ID: 1181699557

View in Genome Browser
Species Human (GRCh38)
Location 22:24612608-24612630
Sequence CACCTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62723
Summary {0: 1, 1: 46, 2: 1250, 3: 12665, 4: 48761}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181699557_1181699563 17 Left 1181699557 22:24612608-24612630 CCTCCGTCTCCTGGATTCAGGTG 0: 1
1: 46
2: 1250
3: 12665
4: 48761
Right 1181699563 22:24612648-24612670 TCCTGAGTAGCTGATATTACAGG 0: 45
1: 4475
2: 68407
3: 158752
4: 239105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181699557 Original CRISPR CACCTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr