ID: 1181709614

View in Genome Browser
Species Human (GRCh38)
Location 22:24674257-24674279
Sequence ATTACAGAGCAGAGGAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 2, 1: 1, 2: 3, 3: 20, 4: 255}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181709614_1181709621 2 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709621 22:24674282-24674304 CTACCTGGAGGGCTCTAGAGGGG No data
1181709614_1181709623 9 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709623 22:24674289-24674311 GAGGGCTCTAGAGGGGCTCTAGG No data
1181709614_1181709620 1 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709620 22:24674281-24674303 TCTACCTGGAGGGCTCTAGAGGG No data
1181709614_1181709624 10 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709624 22:24674290-24674312 AGGGCTCTAGAGGGGCTCTAGGG No data
1181709614_1181709619 0 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709619 22:24674280-24674302 CTCTACCTGGAGGGCTCTAGAGG No data
1181709614_1181709625 13 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709625 22:24674293-24674315 GCTCTAGAGGGGCTCTAGGGAGG 0: 3
1: 0
2: 0
3: 11
4: 97
1181709614_1181709617 -10 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709617 22:24674270-24674292 GCTCTGTAATCTCTACCTGGAGG No data
1181709614_1181709618 -9 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181709614 Original CRISPR ATTACAGAGCAGAGGAGCGA AGG (reversed) Intergenic
901098941 1:6704216-6704238 TTTCCAAAGCAGAGGAGGGATGG - Intergenic
901243077 1:7705755-7705777 ACTACAGACCAGGGGAGCGGAGG + Intronic
902235432 1:15054321-15054343 ATGACAGGGCAGAGGAGACAGGG - Intronic
902891544 1:19447935-19447957 ATTAGAGTGCAGGGGAGTGAGGG - Intronic
903143753 1:21356391-21356413 ACCACAGGGCACAGGAGCGATGG - Intergenic
903187205 1:21635383-21635405 ATGACTGAGCAGAGGAATGAAGG - Intronic
903650062 1:24916750-24916772 TTTACAGAACAGAGCAGAGATGG - Intronic
903763422 1:25715709-25715731 AGTATAGAGCAGAAGAACGATGG + Intronic
904268495 1:29332303-29332325 ATTACAAAGCAGGGCAACGAAGG - Intergenic
904860555 1:33534471-33534493 ATAACTGAGCAGAGCAGGGAGGG - Intronic
904987444 1:34563533-34563555 AGCACAGAGCAGGGCAGCGAAGG - Intergenic
907201151 1:52727408-52727430 GTTACAGAGCAGTGAAGTGAGGG + Intronic
907222793 1:52919779-52919801 ATGACAGTGCAGAGGAGGCATGG - Intronic
907836395 1:58113090-58113112 ATTATAGAGCAGAAGGGTGAGGG + Intronic
907936707 1:59048236-59048258 AATACAGAGCAGATGAGGAAAGG + Intergenic
909995179 1:82270220-82270242 AAAGCAGAGCAGAGGAGGGAAGG - Intergenic
911759865 1:101602057-101602079 ATTATAGGGTAGAGGAGCGGAGG + Intergenic
912909151 1:113739385-113739407 AATTCAGAGGAGAGGAGAGATGG - Intronic
915002710 1:152608160-152608182 ATTCCCGAGCAGAGGAGTGCAGG - Intergenic
918429191 1:184440700-184440722 CTTACAGGACAGAGGAGAGAGGG + Intronic
920216088 1:204362351-204362373 ATTGTAGAGCAGAGGAGAGACGG - Intronic
920422871 1:205847368-205847390 AGTACAGAGCTGAGGAAGGATGG - Intronic
