ID: 1181709611

View in Genome Browser
Species Human (GRCh38)
Location 22:24674219-24674241
Sequence ACTTCCAGTGTCTTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 3, 1: 0, 2: 0, 3: 18, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181709611_1181709617 28 Left 1181709611 22:24674219-24674241 CCCTTCTCCAAGACACTGGAAGT 0: 3
1: 0
2: 0
3: 18
4: 223
Right 1181709617 22:24674270-24674292 GCTCTGTAATCTCTACCTGGAGG No data
1181709611_1181709616 25 Left 1181709611 22:24674219-24674241 CCCTTCTCCAAGACACTGGAAGT 0: 3
1: 0
2: 0
3: 18
4: 223
Right 1181709616 22:24674267-24674289 TCTGCTCTGTAATCTCTACCTGG No data
1181709611_1181709618 29 Left 1181709611 22:24674219-24674241 CCCTTCTCCAAGACACTGGAAGT 0: 3
1: 0
2: 0
3: 18
4: 223
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181709611 Original CRISPR ACTTCCAGTGTCTTGGAGAA GGG (reversed) Intergenic
901460390 1:9387685-9387707 TCTTCCCGTGTGTTGGGGAAGGG - Intergenic
904843635 1:33391222-33391244 AGAACCACTGTCTTGGAGAATGG + Intronic
904898638 1:33838054-33838076 ACTCCCAGAGCCTTGGAGACAGG - Intronic
905005299 1:34704863-34704885 AATTCCACAGTCTTGGAGATGGG + Intergenic
906044629 1:42818364-42818386 ACTGCCAGTGGCTAGGAGAGAGG + Intronic
907086515 1:51680329-51680351 ACATTCAGTGTCATGGGGAAAGG - Intronic
908360015 1:63359650-63359672 ACATCCAGTGTCTGTGTGAATGG - Intergenic
909762026 1:79301622-79301644 ACTTTCAGTGTCTGGGAGAGAGG - Intergenic
911794107 1:102054730-102054752 GCATGAAGTGTCTTGGAGAAGGG + Intergenic
912337021 1:108872716-108872738 TTTTCCAGTGTGTTGGAGTAGGG - Intronic
913077356 1:115352314-115352336 ACTGCAGGTGTCTTGGGGAAGGG - Intergenic
916893110 1:169132919-169132941 ACTTTTAGTGTCTTTGGGAAGGG - Intronic
917705819 1:177633674-177633696 ATTTACAGTGTGTTGGAAAAGGG + Intergenic
920552177 1:206871615-206871637 ACTCTCACTGTCTTGGACAAGGG + Intergenic
921422661 1:214966472-214966494 ACGTGAACTGTCTTGGAGAAGGG + Intergenic
922096286 1:222445762-222445784 ATCTCCAGTGTGTTGGAGATGGG - Intergenic
922634369 1:227151163-227151185 GCTTCCAGGGTCTAGGGGAAGGG - Intronic
924132692 1:240928273-240928295 AAATCCAGTGTGTTGGAAAAGGG - Intronic
924825567 1:247534451-247534473 ACTGCCAGAGTCATGCAGAAGGG + Intronic
924948266 1:248860333-248860355 AATACCAGTGGCTTGGAGTAGGG - Intergenic
1063110952 10:3037206-3037228 ACTTTCAGTGTCTAAGAGGAGGG + Intergenic
1064144755 10:12818773-12818795 CCTTCCAGTGTGATGGTGAAGGG - Intronic
1064332551 10:14407416-14407438 GCTTCCAGAGCCTTGAAGAAAGG + Intronic
1064574494 10:16730443-16730465 AAGTGCAGTGTCTTGGACAACGG + Intronic
