ID: 1181709612

View in Genome Browser
Species Human (GRCh38)
Location 22:24674220-24674242
Sequence CACTTCCAGTGTCTTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 3, 1: 0, 2: 2, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181709612_1181709617 27 Left 1181709612 22:24674220-24674242 CCTTCTCCAAGACACTGGAAGTG 0: 3
1: 0
2: 2
3: 21
4: 226
Right 1181709617 22:24674270-24674292 GCTCTGTAATCTCTACCTGGAGG No data
1181709612_1181709616 24 Left 1181709612 22:24674220-24674242 CCTTCTCCAAGACACTGGAAGTG 0: 3
1: 0
2: 2
3: 21
4: 226
Right 1181709616 22:24674267-24674289 TCTGCTCTGTAATCTCTACCTGG No data
1181709612_1181709618 28 Left 1181709612 22:24674220-24674242 CCTTCTCCAAGACACTGGAAGTG 0: 3
1: 0
2: 2
3: 21
4: 226
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181709612 Original CRISPR CACTTCCAGTGTCTTGGAGA AGG (reversed) Intergenic
901460391 1:9387686-9387708 CTCTTCCCGTGTGTTGGGGAAGG - Intergenic
902112750 1:14096673-14096695 GAGTTCCAGTTTATTGGAGAAGG + Intergenic
903271150 1:22189157-22189179 TGCTTCCATTGTCTTGGGGAAGG + Intergenic
905005298 1:34704862-34704884 CAATTCCACAGTCTTGGAGATGG + Intergenic
905411046 1:37768179-37768201 AACTTTCAGTAACTTGGAGATGG - Intergenic
908157791 1:61373704-61373726 TACTTCCAGCTTGTTGGAGATGG + Intronic
913077357 1:115352315-115352337 CACTGCAGGTGTCTTGGGGAAGG - Intergenic
913973278 1:143433075-143433097 CAGATTCAGTGTCTTGGTGAGGG - Intergenic
914067664 1:144258682-144258704 CATATTCAGTGTCTTGGTGAGGG - Intergenic
914111491 1:144707672-144707694 CATATTCAGTGTCTTGGTGAGGG + Intergenic
914762401 1:150609727-150609749 CACAGCCAGCGTCTTGGACAGGG + Intronic
914831200 1:151172202-151172224 CAGTCCTAGTGTCTGGGAGAAGG - Intronic
916032280 1:160887821-160887843 CATCTCCAGTGACTTGGAGAAGG + Intergenic
919787473 1:201268935-201268957 CACATGCAGCGTCTGGGAGAGGG + Intergenic
921013656 1:211167674-211167696 CACTTCTAGTTTCTAGCAGAGGG + Intergenic
921254844 1:213329934-213329956 CACTTCAGGTTTCTTTGAGAGGG - Intergenic
922096287 1:222445763-222445785 GATCTCCAGTGTGTTGGAGATGG - Intergenic
924228164 1:241940100-241940122 CAAGGCCAGTGTCTAGGAGAAGG - Intergenic
1063062060 10:2566078-2566100 CAGTTCCAATGTCTTTGAAAAGG + Intergenic
1063678100 10:8159817-8159839 CACTTCCTGTGTCATCCAGATGG + Intergenic
1064176604 10:13080777-13080799 CACTTCCTGTGTCAGGGAGGGGG + Intronic
1065025435 10:21535253-21535275 GACTTCCTGTGGCGTGGAGACGG + Intronic
1066441517 10:35444114-35444136 CCCTTCAAGTGTGTTGGAAATGG - Intronic
1068156577 10:53206463-53206485 CACTTCCTCTCTCTTGGAGTGGG + Intergenic
1068369694 10:56096251-56096273 CACTTCCCTTGGCTGGGAGAGGG + Intergenic
