ID: 1181709613

View in Genome Browser
Species Human (GRCh38)
Location 22:24674226-24674248
Sequence TCACAGCACTTCCAGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 3, 1: 0, 2: 0, 3: 27, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181709613_1181709617 21 Left 1181709613 22:24674226-24674248 CCAAGACACTGGAAGTGCTGTGA 0: 3
1: 0
2: 0
3: 27
4: 226
Right 1181709617 22:24674270-24674292 GCTCTGTAATCTCTACCTGGAGG No data
1181709613_1181709618 22 Left 1181709613 22:24674226-24674248 CCAAGACACTGGAAGTGCTGTGA 0: 3
1: 0
2: 0
3: 27
4: 226
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data
1181709613_1181709616 18 Left 1181709613 22:24674226-24674248 CCAAGACACTGGAAGTGCTGTGA 0: 3
1: 0
2: 0
3: 27
4: 226
Right 1181709616 22:24674267-24674289 TCTGCTCTGTAATCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181709613 Original CRISPR TCACAGCACTTCCAGTGTCT TGG (reversed) Intergenic
901541730 1:9922056-9922078 TCCCAGCACTTTCGGAGTCTGGG - Intergenic
902405280 1:16179564-16179586 TCAAATCACTTCCACTCTCTGGG - Intergenic
902653115 1:17849648-17849670 TCCCTGCACTTCCAGTGCCTAGG - Intergenic
904353644 1:29924696-29924718 TCACAGCACTTCCCACCTCTAGG - Intergenic
907757791 1:57327626-57327648 TCAAAACACCTCCTGTGTCTTGG + Intronic
908002764 1:59696892-59696914 ACAAAGCACTTCCCGTTTCTGGG - Intronic
908104268 1:60825238-60825260 TCTCAGCCCTCCCAGTGTTTTGG - Intergenic
909078864 1:71085465-71085487 TCTCAGGACTTCCACTGTCCAGG - Intergenic
909803408 1:79844185-79844207 TGCCAGCACATTCAGTGTCTTGG + Intergenic
909959226 1:81818337-81818359 TCACAGCATTTATAATGTCTTGG + Intronic
910949181 1:92627317-92627339 TAACAGCATTTGCAGTGTCCTGG - Intronic
917590325 1:176469721-176469743 TCTCAGACCTTCCTGTGTCTGGG - Intronic
919649343 1:200130513-200130535 TTACAGCACTTCCAGTGATGAGG - Intronic
919710918 1:200727119-200727141 TCACATCACTTACACTGCCTGGG + Intergenic
921797267 1:219360831-219360853 ACACACCACTACCAGTATCTGGG + Intergenic
923332138 1:232935068-232935090 TCACAGCCTTCCCAATGTCTAGG - Intergenic
1063069677 10:2648623-2648645 TCAAAGCGCTTTCAGTTTCTAGG - Intergenic
1063542471 10:6948178-6948200 TCACAGCATTTGCAGTGACCTGG + Intergenic
1067432532 10:46253447-46253469 GCACAGCACTTCCATTCTCAGGG + Intergenic
1069049445 10:63777292-63777314 TCACCACATTTCCAGTCTCTTGG + Intergenic
1069542637 10:69306931-69306953 TCACCACATTTCCAGTGACTAGG + Intronic
1069664829 10:70147230-70147252 TTACAGCAAATCCAGTTTCTCGG - Intergenic
1070659925 10:78298110-78298132 ACATAGCATTTCCAGTGTCCAGG - Intergenic
1071142218 10:82522294-82522316 TCCCAGCACTTTCAGAGGCTGGG - Intronic
1071777545 10:88806107-88806129 TGACAGCACTTCCAGTGGATGGG + Intronic