1065025436 10:21535254-21535276 ACTTCCTGTGGCGTGGAGACGGG + Intronic
1066263674 10:33753913-33753935 GCTTTAAGTGTCTTGGAAAATGG - Intergenic
1069026317 10:63546111-63546133 AGTTCCAGTGTCTTTAACAATGG - Intronic
1069239028 10:66115412-66115434 ATTTTCAGTGTCTTGGAAAGTGG + Intronic
1070525300 10:77291158-77291180 ACTTCAATTGACTTGCAGAAAGG - Intronic
1071926451 10:90415327-90415349 ACTTCCTGTTTCATGGATAAAGG + Intergenic
1073611983 10:104953338-104953360 GCTTCCAGTTCCTTGCAGAATGG - Intronic
1076526551 10:131115911-131115933 ACTCCCAGGGTCCTGGAGAGGGG - Intronic
1078360493 11:10664154-10664176 ACTTCCAGTTCCTCGGAGAGGGG - Intronic
1079977877 11:27114946-27114968 ATTGCCAAGGTCTTGGAGAAGGG + Intronic
1080678535 11:34450852-34450874 GCTTCCAGTATGTTGGAGGAAGG - Intronic
1087740646 11:101883250-101883272 ACTTTCTGTGTCTTTGGGAAGGG - Intergenic
1088587027 11:111368349-111368371 ACTTAGAGTGTCTGGGACAAGGG - Intronic
1088591022 11:111403372-111403394 AATTACAGTGTCATGGTGAAGGG - Intronic
1088805183 11:113345873-113345895 TTTTCCAGTGTCTCGGAGAGTGG + Intronic
1089209553 11:116791056-116791078 TCTTTCAGGGTCCTGGAGAAGGG + Exonic
1090956036 11:131513512-131513534 ATTTCAAGTTTCTTGGAGACAGG + Intronic
1092014731 12:5149325-5149347 TCTTCCATTGTCCTGGAGCATGG - Intergenic
1092101795 12:5889608-5889630 ACTGCCAGTCTCTTGGAGCCAGG + Intronic
1092563204 12:9637826-9637848 GCTTCCAGTTTCATGGATAAAGG - Intergenic
1093513862 12:19961947-19961969 ACTTGCTGTATCTTGGAGCAAGG + Intergenic
1094250054 12:28349425-28349447 ACTGTCAGTGTCTTTGAGCAGGG + Intronic
1097157621 12:57024391-57024413 TCTTCAAGTCTCTTGGAGAGGGG - Intronic
1097476793 12:60067676-60067698 ATTTTCAGTGTCTGGGAGAGAGG + Intergenic
1099273820 12:80549911-80549933 TCTCCCAATGTTTTGGAGAAGGG - Intronic
1102365623 12:112331837-112331859 AATTCCAGTGTCAGGGACAAGGG + Intronic
1102703917 12:114864695-114864717 CCTTCCATTGTCATGGAGGAGGG + Intergenic
1102777765 12:115535423-115535445 TCCTCCAGGGTCTTGCAGAATGG - Intergenic
1106302030 13:28475894-28475916 ACTTCCAGAATGATGGAGAAAGG + Intronic
1106982980 13:35312124-35312146 GATTCCAGTTTCTTGGGGAAAGG + Intronic
1107381425 13:39860688-39860710 ACTGCCAGTTTCTTGGAGGCTGG + Intergenic
1110301701 13:73936482-73936504 TCTTCCTGTGTATTGGAGGAAGG - Intronic
1111476088 13:88749897-88749919 ACGTCCATCGTGTTGGAGAAAGG - Intergenic
1115296653 14:31835134-31835156 ACGTCCAGGATCTAGGAGAAAGG + Intronic
1115434888 14:33361075-33361097 ACTACCAGATTGTTGGAGAAAGG + Intronic
1116186966 14:41609590-41609612 AATTCTAATGTCTTCGAGAAAGG - Intronic
1116477082 14:45352414-45352436 AATGCCAGTTTCTTGAAGAAAGG - Intergenic