920423585 1:205854369-205854391 AGTACAGAGCTGAGGAAGGATGG + Intergenic
920846409 1:209596351-209596373 AATCCAGAGGAGAGGAGAGAAGG + Intronic
922336072 1:224618814-224618836 CTTGCAGAGCAGAGAAGGGAGGG - Intronic
923514581 1:234683957-234683979 ACGACAGAGCAGAGGAGGGCTGG + Intergenic
1065257088 10:23881060-23881082 ATTTCAGAGGAGAGGAGCACTGG + Intronic
1065610457 10:27466804-27466826 ATTATAGGACAGAGGAGCGGAGG - Intergenic
1066156739 10:32686475-32686497 AATAAAGATCAGAGGAGCTAAGG + Intronic
1069214589 10:65803803-65803825 ATTACAGAGCAGAGTATAGAAGG + Intergenic
1071523167 10:86343500-86343522 AATACAGAGCAGTGGAGCGATGG - Intronic
1074744257 10:116515499-116515521 CTTAAAGAGCAGAAGAGTGAGGG - Intergenic
1076478275 10:130767488-130767510 GTAACAGCGCAGAGGAGGGAGGG - Intergenic
1077807564 11:5604836-5604858 ATCACATAGCAGAGGAACCATGG + Intronic
1080657119 11:34266837-34266859 TTTTCAGAGTAGAGGAGAGATGG + Intronic
1084232223 11:67761404-67761426 ATTACAGGGTGGAGGAGCGGGGG - Intergenic
1085778794 11:79390102-79390124 AATACAGAGCAGTGGAATGAAGG + Intronic
1086004942 11:82026907-82026929 ATTATAGAGTAGAGGAGCGGAGG - Intergenic
1086291530 11:85315890-85315912 TTTCCAGAGCAGAGGAGACAGGG - Intronic
1087167145 11:95016372-95016394 ATGACAGAGCAGAATAGGGAGGG + Intergenic
1088184118 11:107144336-107144358 AATACAGAGCAGAGAAAAGAAGG + Intergenic
1089046589 11:115506003-115506025 ATTACAGAGCAGAATATCCAGGG - Intergenic
1089349021 11:117811002-117811024 ATTACAGGGTGGAGGAGCGGAGG - Intronic
1089579246 11:119471151-119471173 ATTACAGAGAAGGGGAGAGCGGG - Intergenic
1089987362 11:122826340-122826362 ATTATAGAGTGGAGGAGCGGAGG - Intergenic
1091119308 11:133043416-133043438 ATTTCAGAGCTGAGGAGCAGAGG - Intronic
1096040095 12:48507623-48507645 ATTACAGAGAGGGGGAGTGAAGG + Intronic
1096307278 12:50488897-50488919 ATTGGAGAGAAGAGGAGAGATGG - Intergenic
1096650837 12:53061223-53061245 ATCTGAGAGCAGAGGTGCGAAGG - Exonic
1097275014 12:57807240-57807262 ATTGGAGAGCAGAGGAGGGGTGG - Intronic
1098176372 12:67795845-67795867 ATTCTAGATCAGAGGAGCAAAGG + Intergenic
1098426732 12:70372737-70372759 ATTACCTAGCAGAGGAGATAAGG + Intronic
1101027909 12:100631561-100631583 TTTAGAGAGGAGAGGAGGGAGGG + Intergenic
1101700372 12:107168372-107168394 ATTACAGAGCAGAAAATGGAAGG - Intergenic
1101727215 12:107398059-107398081 AAAACAGAGCAGAGGAATGAAGG - Intronic
1102776801 12:115526685-115526707 ATTACAGGGCAGAGCATAGAGGG + Intergenic
1107752348 13:43581710-43581732 TTTACTGTGCAGAGGAGCCAGGG + Intronic
1110159156 13:72354518-72354540 ATGGCAGAGCAGGGGAGAGAGGG + Intergenic
1110291245 13:73809021-73809043 ATTAAAGATCAAAGGAGCCATGG - Intronic
1113324259 13:109267064-109267086 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1118377777 14:65191845-65191867 ATCACAGAGCAGGGTAGAGAAGG + Intergenic
1118659464 14:67991920-67991942 ATTACAGAATAGAGGAGAAATGG + Intronic
1119844352 14:77817337-77817359 ATTCCAGAGCAGAGGGATGAGGG + Intronic
