic
953434732 3:42869502-42869524 TTGGATGTGGGGAAGGCACAGGG - Intronic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954749704 3:52806536-52806558 CTGGGGGTGGGGAGTGCCCAGGG + Intronic
955532273 3:59886546-59886568 CTGTGTGTGCAGAGATCACATGG + Intronic
955566329 3:60250894-60250916 CTGTGTTTGGTGAGGGCAGTGGG - Intronic
956368235 3:68529673-68529695 CTGTGTGTGCAGAGACCACATGG + Intronic
956894288 3:73643950-73643972 CTGTGAGTGGGGATGGGACTGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958540533 3:95465071-95465093 CTCTCAGTGGAGAGGGCACATGG + Intergenic
958867268 3:99515965-99515987 ATGTGTTTGGGGAGGTCCCAAGG + Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959681722 3:109104221-109104243 CTCTCTGTGGGGAGGGAAAAAGG + Intronic
959685168 3:109137580-109137602 CTGTGTGTGGGAAGGGCTTCAGG - Intergenic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
961452571 3:127009023-127009045 CTGGGTGTGGGCAGAGCCCACGG + Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961871215 3:129989707-129989729 CTGTGTGTGCAGAGATCACATGG - Intergenic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964202544 3:154134333-154134355 CTGTGTCTGGGGAGGACTCTGGG + Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
968576310 4:1367842-1367864 GTGTGTGTGGGGTGGGGACAGGG - Intronic
968747498 4:2367915-2367937 CTGGGTAAGGGGAGGGCACCTGG - Intronic
968752054 4:2395444-2395466 CTGTGTGTGGGGAGAGCGTTGGG - Intronic
968819411 4:2838237-2838259 CACTGTGAGGGGAGGGCACTTGG - Exonic
968833407 4:2945278-2945300 GTGTTTGCGGGGAGGGCATATGG - Intronic
968887257 4:3341430-3341452 GGGTATGTGGGGAGGGGACAAGG + Intronic
968887322 4:3341593-3341615 GAGGGTGTGGGGAGGGGACAAGG + Intronic
968887381 4:3341738-3341760 GAGGGTGTGGGGAGGGGACAAGG + Intronic
968894665 4:3392127-3392149 CTGAGTGTGGGGAGAGCTCAAGG + Intronic
968984584 4:3868219-3868241 CTGCGTGTGTGGAGCTCACAGGG + Intergenic
969532592 4:7738089-7738111 ATGTTTGAGGGGAGGGGACACGG + Intronic
970279758 4:14441811-14441833 CTGTTTCTGGGGAGGCCTCAGGG - Intergenic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
971291532 4:25345921-25345943 CTGTCTGTGCTCAGGGCACAGGG + Intronic
971672664 4:29583214-29583236 CTGCTTCTGGGGAGGGCTCAGGG + Intergenic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973605453 4:52582895-52582917 CAGTGTGTGTTGGGGGCACAGGG + Intergenic
974000496 4:56506508-56506530 CTGCGTGTGGGGAGGGTTCGGGG - Intronic
974194184 4:58550210-58550232 CTGTGTGTGAGTAGGGCATGAGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
979029159 4:115618427-115618449 CAGTGTGTGTGGAGATCACATGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980987557 4:139710535-139710557 CGGGGTGGAGGGAGGGCACAGGG - Intronic
982337173 4:154253107-154253129 CGGGGTGTGGGGAGAGCCCAGGG + Intronic
984152452 4:176151384-176151406 GTGTGTGTGGGGGTGGGACACGG - Intronic
984556163 4:181216466-181216488 CTGTTTGTGGAGTGGCCACAGGG - Intergenic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
985779109 5:1860587-1860609 CTGTGTGTGAGGGGGTCACTGGG + Intergenic
986593132 5:9391948-9391970 ATGTGTGTGGCGGGAGCACAGGG - Intronic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
990305770 5:54492937-54492959 CTGTCTGTGGGGTGAGCAGAAGG - Intergenic
991258084 5:64637452-64637474 CTGTGTGGAGGGAGGGGACTAGG + Intergenic
991473216 5:66991850-66991872 CTGTCTCTGGTGAGGGCTCATGG - Intronic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
993049674 5:82912176-82912198 CTGTGTGTGGTGAGGCAACTGGG - Intergenic
993152229 5:84175171-84175193 ATGTCAGTGGGGATGGCACAAGG - Intronic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993956828 5:94244337-94244359 TTTTTTGTGGGGAGGGAACAGGG + Intronic