1117114465 14:52495593-52495615 ACTTTGTGAGTCTTGGAGAAAGG + Intronic
1117472534 14:56060748-56060770 ACTACCTGTGTTTAGGAGAAAGG - Intergenic
1119065169 14:71518431-71518453 ACTTCCAGGTTAATGGAGAAAGG - Intronic
1120039742 14:79739077-79739099 ATTTCCAGTGTCTTTGAAATGGG - Intronic
1121424530 14:93840134-93840156 TCTTCCATTGTCTTCCAGAAAGG - Intergenic
1121496180 14:94392668-94392690 ACTTCCTGTGTGTTGGGGAGGGG + Intergenic
1121545704 14:94761882-94761904 CCTCCCTGTTTCTTGGAGAAGGG + Intergenic
1122281671 14:100626670-100626692 TCTTCCATTTTCTTGAAGAATGG + Intergenic
1127488669 15:59441730-59441752 ACAACCAGTGTCATGGAGACAGG - Intronic
1128132341 15:65237262-65237284 ACTTCCTGTGTCTGGGAGGAGGG - Intronic
1131579072 15:93623299-93623321 ACTTCCAGTGTTTTCAACAAAGG + Intergenic
1132086742 15:98914466-98914488 ACTTACAGGGTCATGGAGATGGG - Intronic
1133453072 16:5919779-5919801 ACTTCCAGGGCTGTGGAGAAGGG - Intergenic
1134777933 16:16869028-16869050 ATTTCTTGTGTCTGGGAGAAGGG - Intergenic
1135426491 16:22341318-22341340 ACTTCCAGTGTTTTGTTGAATGG - Intergenic
1136564996 16:31064452-31064474 ACTTCCATGGCCTTGGTGAACGG + Exonic
1138744653 16:59349001-59349023 ACTTACAGAGTCTAGGAGAATGG - Intergenic
1141016649 16:80457170-80457192 ACTTGTAGTGACATGGAGAACGG + Intergenic
1143419699 17:6779138-6779160 AATTCCAGAATCTTGGGGAAAGG + Intronic
1143932853 17:10448769-10448791 ACTTCCAGGTTCTGGCAGAATGG - Exonic
1144725140 17:17498067-17498089 TCTGCCAGAGTCTGGGAGAAGGG + Intergenic
1146122206 17:30205715-30205737 ACCTCCAGGGTCTGGGGGAAAGG + Intronic
1148554386 17:48569526-48569548 AAATCCAGGGGCTTGGAGAAGGG - Intronic
1150396630 17:64827284-64827306 ATTGCCAGTGGCTGGGAGAAAGG + Intergenic
1150654581 17:67031540-67031562 ACTGCCAGAGTCTTGGAGAGAGG - Exonic
1150993721 17:70291666-70291688 ACTTTCATTGTCTTAGAAAAAGG + Intergenic
1155615338 18:27715501-27715523 ACATCCAGTGGCAGGGAGAAGGG + Intergenic
1157026277 18:43847743-43847765 ACTTCCTGTTTCTAAGAGAAAGG + Intergenic
1163225942 19:15961375-15961397 CTTTGCACTGTCTTGGAGAAGGG + Intergenic
1163759317 19:19126254-19126276 ACCTCTAGTGTCTTGATGAATGG - Intronic
1164915694 19:32050712-32050734 AATTCCACTGTCTTTTAGAAAGG - Intergenic
1165358463 19:35318822-35318844 ACTTCCTCTCTCTTGGACAATGG - Intergenic
925829686 2:7882211-7882233 AGTTCCATTGTGTTGGAGATGGG + Intergenic
929640412 2:43572634-43572656 ACTTTCAGTAGCTTGAAGAAAGG + Intronic
933004544 2:76974042-76974064 ATTTCCAGTTGCTTAGAGAAAGG + Intronic
933131936 2:78682615-78682637 ACGTGAAGGGTCTTGGAGAAAGG + Intergenic