1120683173 14:87505795-87505817 ATGACTGTGCAGAGGAGCAAGGG + Intergenic
1121564346 14:94897393-94897415 ATTTCATTGCAGAGGAGGGAGGG - Intergenic
1123837642 15:24212244-24212266 ATTACAGTCCAGAAGAGCTATGG + Intergenic
1123886944 15:24735732-24735754 AGTACAGGGCAGGGGAGAGAAGG + Intergenic
1124907076 15:33879953-33879975 ATGACAAAGCAGAAAAGCGAAGG + Intronic
1125045697 15:35240490-35240512 ATTACAGGGTGGAGGAGCGGAGG - Intronic
1125333134 15:38601775-38601797 ACTCAAGAGCAGAGGAGTGAGGG + Intergenic
1126912480 15:53430826-53430848 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
1127130405 15:55856280-55856302 ATGACAGGGCAGAAGAGAGAAGG + Intronic
1129287896 15:74540838-74540860 ACTAAAGAGCAGAGGAGTGTAGG - Intergenic
1131059731 15:89397361-89397383 ATCACAGAGCAGAAGAGTGCGGG + Intergenic
1131173328 15:90193588-90193610 ATCTCAGAGCAGAGGAGACAGGG - Intronic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1132333838 15:101030530-101030552 ACCACACAGCAGAGGAGAGAAGG - Intronic
1133923842 16:10179042-10179064 ATTACACAGAAGTGGAGGGAAGG - Intronic
1134911106 16:18027243-18027265 ATTATAGAGGAGAGAAGTGAGGG + Intergenic
1136576351 16:31127561-31127583 ATTCCAGAGAAGAGGAGCTGAGG - Intronic
1139515778 16:67451560-67451582 AGTGCAGAGCAGAGGAGCAAAGG + Intronic
1140256305 16:73339265-73339287 ATTACAAGGCAGAGGAGAGCAGG - Intergenic
1140841154 16:78840442-78840464 GTTACAATGAAGAGGAGCGATGG + Intronic
1141522599 16:84591135-84591157 AATACAGAGCAGTGGAGGGTGGG - Intronic
1141833666 16:86524058-86524080 ATAACAGAGAAGAGCAGTGATGG - Intergenic
1141901793 16:86995834-86995856 ACAGCAGGGCAGAGGAGCGATGG - Intergenic
1143744993 17:8986449-8986471 ATTACAGGTCAGAGGAGAAAGGG + Intergenic
1143977504 17:10840798-10840820 ATAATAGAGCAGAAGAGCGAAGG - Intergenic
1145228067 17:21147801-21147823 ATTACAGAGCAGAGTTTCCAGGG - Intronic
1145873451 17:28296155-28296177 ATTGCAGAGCAAAAGAGCCAGGG + Intergenic
1148009432 17:44464012-44464034 ATTGCAGAGCAAAAGAGCCAGGG + Intronic
1148918878 17:51011361-51011383 ATTACACAGAAGAGAAGCCAAGG + Intronic
1152471993 17:80494660-80494682 GTTACACAGCAGCTGAGCGATGG - Intergenic
1203156611 17_GL000205v2_random:10007-10029 ATTACAGAACAGTGGTACGAGGG - Intergenic
1154949245 18:21192089-21192111 ATTTCAGAGCACAGTAGCTATGG - Intergenic
1155978013 18:32152816-32152838 GTTACAGAGCAGAGGTCCTAGGG + Intronic
1156723180 18:40095213-40095235 ATTAAGGAGCAGAGGAGGAAAGG + Intergenic
1156901635 18:42307533-42307555 AATACAGAGCCAAGGAGCAAAGG - Intergenic
1157775981 18:50396713-50396735 GATACAGAGGAGAGGAGAGAGGG + Intergenic
1160353292 18:78204036-78204058 ATAACAGAGCAGGGGAAGGATGG + Intergenic
1162876487 19:13624441-13624463 CTTAAAGAGCAGAGGAACGGTGG + Intergenic
1162879014 19:13643726-13643748 ATTGCCCAGCAGAGGAGTGAGGG + Intergenic
1163752365 19:19085334-19085356 ATTCCAGAGCACAGGGGCAAAGG + Intronic
1164733351 19:30522133-30522155 GCCACAGAGCAGAGGAGCCAAGG - Intronic