1072090084 10:92118867-92118889 TCAAAGCAGTACCAGTGTCATGG - Intronic
1072355459 10:94605601-94605623 TCTCAGAACTTCCAGTGTTGTGG + Intronic
1073588292 10:104731939-104731961 TCTCAGCCCTTCCAGTAACTTGG + Intronic
1074472480 10:113740178-113740200 TAACAGCATTTGCAGTGTCCTGG + Intergenic
1075889207 10:125931021-125931043 TAACAGCACTTGCAGTGACCTGG - Intronic
1078430078 11:11281733-11281755 TCACCGCACTTCTAGTCTCTAGG - Intronic
1079123236 11:17699711-17699733 TCACAGCACAGCCAGTGTGGGGG + Intergenic
1079210765 11:18458580-18458602 TGACAGAAGTTGCAGTGTCTAGG - Intronic
1079309958 11:19356468-19356490 TCTGGGCACTTCCAGTGTCTTGG + Intronic
1079710271 11:23674581-23674603 TGACAGCACTTCTAGTAGCTGGG + Intergenic
1079777897 11:24557168-24557190 TCACAGCACCTGCAGTGTGAAGG - Intronic
1081080496 11:38733850-38733872 ACACAGAACTTCCAGTCCCTAGG + Intergenic
1082085842 11:48048851-48048873 TCACATCACTTTCACAGTCTTGG + Intronic
1086574979 11:88329525-88329547 TTACAGGACTTCCTGTCTCTGGG + Intronic
1087108771 11:94440013-94440035 TCACAGCACTTACAGTGCAAGGG + Intronic
1087318791 11:96635689-96635711 TCTCAGCACCTCCTGGGTCTTGG + Intergenic
1089964802 11:122647137-122647159 GCACAGTTCTTCCAGTTTCTTGG - Intergenic
1090523642 11:127505482-127505504 TCACAGCACTCATAGTGTCCAGG - Intergenic
1092027231 12:5251822-5251844 CCATAGCATTTCCAGTTTCTGGG - Intergenic
1092027449 12:5254614-5254636 GCTCAGCACTGCCTGTGTCTGGG - Intergenic
1093477556 12:19573120-19573142 TCTCAGCACTCCCAATGTTTGGG + Intronic
1093488298 12:19676809-19676831 TCACAGCATTTGCAGTGACCTGG - Intronic
1093721055 12:22442763-22442785 TAACAGCACTTGCAGTGACCTGG + Intergenic
1094327488 12:29256505-29256527 TCTCAGCACTTCCTCTGCCTGGG + Intronic
1095428408 12:42105377-42105399 TGATAGCACTACCAATGTCTTGG - Intronic
1096135380 12:49195808-49195830 TCCCAGCACTTTCAGAGGCTGGG - Intronic
1096215919 12:49797275-49797297 TCTCAGCACCTCCAGAATCTGGG + Exonic
1096764057 12:53868642-53868664 ACACTGCACTTCCACTGTCCTGG - Intergenic
1097786758 12:63768911-63768933 TAACAGCAGATTCAGTGTCTGGG + Intergenic
1098572528 12:72005115-72005137 TGACAGCATTTCCATTTTCTAGG - Intronic
1100739803 12:97579534-97579556 TAAAAGCACTTCCAATGTCAAGG - Intergenic
1101660630 12:106762071-106762093 TCACAGTACCTGCATTGTCTTGG + Intronic
1101959882 12:109241045-109241067 ACACAGCAATTCCAGTTTCAGGG - Intronic
1102916192 12:116754273-116754295 TAACAGCACTTGCAGTGACCTGG - Intronic
1104880680 12:132068449-132068471 TCACAGCACAGCCAGTGTCCAGG - Intronic
1105279441 13:18954613-18954635 ACACAGCTCTGCTAGTGTCTAGG + Intergenic
1105564257 13:21528543-21528565 TCTCAGCCCTTCCACTGTATTGG + Intronic
1105908766 13:24840587-24840609 TAACAGCATTTGCAGTGACTTGG + Intronic
1106876138 13:34076089-34076111 TCACAATAATTTCAGTGTCTGGG + Intergenic