933668716 2:84986484-84986506 ACATGCAGTGTGTTGGAGAGAGG + Intronic
935101918 2:100004234-100004256 ACTTCCAGTGAGGTAGAGAAGGG - Intronic
935458252 2:103295826-103295848 ACTTCCAGGGCTTTGGAGACAGG - Intergenic
938273358 2:129994045-129994067 TCTCTCAGCGTCTTGGAGAAGGG - Intergenic
938442861 2:131352056-131352078 TCTCTCAGCGTCTTGGAGAAGGG + Intronic
940714273 2:157201698-157201720 ATTTCCAGGGTTTTGGAGGAAGG + Intergenic
940862968 2:158789250-158789272 AATCCCAGTGTTTTGGAGAGAGG + Intergenic
940920622 2:159302218-159302240 ATTTCCAGGGACTTGGAGAAAGG + Intergenic
941466808 2:165837918-165837940 AAGTCCTGTGTCTTGCAGAAGGG + Intergenic
942537110 2:176976640-176976662 ATTTTCAGTCTCTTGGAAAATGG - Intergenic
944126777 2:196303023-196303045 ACATCCAGTGTCATGCTGAATGG - Intronic
944678535 2:202054814-202054836 ACTTCCAGTCTCTTGCTGAGAGG + Intergenic
946869646 2:224074273-224074295 ACTTCCTGTGTCTTGCTAAATGG - Intergenic
1168900620 20:1361451-1361473 GCTTCCAGTGTTGTTGAGAAGGG - Intronic
1170795856 20:19546220-19546242 ACATCCTGCGTCCTGGAGAAGGG - Intronic
1170886145 20:20341157-20341179 ACTTTAAGTGTCTTGGAACAGGG - Intronic
1170922819 20:20694994-20695016 ACTTCCAGGGCGTTCGAGAAAGG + Intronic
1171352111 20:24511205-24511227 AGTTAAAGTGTCATGGAGAAAGG - Intronic
1172722241 20:37008245-37008267 TCTTCTTGTGTCTTTGAGAAAGG + Intronic
1173071763 20:39775038-39775060 ACTTCCAGGGCCTGGGAGCATGG + Intergenic
1173301731 20:41809560-41809582 ATTTCCAGTGACTGGGAGAGGGG + Intergenic
1175850998 20:62092955-62092977 TCTTCCACTGTCTTGAAGAATGG - Intergenic
1179324491 21:40327569-40327591 ACTTCCAGTGACATGTTGAATGG + Intronic
1179341634 21:40516403-40516425 ACTGCCAGTGTTTTGGGGGAGGG - Intronic
1181504611 22:23343988-23344010 ACTTCCAGTGTCTTGGAGAAGGG - Intergenic
1181655727 22:24296601-24296623 ACTTCCAGTGTCTTGGAGAAGGG - Intronic
1181709611 22:24674219-24674241 ACTTCCAGTGTCTTGGAGAAGGG - Intergenic
1183895766 22:40967456-40967478 ACTTCCACTTTCTTTGGGAAAGG - Intronic
1184050728 22:42002103-42002125 ACTGCTTGTGTGTTGGAGAAAGG + Intronic
952235193 3:31472229-31472251 AATAGCAGTGGCTTGGAGAAGGG - Intergenic
953630354 3:44610350-44610372 ATTGCCAGGGTCTTGGGGAATGG + Intronic
955340302 3:58120287-58120309 GCTCTCAGTGTCTTGGGGAAAGG - Intronic
955613235 3:60779838-60779860 ACTTCCTGTTTCATGGATAAAGG + Intronic
957677948 3:83394224-83394246 TCATCAAGGGTCTTGGAGAAGGG + Intergenic
957778400 3:84786563-84786585 ACTCCCAGTTTCTGGGAAAATGG - Intergenic
959484737 3:106913652-106913674 TCTTCCACTGTCTTGATGAATGG + Intergenic
963715957 3:148804212-148804234 ACTTGCAGGGTTTTGGGGAAAGG + Intronic