1166129493 19:40737541-40737563 AAGACAGGGCAGAGGAGTGAGGG - Intronic
1166499017 19:43327491-43327513 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
1167569249 19:50276704-50276726 ATTTCAGAGCAGAGGAAGGCAGG - Intronic
1167902073 19:52629493-52629515 ATTACAGGGTGGAGGAGCGGAGG - Intronic
925263208 2:2546053-2546075 AGGACAGAGCAGAAGAGTGATGG - Intergenic
925459248 2:4045441-4045463 ACCACTGAGGAGAGGAGCGAAGG - Intergenic
926463173 2:13158788-13158810 GTTACTGAGCAAAGGAGCGGGGG + Intergenic
927502917 2:23594134-23594156 ATTATACAGCAGAGGTGGGAAGG + Intronic
928238750 2:29568617-29568639 CTTACAGAGCAGGGGAGGGAAGG - Intronic
929478955 2:42283230-42283252 ACTACAGACCAGAGAAGAGAAGG - Intronic
931625696 2:64254254-64254276 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
931663982 2:64596952-64596974 ATGACAGAGCAGAGGAAGGAGGG - Intergenic
931850346 2:66245650-66245672 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
932412946 2:71558132-71558154 ATTACAGAGCAGCACAGCAAGGG - Intronic
933079200 2:77966830-77966852 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
933205300 2:79500576-79500598 ATTTCAGAGCAGAGAAGGGTGGG - Intronic
934968154 2:98740993-98741015 AGGACAGAGCAGAGGGGCCAGGG + Intergenic
935345076 2:102100252-102100274 AGTACAGAGCAGAGGAATGCAGG - Intronic
938851899 2:135268776-135268798 ATTACAGAGGAGAGCAGACAAGG + Intronic
939356927 2:141114549-141114571 ATGACAGAGGAGAGAAGAGAAGG - Intronic
940833682 2:158496516-158496538 ATTTCAGACCAGAGGACAGATGG - Intronic
940905210 2:159163061-159163083 TCTACAGAGAAGAGGAGCGAGGG - Intronic
941637904 2:167955776-167955798 AGTACAGAACAGAGGTGGGAAGG + Intronic
943688258 2:190842285-190842307 ATTTCAGAGCACAGCAGCCAAGG - Intergenic
943806571 2:192132142-192132164 ATTACAGGGTGGAGGAGCGGAGG - Intronic
945017245 2:205531892-205531914 ATTACAGAGAAGTGGAAGGATGG + Intronic
945153182 2:206810844-206810866 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
946768713 2:223064852-223064874 ATTATAGACCAGAGAAGCAATGG + Intronic
947526382 2:230878994-230879016 ATTTCAGAACAGAGGAGGCAGGG - Exonic
948144561 2:235698967-235698989 ATTAGAGAGGAGAGGAGCACAGG + Intronic
948677909 2:239609921-239609943 ATTACAGAGAAGAGAATTGATGG - Intergenic
948759802 2:240183573-240183595 ATTAGACAGCAGAGGTGGGACGG - Intergenic
1169749436 20:8976577-8976599 ATTACAGAGCTGAGCAGAGTGGG - Intergenic
1170429534 20:16263717-16263739 ATCCCATAGCAGAGGAGAGAAGG - Intergenic
1171079065 20:22159551-22159573 ATTTCAGAGCAAAGGAACGCTGG + Intergenic
1171086059 20:22239354-22239376 ATTGAAGTGCAGAGGAGGGAGGG - Intergenic
1172110113 20:32539595-32539617 AACAAAGAGAAGAGGAGCGATGG - Intronic
1172718698 20:36983115-36983137 AAGAGAGAGCAGAGGAGAGAAGG - Intergenic
1173101833 20:40095064-40095086 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1174406644 20:50307119-50307141 TTTACAGAGCAGAAAAGCCAAGG - Intergenic
1177803006 21:25846978-25847000 ATTTCAGAGCAGTGGGGCTAGGG - Intergenic