1070072018 10:73099048-73099070 CCCTTCCAGGGACTTGGAAAGGG - Intergenic
1070548177 10:77469289-77469311 TCCTTCCAGTTTATTGGAGAAGG + Intronic
1070719122 10:78744364-78744386 CAATCCCAGTGTCTTAGAAATGG - Intergenic
1076302465 10:129438423-129438445 CACTTCCAGTGCCTTGGCTGTGG - Intergenic
1076526552 10:131115912-131115934 AACTCCCAGGGTCCTGGAGAGGG - Intronic
1078360494 11:10664155-10664177 GACTTCCAGTTCCTCGGAGAGGG - Intronic
1079085871 11:17444477-17444499 CTCTGCCAGTCTCTTGGAGGTGG - Intronic
1079290203 11:19181205-19181227 CACTCTCATTGGCTTGGAGATGG - Intergenic
1079309962 11:19356474-19356496 CACTTCCAGTGTCTTGGGGGAGG + Intronic
1081360458 11:42171166-42171188 ATCCTCCAGTGTCATGGAGAAGG - Intergenic
1081508911 11:43747973-43747995 CAGTTCTGGGGTCTTGGAGAGGG + Intronic
1081560077 11:44205581-44205603 CACTCCCAGGGTCTTGGAAGAGG - Intronic
1082074991 11:47969324-47969346 AACTTCCAGCTTCTTGGAAAGGG - Intergenic
1087088532 11:94244480-94244502 CTCTTCCCATGCCTTGGAGAAGG - Intergenic
1087938179 11:104060330-104060352 CTTTTCCACTGTCTTGGACAAGG + Intronic
1088587028 11:111368350-111368372 CACTTAGAGTGTCTGGGACAAGG - Intronic
1089750865 11:120650151-120650173 CCCTTTCAGTGTACTGGAGATGG + Intronic
1092653267 12:10657053-10657075 CACTTCCAGTATCTTCCAGGTGG - Intronic
1093411316 12:18871199-18871221 TATTTCCAGTGCCTTGGACAGGG - Intergenic
1093421598 12:18980431-18980453 AACTTCCAGTGGGTTGGAGATGG - Intergenic
1094250053 12:28349424-28349446 CACTGTCAGTGTCTTTGAGCAGG + Intronic
1094632029 12:32185108-32185130 CTCTACCAGTGGCTTGAAGATGG - Intronic
1096764056 12:53868636-53868658 CACTTCCACTGTCCTGGTCATGG - Intergenic
1097157622 12:57024392-57024414 ATCTTCAAGTCTCTTGGAGAGGG - Intronic
1097396001 12:59075581-59075603 CTCTTCCAGTGTATTCCAGAAGG + Intergenic
1098134142 12:67383795-67383817 CGCTTCCAGGGTCATGGAGCTGG + Intergenic
1098213016 12:68186186-68186208 CTCCCCCAGGGTCTTGGAGAGGG - Intergenic
1099184885 12:79505439-79505461 CACTCCAAGTGTCTTGGAAGTGG + Intergenic
1102360473 12:112283120-112283142 CTCTTTCAGTGTGTTGGAGATGG + Exonic
1102389540 12:112538235-112538257 CACTTCCTGTGTCTGTGACATGG + Intergenic
1102568302 12:113811660-113811682 CACTCCCAGTGACTGGGTGATGG + Intergenic
1103326935 12:120127951-120127973 CACATCCAGGATCTTGGAGAGGG + Exonic
1104597616 12:130130828-130130850 ACCTTTCAGTGTCTGGGAGAGGG - Intergenic
1107320044 13:39176906-39176928 GACTTTCAGTGTCTAGGAGAAGG - Intergenic
1108780685 13:53827576-53827598 CATTTCCAGTGGCCTGGATAAGG + Intergenic
1112432387 13:99361516-99361538 CCCTTCCACTGTCCTGGAGTGGG + Intronic
1113281870 13:108797128-108797150 AACTACCAGTGTGATGGAGATGG + Intronic
1113374341 13:109750360-109750382 CACTTCCATTGTCTGGGATTGGG - Intergenic