964521527 3:157574379-157574401 ATTTACAGTCTCTTGGAGTAGGG + Intronic
965597811 3:170425203-170425225 ACAGCAAGTGTCTAGGAGAAGGG - Intronic
966363353 3:179153643-179153665 ATCTCCAGTGTTTTGGATAAGGG + Intronic
969309182 4:6342762-6342784 ATTTCCAGTGCTTCGGAGAAAGG + Intronic
970098967 4:12498545-12498567 ACTTTTAGTGTACTGGAGAAAGG + Intergenic
971133912 4:23845626-23845648 GCTCCTAGTTTCTTGGAGAAAGG - Intronic
975084427 4:70320585-70320607 ACTTTCAGTTGCTTGTAGAAAGG - Intergenic
976076250 4:81302296-81302318 CCTTCCAGTGCCCTGGAGCATGG - Intergenic
976907897 4:90263028-90263050 ACATGAAGGGTCTTGGAGAAGGG - Intronic
978328978 4:107590540-107590562 GTTTCCAGGGTCTTGGGGAAGGG - Intronic
979361027 4:119765244-119765266 TCTTCCCTTGTCTTGAAGAACGG - Intergenic
979736965 4:124098706-124098728 AGTTAGAGTGTCTTGCAGAATGG - Intergenic
981585775 4:146300550-146300572 TCCTCCAGTACCTTGGAGAAGGG - Intronic
981592731 4:146382409-146382431 ACTCCCAGGGGCTGGGAGAAGGG + Intronic
982089822 4:151870838-151870860 CTTTCCCGTGTCTTGGAGAAAGG - Intergenic
982092968 4:151896498-151896520 ACTTCCTGTGTCTTGTTAAATGG - Intergenic
982644420 4:158005364-158005386 ACTTACAGTGTCAGGGAAAATGG + Intergenic
985364913 4:189218797-189218819 ATTTTCAGTGTCTTGAAAAATGG + Intergenic
985849556 5:2378776-2378798 ACTTCAGGTGTGTTAGAGAATGG + Intergenic
986134518 5:4962439-4962461 ACTTCCAGTGAGTTGTAGAGGGG - Intergenic
988501019 5:31783844-31783866 GCTTCCAATTTCCTGGAGAAAGG + Intronic
988787134 5:34575459-34575481 ACCTCCAGAGCCTTGGAGATGGG - Intergenic
988844366 5:35113668-35113690 ACTTCCAGTCTCCTGAAGAGAGG + Intronic
990073823 5:51817819-51817841 ACTTCATGTGTCCTGGAGATAGG + Intergenic
990200426 5:53366694-53366716 ACTTCCAGGTTCATGGGGAATGG + Intergenic
990725929 5:58754559-58754581 ACTTTCAGTGTGTTGGGGAGTGG - Intronic
991014273 5:61914956-61914978 GCTTCCTGTTTCATGGAGAAAGG + Intergenic
994305235 5:98195202-98195224 ACATTCAGTGTCTGGTAGAATGG - Intergenic
994471176 5:100210147-100210169 ACTTCCAGTAGCTGGGAGATGGG - Intergenic
996709253 5:126527782-126527804 ACTTCCATTGACTTGGACAATGG - Intergenic
996791905 5:127302454-127302476 ATTTCCAGGGTCTGGGGGAAGGG + Intronic
998403208 5:141858786-141858808 ACTGCCAAAGTCTTGGAGGATGG - Intronic
1002614210 5:180440468-180440490 ACTTCCAGTTTCAAGGAGGAAGG + Intergenic
1002977452 6:2096290-2096312 ACATCCAGTGTCTTAAAGCAGGG + Intronic
1004255380 6:14058577-14058599 ATTTCCAGTGGCTAGGAGGAGGG + Intergenic
1004313115 6:14563496-14563518 GCATCCAGTGTCTTGGAGCTGGG - Intergenic
1004596750 6:17106164-17106186 ACCTCGAGTGTCTTGTAAAATGG - Intronic