1178785398 21:35648766-35648788 ATCACAAAGCAGAGCAGGGAAGG + Intronic
1180096473 21:45557554-45557576 TGGCCAGAGCAGAGGAGCGAGGG + Intergenic
1181424976 22:22829591-22829613 ATGACAAAGCAGAAAAGCGAAGG + Intronic
1181504614 22:23344026-23344048 ATTACAGAGCGGAGGAGCGAAGG - Intergenic
1181655730 22:24296639-24296661 ATTACAGAGCAGAGGAGCGAAGG - Intronic
1181709614 22:24674257-24674279 ATTACAGAGCAGAGGAGCGAAGG - Intergenic
1183781454 22:40001791-40001813 TTTGCAGAGCAGAGGAGGGAAGG + Intronic
1185109127 22:48891044-48891066 ATCACAGAGGAGCGGAGCGGTGG - Intergenic
949238777 3:1844037-1844059 ATTAAATAGCAGGGGAGAGAAGG - Intergenic
950152983 3:10702914-10702936 ATTACAGAGAAAAGGAATGATGG - Intronic
950315240 3:11996201-11996223 ATTACAGAGCATGGCAGCCAAGG - Intergenic
951876108 3:27427803-27427825 ATTAGAGTGGAGAGGAGAGAGGG - Intronic
957919404 3:86729479-86729501 ATTACCCAGCAGAGGTGCAATGG - Intergenic
962677782 3:137769174-137769196 AACACCCAGCAGAGGAGCGACGG - Intergenic
965360718 3:167735216-167735238 CTGACAGAGCAGAGGAAGGAAGG + Intergenic
965394130 3:168141772-168141794 ATGGCAGAGCAGGAGAGCGAAGG + Intergenic
966069294 3:175855944-175855966 ATTACAGCTGAGAGGAGTGAAGG + Intergenic
966085359 3:176063032-176063054 ATTATAGAGTGGAGGAGCGGAGG - Intergenic
966201108 3:177360035-177360057 ATGACTGAGCAGAGGAGCGGGGG - Intergenic
966364325 3:179166553-179166575 ATTACAAAGCAGAGTAAAGAAGG - Intronic
966947882 3:184790081-184790103 ATTACCGAGGTGAGGAGTGATGG + Intergenic
968320536 3:197764237-197764259 GTTACAGAGCATAAGAGGGAAGG + Intronic
968656099 4:1779086-1779108 ATCACAGAGCTGAGGAGAGAGGG - Intergenic
968914387 4:3490899-3490921 ATGAATGAGCAGAGGAGAGAAGG - Intronic
969540008 4:7782373-7782395 AGTACAGAGCAGGGGACAGAGGG - Intronic
970007938 4:11428484-11428506 CTTCCAGAGCAGAGGTGCTAGGG + Intronic
971180476 4:24324931-24324953 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
971258270 4:25032701-25032723 TTTATAGAGCAGAGGAACGGAGG + Intergenic
973177600 4:47227117-47227139 ATTACAGAGAGGAGCAGAGAAGG - Intronic
973898737 4:55444930-55444952 ATTACAAAGCAGAGCAAAGATGG - Intronic
974428476 4:61768281-61768303 ATTACAGGGTGGAGGAGCGGAGG + Intronic
978335141 4:107659115-107659137 ACTACAGAGCAGAGCAGCTCAGG - Intronic
979863139 4:125719401-125719423 ATTATAGAGTAGAGGAGAAAAGG - Intergenic
980833741 4:138163861-138163883 ATTTCAGACCAGAGGACAGATGG + Intergenic
981669577 4:147272867-147272889 CTTACAGAGCAGATGAGAGTGGG - Intergenic
982280186 4:153676374-153676396 ATTACAGAGCAGAGTTTCCAGGG + Intergenic
983360334 4:166718018-166718040 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
983659502 4:170118173-170118195 ATTATAGAGCGGAGGAGAGAAGG - Intergenic
986193459 5:5517275-5517297 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
986237989 5:5929863-5929885 AATACAGAGGACAGGAGAGAGGG + Intergenic
989609937 5:43281343-43281365 ATCCCAGAGCACAGGAGTGAAGG + Intergenic