1113695400 13:112342508-112342530 CACTTCCCGTGTCTCTTAGAAGG - Intergenic
1114881149 14:26787850-26787872 CACTTCTAATGTCGTGGATAAGG + Intergenic
1116743786 14:48792370-48792392 GACTTCCCTTGGCTTGGAGAGGG - Intergenic
1119416807 14:74476443-74476465 CACCTGCAGGGGCTTGGAGAAGG - Intronic
1119669303 14:76506589-76506611 CACTTCCCTTGTGGTGGAGAAGG + Intergenic
1120039743 14:79739078-79739100 GATTTCCAGTGTCTTTGAAATGG - Intronic
1120480530 14:85043756-85043778 CATTTCCCGAGTGTTGGAGATGG - Intergenic
1121426237 14:93854204-93854226 CACCTCCATTGTCTTGCAGCAGG + Intergenic
1121496179 14:94392667-94392689 CACTTCCTGTGTGTTGGGGAGGG + Intergenic
1121604736 14:95232175-95232197 CAGTGCCAGTGTCTGGGTGAGGG + Intronic
1122893756 14:104745131-104745153 CCCTTCCAGTGTTTTGGGAATGG + Intronic
1124847359 15:33304535-33304557 CATTTCCAGTATCTTTGAGCTGG - Intergenic
1124853155 15:33360724-33360746 CACAGCCAGTGTGTTGGAGTGGG + Intronic
1125456090 15:39860348-39860370 CACTTCCAGTGCCCTGGGCAGGG - Intronic
1126672531 15:51129398-51129420 CACTTCCATTTTGTAGGAGAGGG + Intergenic
1127387398 15:58477664-58477686 CTCCCCCAGTGTCTTAGAGATGG + Intronic
1128053042 15:64680409-64680431 CAGATCCAGGGTCTGGGAGAAGG + Intronic
1128132342 15:65237263-65237285 GACTTCCTGTGTCTGGGAGGAGG - Intronic
1129320094 15:74769916-74769938 AAATTCCAGGATCTTGGAGATGG + Intergenic
1130147183 15:81283018-81283040 CCCTCCCAGTGGCCTGGAGAGGG - Intronic
1130881975 15:88063008-88063030 CACTTTCAGTGCTTTGGGGATGG + Intronic
1131652383 15:94414923-94414945 CACTTCCTGTATCTTTAAGATGG - Intronic
1132086743 15:98914467-98914489 CACTTACAGGGTCATGGAGATGG - Intronic
1133491576 16:6275074-6275096 CACTTACATTGTCTTGCAGTGGG - Intronic
1133609677 16:7421670-7421692 CATTTCCACTGGCCTGGAGATGG + Intronic
1134777934 16:16869029-16869051 CATTTCTTGTGTCTGGGAGAAGG - Intergenic
1139916858 16:70433698-70433720 CCCCTCCAGGGTCTTGGAGTGGG - Intronic
1141533382 16:84661961-84661983 CACCTGCACGGTCTTGGAGAAGG - Exonic
1144675596 17:17159411-17159433 CTCTTACAGTGGCTTGGGGACGG + Intronic
1146168168 17:30608543-30608565 CACAACCAGTGTCTTTGAGGTGG - Intergenic
1146221136 17:31022023-31022045 CACAACCAGTGTCTTTGAGGTGG - Intergenic
1146313377 17:31788358-31788380 CACTTCCAGTGTCTTGCTGTTGG + Intergenic
1147417889 17:40306904-40306926 CACTACCAGTGCCTTGGGGCTGG - Intergenic
1147664198 17:42135667-42135689 AGCATCTAGTGTCTTGGAGAAGG - Intronic
1150354200 17:64469400-64469422 CATTTCCTTTGTTTTGGAGACGG + Intergenic
1150366664 17:64593437-64593459 CACAACCAGTGTCTTTGAGGCGG + Exonic
1151161187 17:72167139-72167161 CACTTTCAAAGTCTTTGAGATGG - Intergenic