1005013410 6:21356927-21356949 ACTTCCTGTGTCTTGTTAAATGG - Intergenic
1005913943 6:30335632-30335654 ACTTCCAGTTTCATTGAAAATGG - Intronic
1006068172 6:31477570-31477592 ACCTCCATGGACTTGGAGAAAGG + Intergenic
1007783957 6:44270066-44270088 ACTCCCAGTTTCGTGGTGAAGGG - Intergenic
1007907919 6:45482371-45482393 GCATACAGTGTCTGGGAGAAAGG - Intronic
1010725436 6:79327404-79327426 ACTTCCTGTTTGTTGGAGAAAGG - Intergenic
1011728653 6:90236899-90236921 CCTTCCTGAGTCCTGGAGAATGG - Intronic
1013670279 6:112394394-112394416 ATTGCCAGTGACTTGGGGAAGGG - Intergenic
1013675781 6:112460825-112460847 ATTTCAAGTGTTTTGGAAAAGGG - Intergenic
1014284902 6:119486268-119486290 ATTTCCAGGGTCTGGGGGAAGGG + Intergenic
1015573073 6:134642089-134642111 ACTTTCAGAGTCTTGGAGGGTGG - Intergenic
1015700753 6:136033628-136033650 ATTTCCATTGTCATGGGGAAAGG - Intronic
1016609709 6:145974579-145974601 AATTTCAGTGTCTTGGACAAGGG - Intergenic
1017202519 6:151771348-151771370 ATTTCCAGTGCCGTGGACAAAGG - Intronic
1017792533 6:157814050-157814072 AGTTCCAAGTTCTTGGAGAAGGG + Intronic
1018889460 6:167973037-167973059 AATTCGAGTGACTTGGAGGAGGG + Intergenic
1019899575 7:4009558-4009580 ATTTCCAGTGACATGGATAATGG - Intronic
1021874338 7:25034562-25034584 ATTGCCAGGGTCTTGGGGAAAGG - Intergenic
1021884931 7:25129088-25129110 AGTGCCTGTGGCTTGGAGAAGGG + Intergenic
1022029923 7:26483214-26483236 AGTGCCAGTGTGTTGGAGCATGG + Intergenic
1022597821 7:31729602-31729624 ACATCAAGTGTATTGGAGAAAGG + Intergenic
1024566678 7:50687160-50687182 ACTTTTAGTTTCTTGGAAAAAGG + Intronic
1025093227 7:56079786-56079808 GCCTCCTGTGTTTTGGAGAAGGG + Exonic
1028638459 7:93016800-93016822 ACTTGCAGTGTCTAGAAGAGAGG - Intergenic
1029926279 7:104322238-104322260 ACTACCAGCTTCTTGCAGAAAGG - Intergenic
1029965823 7:104739765-104739787 ACTTTCAGTGTCATGGAAGAAGG + Intronic
1030715210 7:112801168-112801190 ACTTCCTGTGTCTTGTTGAACGG - Intergenic
1031282913 7:119827397-119827419 ACTGACAATGTTTTGGAGAAAGG - Intergenic
1031845585 7:126802336-126802358 ATTACCAGAGTCTGGGAGAAGGG - Intronic
1032720758 7:134549320-134549342 TCCTCCAGTGTCCTGGAGCATGG - Intronic
1033518921 7:142140097-142140119 ACTTCCTTTGTCTTTGAGGAAGG + Intronic
1034444756 7:151108121-151108143 ACTTCCAGGGTCTTAGAACATGG + Intronic
1034748492 7:153545355-153545377 ATTGCCAGTATCTTGGAGATGGG - Intergenic
1035702984 8:1651447-1651469 ACTTCCAGTCTCTTGGTGATGGG - Intronic
1035777378 8:2198664-2198686 ACTTCCAATTTCTTGGAAATCGG + Intergenic
1037905428 8:22713522-22713544 CCTTCCAGGCTCTTGGAAAATGG - Exonic