990612268 5:57469507-57469529 ATGTCAGAGAAGAGGAGCTATGG - Intergenic
991649029 5:68833077-68833099 AATACAGAGAAGAGGACAGAAGG - Intergenic
994532619 5:100988246-100988268 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
994797164 5:104318232-104318254 ACTACAGAGCAGAGAGGCAAAGG + Intergenic
995283441 5:110360163-110360185 ATTAAGGAGCAGAGGAGTTAAGG + Intronic
995376498 5:111480179-111480201 ATTACAGAGCAGAAGAGCCATGG - Intronic
996924927 5:128813487-128813509 ATCACAGAGCAGAGGGGCACAGG - Intronic
996954456 5:129165934-129165956 ATTACTTAGCAGAGTAGCAAAGG - Intergenic
998530498 5:142880202-142880224 ATTACAGGGCAAAGGAGCCCTGG - Intronic
999068201 5:148714956-148714978 ATTGCAGAGCAGGAGAGAGAGGG - Intergenic
999157893 5:149471607-149471629 ACTAGAGAGAAGAGGAGGGAGGG + Intergenic
999426396 5:151490949-151490971 ATCACAGAGCAACGGAGCAAAGG + Exonic
999618945 5:153453702-153453724 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
999954949 5:156690183-156690205 ATGAGAGAGCAGAGGAACCAGGG + Intronic
1001125402 5:169014550-169014572 TTTCCAGCTCAGAGGAGCGAAGG - Intronic
1002918491 6:1548150-1548172 GTTACAGAGCAGAGCAGAAAGGG - Intergenic
1003306274 6:4932338-4932360 ATCACAGGGCAGAAGAGCCAGGG + Intronic
1003455276 6:6276192-6276214 GTCAGAGAGCAGAGGAGCGTGGG - Intronic
1003498352 6:6683700-6683722 AATAAGGAGCAGAGGAGCTAGGG - Intergenic
1005341672 6:24849324-24849346 AATACAGTGCAGAGGAACTAAGG + Intronic
1005784199 6:29226177-29226199 ATTACACAGCAGGAGAGTGAGGG - Intergenic
1008301315 6:49843982-49844004 ATTTCAGAGCAAAGGATTGAAGG + Intronic
1008591734 6:53000219-53000241 ACTACTGAGCAGATGAGTGAAGG - Intergenic
1010121362 6:72379359-72379381 CTTCAAGAGCAGAGGAGGGAAGG + Intronic
1010648012 6:78416883-78416905 ATTAAAGATGAGAGGAGAGAAGG + Intergenic
1010665170 6:78620486-78620508 AATACAGAGAAGAGGAAAGAGGG - Intergenic
1010803975 6:80212882-80212904 ACTACAGAGAAGAGGAAAGAAGG - Intronic
1011536704 6:88383328-88383350 AGTAGAGAGCAGATGAGAGAAGG + Intergenic
1012689497 6:102294643-102294665 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1013301774 6:108810690-108810712 ATTCCAGGGCAGAGGCGTGACGG + Intergenic
1015165145 6:130194051-130194073 ATTATAGAGTGGAGGAGCGGAGG - Intronic
1015271292 6:131340592-131340614 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1016916527 6:149248982-149249004 ATTACACAGCAGAGGAGTGATGG + Intronic
1017100856 6:150848616-150848638 ATTCCACAGCAGAGGAGCCCTGG + Intergenic
1017394396 6:153979819-153979841 ATTAGAGGGAAGAGGAGGGAGGG - Intergenic
1018870459 6:167778582-167778604 ATTCCTGAGCAGAGGAGGGCCGG - Intergenic
1019029006 6:168994542-168994564 AATACAGAGCAGGGGAGTGGGGG + Intergenic
1020153010 7:5697891-5697913 CTAACAGAGCAGGGGAGAGAAGG + Intronic
1021660536 7:22914827-22914849 ATTATAGAGTAGGGGAGCGGAGG - Intergenic
1021773755 7:24031123-24031145 TTTTAAGAGCAGAGGAGGGAGGG + Intergenic
1021810584 7:24397994-24398016 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1022710125 7:32841895-32841917 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