1156528247 18:37789233-37789255 CCTTTCCAGGGTCTAGGAGAGGG - Intergenic
1161102722 19:2429267-2429289 CACTTCCAGCGGCTGGCAGAGGG + Exonic
1162416060 19:10538313-10538335 CCCTTCTAGTGTTTGGGAGAAGG - Intergenic
1163239598 19:16052334-16052356 CACGTCCAGCATCTTGGGGATGG - Intergenic
1164858274 19:31542281-31542303 CTCTTCCAGTGTCTTTGAGAAGG - Intergenic
1165051164 19:33142444-33142466 CACTTCCTGGGACATGGAGAAGG + Intronic
925156387 2:1651635-1651657 CACATGCAGAGTCTTGGAGGTGG - Intronic
925829685 2:7882210-7882232 GAGTTCCATTGTGTTGGAGATGG + Intergenic
928855499 2:35798148-35798170 CCCTTCCAGGGTCTTGGAGTAGG - Intergenic
929560202 2:42951834-42951856 CACATCCAATGTCTTGGTTAAGG + Intergenic
931153851 2:59605522-59605544 CATTTCCAGGGGCTTGGAGAGGG - Intergenic
931187970 2:59972131-59972153 CATTTCGAGTTTCTTGGAGATGG + Intergenic
933974195 2:87494810-87494832 CACTGCATGTGTCTTGGACATGG - Intergenic
934177973 2:89594032-89594054 CAGATTCAGTGTCTTGGTGAGGG - Intergenic
934288271 2:91668333-91668355 CAGATTCAGTGTCTTGGTGAGGG - Intergenic
936319629 2:111456014-111456036 CACTGCATGTGTCTTGGACATGG + Intergenic
938273359 2:129994046-129994068 CTCTCTCAGCGTCTTGGAGAAGG - Intergenic
938442860 2:131352055-131352077 CTCTCTCAGCGTCTTGGAGAAGG + Intronic
941466344 2:165831998-165832020 CATTTCCTGTGAGTTGGAGAAGG - Intergenic
944104935 2:196069423-196069445 CACTTACCGTGTAGTGGAGACGG + Intergenic
944148655 2:196533596-196533618 CTTTTCCAGTGTCATGGACAAGG - Intronic
945234852 2:207624950-207624972 CACTTCCAGGGTCGGGGAGACGG - Intronic
946135007 2:217638327-217638349 CACTTCCAGTCTCATGCAGTGGG - Intronic
946354192 2:219174795-219174817 CACTCTCAATGCCTTGGAGAGGG - Exonic
947153707 2:227139168-227139190 CAGATCCAGTGTCTTGCTGAAGG - Intronic
948591940 2:239056050-239056072 CACTCCCAGTGTCTAGAAGCAGG - Intronic
1170795857 20:19546221-19546243 CACATCCTGCGTCCTGGAGAAGG - Intronic
1171045574 20:21807086-21807108 CACTTCCACTGTTTAGCAGATGG + Intergenic
1173301730 20:41809559-41809581 AATTTCCAGTGACTGGGAGAGGG + Intergenic
1173839464 20:46147927-46147949 AACTTCCAGCCTCTTGCAGAAGG + Intergenic
1175109332 20:56635437-56635459 CTCTTCCACTGACTTGGACAGGG + Intronic
1175792145 20:61746432-61746454 CACTTCCAGGGGTGTGGAGAGGG - Intronic
1177776419 21:25572005-25572027 CACTTCCAGTGTTTTTGACTGGG - Intergenic
1178109424 21:29355562-29355584 CAGTTGCAGTGTCTTCCAGAGGG + Intronic
1178568495 21:33712150-33712172 CATTTTCATTGTCTTGGAGTTGG + Intronic
1181504612 22:23343989-23344011 CACTTCCAGTGTCTTGGAGAAGG - Intergenic
1181548449 22:23619747-23619769 TAGCTCCAGTGTCTTGGAAATGG - Intronic
1181548862 22:23624020-23624042 AAGGTCCAGTGTCTTGGAAATGG - Intronic