1038325987 8:26573180-26573202 AGTTTCAGGGGCTTGGAGAAGGG + Intronic
1039105774 8:33987982-33988004 CATCCCAGTGTCTTGGTGAATGG - Intergenic
1041836501 8:62222747-62222769 ATTTCCAGTATCTGGGAAAAGGG + Intergenic
1042336379 8:67634156-67634178 AAATCCAGTGACTTGGAGAAAGG - Intronic
1043661700 8:82751068-82751090 ATTTCTATTGTCTGGGAGAAAGG + Intergenic
1044073057 8:87785896-87785918 ACTTCCAGAGACTTGTTGAATGG - Intergenic
1044154382 8:88825269-88825291 ATTTCCAATGTTTAGGAGAAAGG + Intergenic
1044397612 8:91731278-91731300 AGTTCCAGAGTCTTAGATAAAGG + Intergenic
1045058011 8:98385647-98385669 AATTCCAGGCTCTTGGAGCAGGG - Intergenic
1045493922 8:102692154-102692176 ACTGACAGTTGCTTGGAGAATGG - Intergenic
1045818407 8:106304999-106305021 ACTTTAAGTGTCATGTAGAAAGG - Intronic
1049676569 8:143891892-143891914 AAATCCAGTGCTTTGGAGAATGG + Intergenic
1050112182 9:2228376-2228398 ACTTCCTTTGTTTTGAAGAAGGG - Intergenic
1050363556 9:4853821-4853843 ACTTCCACAGTCATGGAAAAAGG - Intronic
1050887658 9:10785873-10785895 ACTTACGGTGTATTGAAGAATGG - Intergenic
1051672761 9:19528728-19528750 GGTTCCAGTGTCCTGGAGAATGG - Intronic
1052636403 9:31111598-31111620 AATACATGTGTCTTGGAGAAAGG + Intergenic
1053154524 9:35767440-35767462 ACTTGAAGTGGCTTGAAGAATGG - Intergenic
1054726708 9:68659450-68659472 CCATCCAGTGTATTGGAAAATGG + Intergenic
1056702313 9:88920937-88920959 ATTTCCAGTGTCTTGGATGGGGG + Intergenic
1057892991 9:98883439-98883461 ATTTCCAGGGCCTTGGAGGAAGG - Intergenic
1058160029 9:101559924-101559946 ACTTCCAGTGCCATGTTGAATGG + Intronic
1059030952 9:110695491-110695513 ACCATCAGTGTCTTGGATAAAGG + Exonic
1059406191 9:114099342-114099364 AGTCCCAGTGTTGTGGAGAAGGG - Intergenic
1059445681 9:114336541-114336563 ACTACCAGTCACTAGGAGAAAGG + Exonic
1188790560 X:34404095-34404117 ACGTGAAGGGTCTTGGAGAAGGG - Intergenic
1189711497 X:43817433-43817455 ACTGACAGTGGCTTGGAGCAGGG - Intronic
1192523903 X:71824963-71824985 ACACCCAGTCTCTTGGAGATGGG - Intergenic
1193984717 X:88226939-88226961 ACTTCCAGTATGATGGTGAATGG - Intergenic
1194204217 X:90992787-90992809 CCTTCCTGTGAATTGGAGAATGG - Intergenic
1194809893 X:98376467-98376489 ACTTCCCGTTTCATGGATAAAGG - Intergenic
1195387154 X:104324227-104324249 TCTGACAGTGTCTTGGAGGAGGG - Intergenic
1196512915 X:116533179-116533201 ACTTCCAGGGACTTGGTGAATGG - Intergenic
1197179393 X:123518011-123518033 ACTACCAGAGTCTTTAAGAAGGG + Intergenic
1198387466 X:136143518-136143540 ACTTCCAGTTTCTTGGAACATGG - Intergenic
1200550056 Y:4568225-4568247 CCTTCCTGTGAATTGGAGAATGG - Intergenic
1201569459 Y:15398713-15398735 ATTTGCAGTGTCTTAGGGAATGG + Intergenic