994070027 5:95590361-95590383 CTGAGTGTGGAGAGTGGACAGGG + Intronic
995341952 5:111070473-111070495 CTGGGTGTAGAGAGGGCCCAGGG + Intronic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998378072 5:141704236-141704258 TTGCCTGTTGGGAGGGCACAGGG + Intergenic
998682641 5:144487381-144487403 ATGTGGGTGGTGAGGACACAAGG + Intergenic
998694014 5:144616842-144616864 ATGTGTGTGTGCAGGTCACAGGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998812339 5:145978880-145978902 CTGTGTGTGGGGAGAGGCCCTGG + Intronic
999076320 5:148799127-148799149 CTGTCTGTAGGGAGAGCTCAAGG + Intergenic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1000097533 5:157985026-157985048 CTGTTTGTGGAGAGGGCTCCAGG + Intergenic
1000111806 5:158115164-158115186 ATGTGTTTGGGGAGTGCTCAGGG + Intergenic
1001517743 5:172367628-172367650 CTGAGTTTTGGCAGGGCACAGGG + Intronic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1003256682 6:4481276-4481298 GTGTGAGTGGGGAGAGCACAAGG - Intergenic
1003754547 6:9102057-9102079 CTGTGTGTGCAGAGATCACATGG + Intergenic
1004246813 6:13985872-13985894 CTGTGTGTGCAGAGATCACATGG - Intergenic
1004367018 6:15021243-15021265 GTGTGTGTGTGGCAGGCACATGG - Intergenic
1006402685 6:33826932-33826954 CTGAGTGTAGGTAGGACACATGG + Intergenic
1006669180 6:35719036-35719058 CTGTGAGTTGGGAGGGGGCAAGG - Intronic
1006809762 6:36812267-36812289 CTGGGTGTGGTGAGGGCCAAGGG + Intronic
1006991961 6:38222598-38222620 CATTGTGAGGGGAGGGCACCAGG + Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007264915 6:40588746-40588768 ATGTGTGTAGAGAGGACACAGGG - Intergenic
1007753667 6:44084835-44084857 CTTTGTGAGTGGATGGCACAGGG - Intergenic
1011540938 6:88427891-88427913 CTGGGTCTGGGGAGGGAGCAGGG - Intergenic
1011694088 6:89896463-89896485 CTGTGTGTGGCTGGAGCACAGGG + Intergenic
1012602452 6:101114885-101114907 CTTTGTGTGGGTAAGGCAAAGGG - Intergenic
1012925512 6:105263357-105263379 CTGTGAGAGGGGAGGACACAGGG + Intergenic
1012967555 6:105691249-105691271 ATGTGTGTGGGGAGGGGTCAGGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013974370 6:116060189-116060211 CTGTGACTGGGGAGAGCAAAGGG + Exonic
1016452158 6:144194497-144194519 CTTGGTGAGGGGAGGGGACATGG + Intergenic
1016669170 6:146681352-146681374 CTGTTTCTGGGGAGGCCTCAGGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018628792 6:165805019-165805041 CTGGGCGTGGGGCGAGCACAGGG + Intronic
1018789039 6:167131912-167131934 CTGATTGTGGGGGTGGCACATGG - Intronic
1018861902 6:167717082-167717104 CTGTTTGTTGGCAGGGGACAGGG - Intergenic
1018906559 6:168079279-168079301 CTGGGTGTGTGGAGGGCGCCAGG + Intronic
1019012558 6:168853576-168853598 TTGTATGTTGGGAGGGCACAGGG + Intergenic
1019303159 7:319320-319342 CTATTTTTGGCGAGGGCACATGG + Intergenic
1019385712 7:754943-754965 CTGGGTGTGGGGAGGGCCTGCGG - Intronic
1019604500 7:1901750-1901772 CTGTGGGTGGGCTGGGCTCAAGG - Intronic
1022248063 7:28580372-28580394 GTGTGTGTGGGGGGGGCATGTGG + Intronic
1022472723 7:30691579-30691601 CTTTGTGGGGAGTGGGCACAGGG + Intronic
1022495354 7:30849882-30849904 CTGTGTTTTGAGTGGGCACATGG - Intronic
1022522840 7:31019140-31019162 CTGGGTGTGGGTAGGGCAGGAGG + Intergenic
1023071521 7:36439598-36439620 CTGTGTGTGGGGTGGGATAAAGG + Intronic
1023580206 7:41673539-41673561 ATGTGGGAGGGGAGGACACATGG + Intergenic
1024158741 7:46652527-46652549 ATGTGTCTGGTGAGGGCAGATGG - Intergenic
1024505576 7:50158772-50158794 CCGTGCCTGGGGAGGGCCCAGGG - Intronic
1024561583 7:50649402-50649424 CTCTGTGTGGAGACGCCACAGGG + Intronic
1026082033 7:67230483-67230505 TTGTGTTTGAGGAGGGTACAAGG - Intronic
1026361150 7:69601121-69601143 GTGTGTGGGGGGTGGGGACAGGG - Intronic