1181655728 22:24296602-24296624 CACTTCCAGTGTCTTGGAGAAGG - Intronic
1181659973 22:24339206-24339228 CATTTTCAGTCTCTTGGAGCTGG - Intronic
1181709612 22:24674220-24674242 CACTTCCAGTGTCTTGGAGAAGG - Intergenic
1181799809 22:25338097-25338119 AAGCTCCAGTGTCTTGGAAATGG + Intergenic
1182135391 22:27897720-27897742 CAGTACCAGTGTCTTTGAGAAGG - Intronic
1184826588 22:46956797-46956819 CACTTCCTCTGTCTTTCAGATGG + Intronic
950397048 3:12741556-12741578 CACCTCCAATGTCTGGGGGAAGG + Intronic
950797698 3:15523626-15523648 AGCTTCCAGTGGCTTGGAGAAGG + Intergenic
951702339 3:25509029-25509051 CACTGCCTGTCTCCTGGAGAGGG + Intronic
953339789 3:42123729-42123751 CCCTTCTAATATCTTGGAGAGGG + Intronic
953636406 3:44668850-44668872 TTTTTTCAGTGTCTTGGAGATGG + Intergenic
955353177 3:58209188-58209210 CTCTTGCAGTGTTTTGGGGATGG + Intronic
957373914 3:79332679-79332701 CACTGTCAGTGTTTTGGAAATGG + Intronic
957677947 3:83394223-83394245 CTCATCAAGGGTCTTGGAGAAGG + Intergenic
959576544 3:107940487-107940509 AACCTGCAGTGTCTTGGAGTGGG - Intergenic
959835116 3:110909375-110909397 TCCTTTCAGTGTCTTGTAGAGGG - Intergenic
961149669 3:124627192-124627214 CATTTAAAGTGTCTTGGAAATGG + Intronic
962443791 3:135447564-135447586 CACTTCCAGTTTCTTGGGTCTGG - Intergenic
962711848 3:138093684-138093706 CACTTTCATTGTTATGGAGATGG + Intronic
962811946 3:138966543-138966565 CACTTCTAGTATCTAGGAAATGG + Intergenic
963668569 3:148222441-148222463 CACTTCCAGGGTCTTATTGAAGG - Intergenic
967016710 3:185488819-185488841 CACTTCCAGAGTCTGGGAAGTGG - Exonic
969831273 4:9799356-9799378 CAGATTCAGTGTCTTGGTGAGGG + Intronic
970153860 4:13120780-13120802 CACTTCCTGTCTCTAAGAGATGG - Intergenic
971992431 4:33916459-33916481 CAATACCTGTGACTTGGAGAAGG - Intergenic
973925816 4:55736212-55736234 CACTTCCAGTGCCTATGGGAGGG + Intergenic
974166466 4:58211267-58211289 CACTCTCTGTGTTTTGGAGATGG + Intergenic
975695388 4:77007857-77007879 CACTTCCAGTTTCTTGAGGGAGG - Intronic
975954384 4:79820587-79820609 CAGTTCTAGTATCTTGAAGATGG + Intergenic
976907898 4:90263029-90263051 CACATGAAGGGTCTTGGAGAAGG - Intronic
980498738 4:133619989-133620011 CACTTGCAGTGTTTTGGCAAAGG + Intergenic
981735970 4:147950621-147950643 GTCCTCCAGGGTCTTGGAGAAGG + Intronic
981741311 4:148004990-148005012 GGATACCAGTGTCTTGGAGATGG - Intronic
982161487 4:152574379-152574401 CTATTCCAGTGTGTTAGAGATGG + Intergenic
984129243 4:175852484-175852506 CATTTCCACTTTATTGGAGAGGG + Intronic
985051066 4:185991679-185991701 GTTTTCCAGTGACTTGGAGATGG - Intergenic
985567268 5:625574-625596 CTCTTCCAGTGTCTCCGAAATGG + Intronic
986134519 5:4962440-4962462 GACTTCCAGTGAGTTGTAGAGGG - Intergenic
