ID: 1181707438

View in Genome Browser
Species Human (GRCh38)
Location 22:24657551-24657573
Sequence GCTGAGGCCCAGAAATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181707437_1181707438 -8 Left 1181707437 22:24657536-24657558 CCTGCTGCAGCTGTGGCTGAGGC No data
Right 1181707438 22:24657551-24657573 GCTGAGGCCCAGAAATGTGAAGG No data
1181707434_1181707438 2 Left 1181707434 22:24657526-24657548 CCTCTGGGCACCTGCTGCAGCTG No data
Right 1181707438 22:24657551-24657573 GCTGAGGCCCAGAAATGTGAAGG No data
1181707431_1181707438 30 Left 1181707431 22:24657498-24657520 CCGGGAGGTCTGGGATCTCTGGT No data
Right 1181707438 22:24657551-24657573 GCTGAGGCCCAGAAATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181707438 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG Intergenic
No off target data available for this crispr