1107197416 13:37669790-37669812 TCACAGCAATTCCATGGCCTTGG + Intronic
1108970358 13:56367943-56367965 TGACAGCACTCCCAGTAGCTGGG - Intergenic
1111376354 13:87384018-87384040 TCACAAAACTTCTAGTGTCTAGG + Intergenic
1113258101 13:108529444-108529466 ACACAGGTCTTCCAGTGTTTTGG + Intergenic
1113961237 13:114127426-114127448 TCCCAGCACACCCTGTGTCTTGG + Intronic
1117078995 14:52132455-52132477 TCACAGCACTTACAGTTTGTGGG - Intergenic
1117079171 14:52133561-52133583 TCACAGCACTTACAGTTTGGGGG - Intergenic
1117809290 14:59529681-59529703 TCTTATCTCTTCCAGTGTCTTGG + Intronic
1119300391 14:73566832-73566854 TCACAGCACTTCCTCTGCCTGGG - Intergenic
1125326560 15:38541337-38541359 TCACAGCACTTGGGGAGTCTGGG + Intronic
1128132344 15:65237269-65237291 TGGCAGGACTTCCTGTGTCTGGG - Intronic
1129247543 15:74288780-74288802 TTGCAGCACTTCAAGTGTCTTGG - Intronic
1129604357 15:77017589-77017611 TCACAGCAATTGCGGTTTCTTGG - Intronic
1130721710 15:86393330-86393352 ACAAAACACTTCCATTGTCTGGG - Intronic
1131295307 15:91143035-91143057 TGACAGCACAGCCAGTGGCTGGG + Intronic
1132534891 16:473548-473570 TCTCAGCCTTTCCAGTGGCTGGG + Intronic
1134140101 16:11711010-11711032 TCACAGGACGTCCAGTGTGCCGG + Intronic
1135610477 16:23862108-23862130 GCACAACACTTACAGTGTCCAGG - Intronic
1137368349 16:47880732-47880754 TCACAGCACTTACCGTGTGCTGG + Intergenic
1137601533 16:49759710-49759732 TTACAACACTTCCAGAGTTTTGG - Intronic
1138447888 16:57076164-57076186 TCCCAGCACTTTCGGAGTCTAGG - Intronic
1139532152 16:67547649-67547671 CCTCAGCACTTCCAGTATCCAGG + Intergenic
1143133826 17:4699127-4699149 TCCCAGCACTTCGAGTGCCGAGG + Intronic
1144251435 17:13420623-13420645 TCACAGAACTTCCAGGGTAGAGG - Intergenic
1146835792 17:36109566-36109588 TAACAGCACTTACATTGTTTAGG + Intergenic
1146966178 17:37032349-37032371 TGACGGCACTTCCACTATCTGGG - Intronic
1149832963 17:59887890-59887912 TCACTGTAATTCCAGTGTTTTGG - Intronic
1151459252 17:74245073-74245095 TCACACCTCGTCCAGTGACTTGG + Intronic
1152570107 17:81117953-81117975 TCACAAACCTGCCAGTGTCTCGG + Exonic
1153168448 18:2288228-2288250 TAACAGCATTTCCAGTGACCTGG - Intergenic
1153948704 18:10039022-10039044 TCTCTGCACTTCCAGTGCCTGGG - Intergenic
1155328583 18:24691398-24691420 TCACAGCATTTACCATGTCTTGG - Intergenic
1155913099 18:31527824-31527846 TCAAAGCAGATGCAGTGTCTGGG + Intronic
1157654261 18:49369856-49369878 TCACAGGTCATACAGTGTCTTGG + Intronic
1157668886 18:49511803-49511825 TCCCAGCACTTCGGGTGGCTGGG - Intergenic
1159656298 18:71032333-71032355 TCCCAGCACTTCCAGAGGCTAGG - Intergenic
1160211295 18:76882326-76882348 CCACAGCACTTAGAGTGTTTAGG + Intronic
1162196849 19:8991603-8991625 TCTCTGAACCTCCAGTGTCTTGG - Intergenic