988787135 5:34575460-34575482 CACCTCCAGAGCCTTGGAGATGG - Intergenic
990312510 5:54553309-54553331 CACTGCCAGTGTCTTGGTGTGGG - Intergenic
990753127 5:59039455-59039477 CACTTCAAGTGCCGTGCAGAAGG - Intronic
990936749 5:61159235-61159257 CACTGCCATTTTCTTAGAGATGG - Exonic
993682869 5:90901335-90901357 CACTTCCATTGGCTTGAAGTTGG - Intronic
994471177 5:100210148-100210170 TACTTCCAGTAGCTGGGAGATGG - Intergenic
994616306 5:102108149-102108171 CACTGCCAGTGGGTTGGGGAGGG + Intergenic
994706135 5:103208673-103208695 CATTTCCATTGTTTTAGAGAAGG + Intronic
995104997 5:108366892-108366914 CACTACCAGTGTGCTGGAGTTGG + Intronic
995686876 5:114781303-114781325 TACTTCTTGTGCCTTGGAGATGG + Intergenic
998142145 5:139706008-139706030 TACTTCCAGTGTGCTGGTGAGGG - Intergenic
998231101 5:140361887-140361909 CCTTTCCAGTGGCTGGGAGAGGG + Intronic
998426033 5:142029404-142029426 CACTTACTGTGTCTTAGGGATGG + Intergenic
998690521 5:144582344-144582366 TACTTCCAGTGCCTTTGACAGGG - Intergenic
1001313082 5:170625008-170625030 CTCTTCCAGTCTATTGCAGATGG + Intronic
1004313116 6:14563497-14563519 AGCATCCAGTGTCTTGGAGCTGG - Intergenic
1005692237 6:28318653-28318675 CACTGCCATTTTCTTAGAGATGG - Intergenic
1006784690 6:36658206-36658228 GACTTGCAGTGTCTGGGAGGAGG + Intergenic
1007405651 6:41634732-41634754 CACTTCCTGTCTCTGGCAGAGGG - Intergenic
1007920766 6:45607489-45607511 CACCTACAGTCTCCTGGAGAGGG - Intronic
1010490136 6:76466164-76466186 CACTCTCAGTATCTTGAAGAGGG - Intergenic
1010793868 6:80096342-80096364 CACATACTGTATCTTGGAGAAGG + Intergenic
1011202552 6:84853017-84853039 CTCTTCCAGAGTTTTGGAGTTGG - Intergenic
1011271016 6:85580033-85580055 CACTGCCTGGGACTTGGAGAGGG - Intronic
1012207817 6:96482756-96482778 CACTTCTTATGTTTTGGAGATGG + Intergenic
1012229266 6:96741379-96741401 CACTTACAATCTCCTGGAGATGG + Intergenic
1016609710 6:145974580-145974602 AAATTTCAGTGTCTTGGACAAGG - Intergenic
1017210052 6:151845887-151845909 CATTTCCAGGGTCTTGCATAGGG - Intronic
1017366360 6:153645439-153645461 CACTTTCATTTTATTGGAGAAGG - Intergenic
1017792532 6:157814049-157814071 CAGTTCCAAGTTCTTGGAGAAGG + Intronic
1019768965 7:2871377-2871399 CATTTCCAGTGTAAAGGAGATGG + Intergenic
1021884930 7:25129087-25129109 CAGTGCCTGTGGCTTGGAGAAGG + Intergenic
1022528699 7:31053738-31053760 CAAATGCTGTGTCTTGGAGAGGG - Intronic
1022636356 7:32139801-32139823 CTCTTCCAGTGTCTTCGTTAAGG - Intronic
1024908625 7:54419502-54419524 CGCTACCGCTGTCTTGGAGATGG - Intergenic
1026482196 7:70789173-70789195 CACGTGCTGTGTCTTGGAGATGG + Intronic
1030167625 7:106570970-106570992 CACTTCCTGTGTCTTTGAAGAGG - Intergenic
1034559569 7:151871483-151871505 CAGCTCCAGGGTCTTGGAGGAGG - Intronic