1026443148 7:70460968-70460990 CTGGGTTTGGGAAGGGCAGAAGG + Intronic
1026444996 7:70476360-70476382 TTGGGAGTGGGCAGGGCACAAGG - Intronic
1026695033 7:72583506-72583528 TTGTGTTTGAGGAGGGTACAAGG + Intronic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1028516041 7:91679282-91679304 CTGTGTGTGCAGAGATCACATGG - Intergenic
1028916772 7:96268061-96268083 CTGTCTGTGAGGTGGGCACCGGG - Intronic
1029375485 7:100174650-100174672 CTGAGTATGGGCAGGGCCCAGGG - Intronic
1029465352 7:100721373-100721395 CTGGGGGTGGGGTGTGCACACGG + Intronic
1029635981 7:101784040-101784062 ATGTGGGTGGGCAGGGGACAGGG + Intergenic
1030110161 7:106020041-106020063 GTGTGTGTGGGGGGGGGGCAAGG + Intronic
1030888702 7:114970655-114970677 CAGTGAGTGGGGAAGGCACTTGG + Intronic
1031522862 7:122787698-122787720 CTGAGTGTGGGGCAGGGACAAGG + Intronic
1032079161 7:128850051-128850073 CAGTGTGTGGGGCGGGCGCCGGG - Exonic
1032155691 7:129465788-129465810 CTGTCTGTGAGGAGACCACAGGG + Intronic
1032440015 7:131935404-131935426 CTCTGTGTGGGCAGGGCATGAGG + Intergenic
1032547451 7:132755720-132755742 CTGTGGGTGGGGTTGGCACCAGG - Intergenic
1032626949 7:133601715-133601737 CTGTGGCTGGTGAGAGCACAGGG - Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034298339 7:149993662-149993684 CTGTGGGTGGGGATTGCAAAGGG - Intergenic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1034618864 7:152441459-152441481 CTGTGAGTGGGGAAAGCACAAGG - Intergenic
1034807675 7:154103120-154103142 CTGTGGGTGGGGATTGCAAAGGG + Intronic
1034975197 7:155444850-155444872 CAGAGTGTGTGGAGGACACAAGG + Intergenic
1035296778 7:157871981-157872003 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296784 7:157872007-157872029 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296796 7:157872054-157872076 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296809 7:157872126-157872148 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296831 7:157872228-157872250 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296842 7:157872280-157872302 GCGTGTGTGGGGAGGACACTGGG - Intronic
1035296848 7:157872306-157872328 GGGTGTGTGGGGAGGACACTGGG - Intronic
1035296856 7:157872332-157872354 GTGTGTGGGGGGAGGACACTGGG - Intronic
1035296864 7:157872358-157872380 GTGTGTGGGGGGAGGACACTGGG - Intronic
1035296872 7:157872384-157872406 GTGTGTGGGGGGAGGACACTGGG - Intronic
1035296884 7:157872436-157872458 GCGTGTGTGGGGAGGACACTGGG - Intronic
1036184140 8:6609815-6609837 CTGTGTGTGGGGGGGGGGCGGGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037710746 8:21353513-21353535 CACTGTCTGGGTAGGGCACATGG - Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1037887494 8:22602492-22602514 CTGAGTGTGGGGAGGGCTCTGGG + Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038644866 8:29352684-29352706 CTCCCTGTGGGGAGGGCAAAAGG + Intergenic
1039424439 8:37474342-37474364 CTGCCTGTGGGGAGCACACAGGG + Intergenic
1041113922 8:54515679-54515701 CTGTGTGTGGTGTTGGCAGAGGG + Intergenic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1041354447 8:56985458-56985480 CTGGGTGTCGGGAGGGGGCAGGG - Intronic
1041360461 8:57047445-57047467 CTAAGTGTGGAGAGGGGACAAGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042672746 8:71282526-71282548 CTGTGTGTGGCGCTGGCAAAAGG - Intronic
1043974390 8:86568417-86568439 CTGGGTGTGGAGACTGCACAAGG - Intronic
1044263910 8:90160595-90160617 CTCTCTGTGGAGAGGGGACATGG + Intergenic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1046780401 8:118208900-118208922 CTGTATGTAGGGAGGGCTCAAGG + Intronic
1047782936 8:128124444-128124466 CTGTGTGTGCTGAGTGCACATGG - Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048307880 8:133296467-133296489 GTGTGTGGGGGGAGGGTCCAGGG - Intronic