1162918588 19:13887347-13887369 TGACAGCACTGCCAGGGCCTGGG - Intronic
1165280016 19:34788050-34788072 ACACAGCACTTACATTGTATTGG + Intergenic
1165361831 19:35341586-35341608 ACACAGCACTTCAAGTGTCCAGG - Exonic
1166855662 19:45781674-45781696 TCACCGCCCTCCCAGTGCCTGGG + Intronic
1167505782 19:49870321-49870343 CAACAGCACTTCCACTGTGTAGG - Intronic
926053840 2:9762133-9762155 ACCCAGCACTTCCAATGTCTGGG - Intergenic
927471727 2:23382664-23382686 TCCCAGCGCATCTAGTGTCTTGG - Intergenic
927647162 2:24885287-24885309 TTTCAGCAATACCAGTGTCTGGG - Intronic
927935528 2:27073865-27073887 TCACAGAACTTCCTGTGCCTAGG + Intergenic
928167926 2:28984195-28984217 TCACATCCCTTCCTGGGTCTTGG + Intronic
928950993 2:36812821-36812843 TCACCAAACTACCAGTGTCTTGG + Intronic
930196857 2:48518899-48518921 TCCCAGCACTTTCAGAGGCTGGG + Intergenic
930991298 2:57658630-57658652 TCACAGCTTTTCCAATGCCTTGG - Intergenic
932952003 2:76304834-76304856 TCACAGAACTTCTAGCCTCTAGG + Intergenic
934490496 2:94759331-94759353 TGGCAGCACTCCCAGTGTCTAGG + Intergenic
938194225 2:129312403-129312425 TTAAAGAACTTCCAGTTTCTTGG - Intergenic
938566207 2:132521262-132521284 TCACAGAACTTCAAGTTTGTTGG - Intronic
940171892 2:150837673-150837695 TCACAGCATTTCGAGTGACCTGG - Intergenic
943689756 2:190857591-190857613 ACACAGCACTCCCACTGACTGGG + Intergenic
944588085 2:201190592-201190614 TCACAAATTTTCCAGTGTCTAGG + Intronic
948720385 2:239895770-239895792 GCACAGCACTTCCACTGTTAAGG - Intronic
948736284 2:240008139-240008161 TCACATCACTTCCAAAGTGTAGG + Intronic
1169721950 20:8687640-8687662 TAACAGCATTTCCAATGACTTGG - Intronic
1169756314 20:9046691-9046713 TCCCAGCTCTTCCACTGCCTGGG - Intergenic
1173006748 20:39145769-39145791 TCTCAGCACTTGCATTTTCTGGG - Intergenic
1173646761 20:44638140-44638162 TCACTTCACTTCCTGTGCCTCGG + Intronic
1174077828 20:47950938-47950960 TGACAGTACTTTCTGTGTCTGGG - Intergenic
1174123959 20:48289006-48289028 TCACAGCAATTCCAGGGCATGGG - Intergenic
1174421432 20:50401520-50401542 TCACAGCAGTTCCAGGAGCTGGG + Intergenic
1176254047 20:64141408-64141430 TCACAGCACTTTAAGTGGCGGGG - Intergenic
1176310615 21:5147037-5147059 CCACAGCATTCCCAGTTTCTGGG + Intronic
1179846440 21:44114998-44115020 CCACAGCATTCCCAGTTTCTGGG - Intronic
1180132270 21:45834407-45834429 TCACAGCACATGCTGTGCCTTGG - Intronic
1181163149 22:20969239-20969261 CCCCAGGACTTCCAGTGTCGGGG + Intronic
1181504613 22:23343995-23344017 TCACAGCACTTCCAGTGTCTTGG - Intergenic
1181655729 22:24296608-24296630 TCACAGCACTTCCAGTGTCTTGG - Intronic
1181709613 22:24674226-24674248 TCACAGCACTTCCAGTGTCTTGG - Intergenic
1182193442 22:28489030-28489052 TCCCAGCACTTTCAGAGGCTGGG + Intronic
1184849454 22:47112013-47112035 TCACAGAGCTTCCAGTGGCCTGG - Intronic