1034748493 7:153545356-153545378 AATTGCCAGTATCTTGGAGATGG - Intergenic
1035702985 8:1651448-1651470 AACTTCCAGTCTCTTGGTGATGG - Intronic
1035824956 8:2634707-2634729 CAGTTCCAGTGATTTGGACAGGG - Intergenic
1036538673 8:9679768-9679790 CATCACCAGTGCCTTGGAGACGG - Intronic
1036594229 8:10197736-10197758 CACTGTCCCTGTCTTGGAGAGGG - Intronic
1036925030 8:12896184-12896206 CACTGCCAATGTCTTTGTGATGG - Intergenic
1037222729 8:16544953-16544975 GACTGCCAGTGACTAGGAGAGGG + Intronic
1041420258 8:57660162-57660184 TTCTTCCAGTATCTTGGACATGG - Intergenic
1044091994 8:88013503-88013525 AAATTCCAGTGTGTTGTAGATGG - Intergenic
1044811639 8:96069423-96069445 TATCTTCAGTGTCTTGGAGATGG - Intergenic
1047895934 8:129366114-129366136 CACTTCAAGTGTATTTGAAATGG - Intergenic
1048302142 8:133259652-133259674 CAATTCCAATGTCAGGGAGAAGG + Intronic
1048646550 8:136427582-136427604 CACTGCCAGTGGATTGGGGAGGG - Intergenic
1049209273 8:141377912-141377934 CTCTGCCAGGGTCCTGGAGAAGG - Intergenic
1050112183 9:2228377-2228399 CACTTCCTTTGTTTTGAAGAAGG - Intergenic
1050119273 9:2291684-2291706 CACATCTAGTCTCTAGGAGATGG - Intergenic
1051363575 9:16303864-16303886 CACGTCCATTATCTTGGAGATGG + Intergenic
1051377862 9:16422582-16422604 CACTTCAAGTGTTTTGCATATGG - Intronic
1053043559 9:34894682-34894704 CACTCCCAGTGTGATGGTGAAGG - Intergenic
1053499774 9:38576376-38576398 CACCTCCAGTGCCTTGGTCACGG - Intronic
1056702312 9:88920936-88920958 AATTTCCAGTGTCTTGGATGGGG + Intergenic
1059406192 9:114099343-114099365 CAGTCCCAGTGTTGTGGAGAAGG - Intergenic
1059832046 9:118107147-118107169 CCCTTCTAATGGCTTGGAGATGG + Intergenic
1061712175 9:132495893-132495915 CAGACCCAGTGTCTTGGTGAGGG - Intronic
1185752970 X:2628780-2628802 CACTTCCTGCTTCCTGGAGATGG + Intergenic
1185753014 X:2629094-2629116 CACTTCCTGTTTCCTGGGGATGG + Intergenic
1186593896 X:10960172-10960194 CACTTCCCATGACTTGGGGATGG + Intergenic
1188790561 X:34404096-34404118 CACGTGAAGGGTCTTGGAGAAGG - Intergenic
1189238528 X:39507504-39507526 AACATACAGTGTCTTGGAGCAGG + Intergenic
1190418497 X:50204480-50204502 CACTTCCATCGTCTTGGGGGTGG + Intronic
1192523904 X:71824964-71824986 AACACCCAGTCTCTTGGAGATGG - Intergenic
1192784059 X:74320961-74320983 CAGTTCTGGTTTCTTGGAGAAGG - Intergenic
1195851238 X:109283991-109284013 GACATCCAGTGTCTTAGATAAGG - Intergenic
1195974651 X:110513298-110513320 AACTCCCAGTGTCTTGTACATGG + Intergenic
1198615023 X:138447704-138447726 CACATCTAGTGTCTTGAAGGTGG - Intergenic
1198786705 X:140296521-140296543 CAATTTCAGTTTCTTAGAGATGG + Intergenic
1199077164 X:143536981-143537003 CACGTGAAGGGTCTTGGAGAAGG + Intergenic
1201990160 Y:20015023-20015045 CCATTCCAGTGTCTTGAAGATGG - Intergenic