1050069127 9:1792011-1792033 CTGGGGGTGGAGTGGGCACAGGG - Intergenic
1050825471 9:9940080-9940102 CTGTATGTGGGGAAACCACAAGG + Intronic
1051168839 9:14297027-14297049 GTGTGTGTGGGCAGGGAGCAGGG - Intronic
1051608340 9:18938358-18938380 CTGTTTCTGGGGAGGCCTCAGGG + Intronic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052998570 9:34564833-34564855 CTGTGGGGGGTGGGGGCACAGGG + Intronic
1054471383 9:65541628-65541650 ATGTGTTCGGGGAGGGAACAAGG - Intergenic
1054861872 9:69962195-69962217 CTGAGTGGGGAGAGGGGACAGGG + Intergenic
1055007070 9:71520125-71520147 ATGTGAGTGGTAAGGGCACATGG - Intergenic
1055208375 9:73761382-73761404 GTGTGTGTGTGGTGGTCACAGGG + Intergenic
1055413446 9:76056394-76056416 CCGTGTGAGGAGAGGGCAAAAGG + Intronic
1055756749 9:79566426-79566448 CTTTTTGTGGGGAGGGAACTTGG - Intergenic
1056300165 9:85232120-85232142 CTGTGTGTTGGAAGGACAGAGGG + Intergenic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1057384967 9:94598908-94598930 AGGGGTGTGGGGAGGGGACAGGG + Intergenic
1057492672 9:95534028-95534050 CCGGGTGTGGTGATGGCACATGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1058345582 9:103957083-103957105 ATGTGTGTGGGAAGGGTAAAAGG - Intergenic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1059246862 9:112856347-112856369 GTGTGTATGGGGAGGGCACGTGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059447586 9:114348490-114348512 CTGTGAGTGGAGAGCGGACAGGG + Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059623634 9:116036557-116036579 CTGTGGGTGGGCAGTACACAAGG - Intergenic
1060424648 9:123494085-123494107 CTTTGAGTGGGCAGGGCTCAGGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061909397 9:133714807-133714829 CTGGGTTTGGGGATGGCCCAGGG + Intronic
1061963946 9:134002934-134002956 CTGGGTGTGGGGTGGGCTCCTGG + Intergenic
1062353235 9:136149219-136149241 CTGCCTGTGGGGACGGCTCAAGG - Intergenic
1203377852 Un_KI270442v1:391523-391545 GTGTGTGTGGTGTGTGCACATGG - Intergenic
1185589535 X:1265271-1265293 TTGTGTGTGGAGAGACCACATGG - Intergenic
1185877855 X:3714198-3714220 CTTTTTGGGGGGAGGGCAGAGGG - Intergenic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186392879 X:9178966-9178988 CTGTGTGTGCAGGGGTCACATGG - Intergenic
1186664683 X:11705098-11705120 CTGTGTGTGGGGAGAGAGCCAGG + Intergenic
1187679606 X:21753750-21753772 TTGTTTGCTGGGAGGGCACATGG + Intronic
1188621167 X:32225801-32225823 CTGTTTCTGGGGAGGCCTCAGGG - Intronic
1189263127 X:39692202-39692224 ATGTGTGTGGGGAGGGACCCAGG - Intergenic
1190133472 X:47772549-47772571 GTGTTTGTGGGCAGGGAACATGG + Intergenic
1190606168 X:52145469-52145491 GTGGGTGGGGGGAGGGGACAGGG - Intergenic
1192264984 X:69531762-69531784 GAGTGTGTAGGCAGGGCACAGGG - Exonic
1194966581 X:100295647-100295669 ATGTGTGTGGTGATGGCAAAAGG - Exonic
1195389130 X:104342766-104342788 CCGTGTCTGGGGAGGTCACCAGG + Intergenic
1195526759 X:105900037-105900059 CAGAGTGTGGAAAGGGCACAGGG - Intronic
1195991889 X:110691205-110691227 GTGGGTCTGGGGAGGGAACAGGG - Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1197693205 X:129523675-129523697 CTGAGTGTGGGGCGCGGACAGGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198620229 X:138499663-138499685 ATGGGTTTGGGGAGGGCAAAGGG + Intergenic
1198953767 X:142103773-142103795 GTGTCTGTTGGGAGAGCACATGG + Intergenic
1200105317 X:153708854-153708876 CTGTGTGCTGGGAGGCTACAGGG - Intronic
1200965039 Y:9027947-9027969 GTGTGTGTGGGAAGGGCAGGGGG - Intergenic
1201320509 Y:12693581-12693603 CTTTCAGTGGGGAGGGGACAAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202148072 Y:21820832-21820854 GTGTGTGTGGGAAGGGCAGGGGG + Intergenic