949859082 3:8489228-8489250 TCACAGCTTTTCCAGTTCCTAGG + Intergenic
949929365 3:9066446-9066468 TCACAGCACTTCAAATGACAAGG - Intronic
950083452 3:10239893-10239915 TCCCAGCACTTCCAGAGGCTGGG + Intronic
952726482 3:36591877-36591899 TGCCAGCAGATCCAGTGTCTCGG + Intergenic
954669829 3:52284241-52284263 TCCCAGCACTTTCAGAGGCTGGG + Intronic
956649354 3:71489572-71489594 TCACAGGACTTCCAGAGTGAAGG - Intronic
957096131 3:75778889-75778911 GCACAGCACTCCCATTGTTTTGG - Intronic
957096144 3:75778959-75778981 GCACAGCACTCCCATTGTTTTGG - Intronic
957464279 3:80566151-80566173 ACCCAGCAGATCCAGTGTCTAGG - Intergenic
958158289 3:89784263-89784285 TCACAACACATACAGTGTCATGG + Intergenic
959402458 3:105920205-105920227 CCTCTGCACTTCCTGTGTCTAGG + Intergenic
960031986 3:113063369-113063391 TGCCAGCAGGTCCAGTGTCTGGG + Intergenic
960230474 3:115220303-115220325 TCACAGCATTTCAAATGTGTGGG + Intergenic
960254632 3:115498979-115499001 TCACACCACTTCCTGTGGATAGG - Intergenic
960672790 3:120168487-120168509 TCTCAGTTCTTCCAGTGTATTGG + Intronic
961871034 3:129988431-129988453 TCTCAGCCCTGCCTGTGTCTGGG + Intergenic
962360465 3:134738190-134738212 TAACAGCATTTCCAGTGACCTGG - Intronic
963480591 3:145868365-145868387 TCCCAGCACTTCGAGAGGCTAGG - Intergenic
964839417 3:160977921-160977943 TCACAAGACTTCCTGTGTATGGG + Intronic
967028874 3:185587382-185587404 TCCCAGCACTTCCAAAGGCTGGG - Intronic
967116149 3:186340888-186340910 TAACAGCACCTCCAGTTTCTGGG + Intronic
968333015 3:197887614-197887636 TCCCATCACTGACAGTGTCTGGG + Intronic
968333041 3:197887712-197887734 TCCCATCACTGACAGTGTCTGGG + Intronic
968333053 3:197887760-197887782 TCCCATCACTGACAGTGTCTGGG + Intronic
969230680 4:5828150-5828172 TCACAGCACCTCCCGTGGGTGGG + Intronic
969456789 4:7304866-7304888 TCAGAGCATTTCCAATGTTTGGG + Intronic
971424901 4:26506050-26506072 TCCCAGCAATTCCAGTGTTTTGG - Intergenic
971520340 4:27541740-27541762 GCAGAGCATTTTCAGTGTCTGGG - Intergenic
974143154 4:57914573-57914595 TCATAGAGCTTCCAGTGTGTTGG - Intergenic
977547577 4:98402321-98402343 TCCCAACACTTCCGGAGTCTGGG - Intronic
979538068 4:121846941-121846963 TAAAAGCAATTCCTGTGTCTAGG + Intronic
979713157 4:123804291-123804313 GAACAGCTCTTCCAGTGGCTGGG - Intergenic
980439334 4:132819429-132819451 TCCCTTCACTTCCAGTATCTTGG - Intergenic
980726823 4:136772787-136772809 TCTAAGCACTTTCAGTGTCTCGG + Intergenic
982046231 4:151448928-151448950 GCACAGGAGTTCCAGTTTCTTGG + Intronic
982231976 4:153217277-153217299 TGACAGCACTTCCAGCCTCCTGG - Intronic
987500565 5:18704189-18704211 TCTCAGCCTCTCCAGTGTCTGGG + Intergenic
989378915 5:40795072-40795094 TAACAGCATTTGCAGTGACTTGG + Intronic
