ID: 1181709610

View in Genome Browser
Species Human (GRCh38)
Location 22:24674218-24674240
Sequence CTTCCAGTGTCTTGGAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181709610_1181709617 29 Left 1181709610 22:24674218-24674240 CCCCTTCTCCAAGACACTGGAAG No data
Right 1181709617 22:24674270-24674292 GCTCTGTAATCTCTACCTGGAGG No data
1181709610_1181709616 26 Left 1181709610 22:24674218-24674240 CCCCTTCTCCAAGACACTGGAAG No data
Right 1181709616 22:24674267-24674289 TCTGCTCTGTAATCTCTACCTGG No data
1181709610_1181709618 30 Left 1181709610 22:24674218-24674240 CCCCTTCTCCAAGACACTGGAAG No data
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181709610 Original CRISPR CTTCCAGTGTCTTGGAGAAG GGG (reversed) Intergenic
No off target data available for this crispr