991229503 5:64315491-64315513 TCTCAGCACTTTGAGAGTCTGGG + Intronic
992286150 5:75237209-75237231 TGACAGCTCTTCCCGTATCTGGG - Intergenic
993848472 5:92975018-92975040 TCACAGTTCTCTCAGTGTCTGGG - Intergenic
994712036 5:103277558-103277580 TCACTGAAATTCCAGTTTCTAGG + Exonic
996722187 5:126640626-126640648 TCAGAGCACTTCCAGTGGTCTGG + Intergenic
997412562 5:133701284-133701306 TCCCAGCTATTCCAGTGGCTGGG + Intergenic
1003625649 6:7738871-7738893 GCACAGCACTTCCTGTGTGTTGG - Intronic
1004348002 6:14866238-14866260 TCCCAGGACTCCCAGTGACTGGG + Intergenic
1004629238 6:17405990-17406012 TCCCAGCACTTTCAGAGGCTGGG - Intronic
1007276693 6:40679394-40679416 ACAGAGCCCTTCAAGTGTCTCGG + Intergenic
1008608489 6:53164086-53164108 TCCCAGCACTTTGAGTGGCTGGG - Intergenic
1008839047 6:55876534-55876556 TCACAATACTTTCATTGTCTGGG + Intergenic
1009490604 6:64285489-64285511 TCAAAGCCATTCAAGTGTCTAGG + Intronic
1010816990 6:80369679-80369701 GCACATTATTTCCAGTGTCTGGG - Intergenic
1011169096 6:84484891-84484913 TCACAGCATTTGCAGTGACTTGG + Intergenic
1014216725 6:118758914-118758936 TCCCAGCAATCCCAGTGCCTAGG + Intergenic
1014963807 6:127721379-127721401 TCACACCACATCCATTATCTGGG - Intronic
1015053504 6:128871256-128871278 TCACAGCACTTACATTCTATTGG - Intergenic
1015614918 6:135064588-135064610 TCCCAGCACTTCAAGAGGCTAGG - Intronic
1016877594 6:148879241-148879263 TCACAGAACTCCCAGTGACAGGG - Intronic
1017365682 6:153634299-153634321 TCACTCCACTACCAGGGTCTGGG - Intergenic
1018086473 6:160305288-160305310 TCCCAGCACTTTGGGTGTCTGGG + Intergenic
1019496401 7:1342399-1342421 TCACACCACTCCCAGGGCCTCGG - Intergenic
1019702599 7:2481162-2481184 TCACAGAGCTTCTGGTGTCTGGG + Intergenic
1020026637 7:4904352-4904374 TCAGAGGACATCCAGGGTCTGGG + Intergenic
1022423578 7:30246532-30246554 TCCCACCACAGCCAGTGTCTTGG + Intergenic
1023317673 7:38957067-38957089 TCCCAGCACTTTGAGAGTCTGGG + Intergenic
1024429770 7:49273836-49273858 TCACAGCAATCCCATTCTCTGGG + Intergenic
1025060891 7:55806501-55806523 TCACTGCACTTCCAGCGTGGCGG - Intronic
1025249387 7:57341945-57341967 TCACAGCAATTCCAGGAGCTGGG - Intergenic
1028228408 7:88276336-88276358 TCACAGTAGTTCCAGCATCTGGG - Intergenic
1028440664 7:90856476-90856498 TCATTGCTCTTCCAGTGTTTAGG + Intronic
1029576761 7:101408466-101408488 TGACAGCACTTCCTGTAGCTGGG + Intronic
1031234680 7:119159465-119159487 TAACAGCATTTGCAGTGACTTGG - Intergenic
1032330427 7:130974224-130974246 TCACAACAATTCAAGTCTCTAGG - Intergenic
1033268035 7:139903250-139903272 TAACAGCATTTGCAGTGACTTGG - Intronic
1035121343 7:156570461-156570483 TAACAGCATTTGCAGTGACTCGG + Intergenic
1040798676 8:51316635-51316657 TCTTTGCACTTCTAGTGTCTGGG + Intergenic
1040840824 8:51782275-51782297 TCACAGCACCTCCAGGTTCAAGG + Intronic
1041364358 8:57085317-57085339 TAACAGCATTTACAGTGACTTGG + Intergenic
1043014271 8:74919252-74919274 TCACCCCCCTTCCATTGTCTAGG + Intergenic
1043333710 8:79148233-79148255 TGAAAGCCTTTCCAGTGTCTAGG - Intergenic
1043726050 8:83611605-83611627 TCTCAGCACCTCCTGAGTCTCGG - Intergenic
1043909221 8:85841314-85841336 ATACAGCACTTACAATGTCTGGG - Intergenic
1044258106 8:90089862-90089884 TAACAGCATTTGCAGTGACTTGG - Intronic
1045362993 8:101450116-101450138 TGACAGCACTTCCTGCATCTGGG + Intergenic
1045520102 8:102896033-102896055 TCACAGGACTTTCAGCTTCTTGG + Intronic
1047421114 8:124709207-124709229 TCTAAGAGCTTCCAGTGTCTTGG - Intronic
1048693886 8:137001969-137001991 TCAGAGCACTTGCTGTGGCTGGG + Intergenic
1049250210 8:141584157-141584179 TCAGGGCACTGGCAGTGTCTGGG - Intergenic
1049307147 8:141910111-141910133 GCACAGCACTGCCAGGGTCCCGG - Intergenic
1051352537 9:16212103-16212125 TGACAGCTCCTCCACTGTCTTGG - Intronic
1051700693 9:19820120-19820142 TAACAGCATTTGCAGTGACTTGG + Intergenic
1052494265 9:29207490-29207512 TCCCAGCACATTCAGTTTCTAGG - Intergenic
1052731005 9:32285661-32285683 TAACAGCATTTGCAGTGTCCTGG - Intergenic
1053667503 9:40326373-40326395 TGGCAGCACTCCCAGTGTCTGGG - Intronic
1053917084 9:42951476-42951498 TGGCAGCACTCCCAGTGTCTGGG - Intergenic
1054378648 9:64466400-64466422 TGGCAGCACTCCCAGTGTCTGGG - Intergenic
1054517108 9:66049912-66049934 TGGCAGCACTCCCAGTGTCTGGG + Intergenic
1054726207 9:68653242-68653264 TTACACCCTTTCCAGTGTCTTGG - Intergenic
1054797706 9:69317946-69317968 TCATACCACATGCAGTGTCTAGG + Intergenic
1055905152 9:81285020-81285042 TAACAGCATTTGCAGTGACTGGG - Intergenic
1060517077 9:124272548-124272570 TCCCAGCACTCCCAGCGTCCTGG + Intronic
1187007519 X:15247122-15247144 TCACAGCAGTTTCTGTCTCTGGG - Intronic
1187681873 X:21776170-21776192 TAACAGCACTTGCAGTGACCTGG + Intergenic
1188045413 X:25420657-25420679 TAACAGCATTTCCAGTGACCTGG - Intergenic
1188909903 X:35833949-35833971 TAACTGCACTTCCAGTTTTTTGG - Intergenic
1189586879 X:42470801-42470823 TGACTGCACTTCCAGTGGCTGGG - Intergenic
1189840397 X:45069869-45069891 TAACAGCACTGCCAGTGTCGAGG + Exonic
1190006106 X:46739678-46739700 TCTCAGCTCTTCCAATGCCTTGG + Intronic
1190291397 X:48995164-48995186 TGAGAGCACTTCCAGTTCCTGGG + Intronic
1190680323 X:52821032-52821054 TCACAACACTTCCATGGGCTAGG + Intergenic
1196197998 X:112855353-112855375 TCTCAGCACTTCCTCTGCCTGGG - Intergenic
1198672926 X:139100760-139100782 TCACAGCATTCCCAGGGCCTCGG + Intronic
1198755888 X:139982212-139982234 TCAAATCATTTCCAGTCTCTGGG - Intergenic
1198872721 X:141193186-141193208 TCTGAGCCCTTCAAGTGTCTAGG - Intergenic
1200211646 X:154349288-154349310 TCACAGGATGGCCAGTGTCTGGG - Intronic