1023851456 7:44152514-44152536 ATTACAAAGAGGAGGAGGGAAGG + Intronic
1024448742 7:49513660-49513682 ATTTCACAGCAGAGGAGCCAAGG - Intergenic
1025710419 7:63902654-63902676 ATGGCAGAGCAGAGGAGGGTCGG - Intergenic
1026641251 7:72127431-72127453 GTTACAGAGCAGAGGAGTCACGG + Intronic
1028183137 7:87748776-87748798 ATTTCAAAGCTGAGGAGGGAAGG + Intronic
1031070231 7:117154026-117154048 ATTACAGAGCATAGGAGGGGAGG + Intronic
1031399909 7:121317289-121317311 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1031818425 7:126469605-126469627 AGTGCAGAGCAAAGGAGTGAGGG - Intronic
1032465097 7:132139210-132139232 ATCAAAGAGCAGAGGGGAGAGGG + Intronic
1032530116 7:132613254-132613276 TGTACAGAGCAGAGGAGAGGAGG - Intronic
1033604515 7:142916226-142916248 ATTACAGAAAAGAGCAGAGAAGG + Intronic
1034013596 7:147557569-147557591 ATGACAGAACACAGGAGCTAAGG - Intronic
1034347278 7:150394985-150395007 ATTACAGTGAATAGGAGCAAAGG - Intronic
1036758464 8:11488915-11488937 ATAACAGCACAGAGGAGGGAGGG - Intergenic
1036814566 8:11891861-11891883 AATACAGAGGAGAGGAGAGGAGG - Intergenic
1038002976 8:23405939-23405961 ATTACTGTGCAGAGAAGCCAAGG - Intronic
1039597740 8:38806086-38806108 AGGACAGAGTAGAGGAGCGAGGG + Intronic
1039852668 8:41383793-41383815 CTAACAGAGCAGAGGAAGGATGG + Intergenic
1041490633 8:58428844-58428866 ATGACAGTGCAGAGCAGTGAGGG + Intronic
1042947095 8:74166124-74166146 AAGACGGAGCAGTGGAGCGAGGG + Intergenic
1043717979 8:83509136-83509158 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
1044258695 8:90094198-90094220 ATTACAGGGTAGAGGAGCGGAGG + Intronic
1044921907 8:97176798-97176820 ATTATAGGGTAGAGGAGCGGAGG - Intergenic
1044936166 8:97295468-97295490 AATACAGAGCAGAGTAGAGAAGG - Intergenic
1045507428 8:102788728-102788750 ATTAGAGAGCTGAGAAGGGAAGG - Intergenic
1045516353 8:102863781-102863803 AGTACCGAGCCGAGGAGCGCGGG - Intronic
1047336525 8:123941802-123941824 AGAACAGAGCAGACGAGGGAAGG + Intronic
1048872457 8:138810735-138810757 AGAACAGAGGAGAGGAGAGAGGG + Intronic
1048878364 8:138854215-138854237 ACTAAAGAGCAGAGGAGTGAGGG + Intronic
1048949411 8:139482957-139482979 ATCACAGAACAGAGTAGAGAAGG - Intergenic
1048988077 8:139746046-139746068 ATCACAGAGCCGTGGAGTGAAGG - Intronic
1049361208 8:142213238-142213260 ATTAGAGAGGAGGGGAGGGAGGG - Intronic
1050117518 9:2277275-2277297 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1052574060 9:30268569-30268591 AGGAAAGAGCAGAGGAGAGAAGG + Intergenic
1056061082 9:82885475-82885497 ATTACAGAGTGGAGAAGCGGAGG - Intergenic
1056262478 9:84862739-84862761 ATTAAAAGGCAGAGGAGGGAAGG + Intronic
1058098773 9:100894081-100894103 ATTACACAGAAGATGAGAGAAGG + Intergenic
1059574542 9:115475080-115475102 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1185990977 X:4893309-4893331 ATTACAGGGTGGAGGAGCGGAGG - Intergenic
1187493610 X:19775693-19775715 GACACAGAGCAGAGGAGCGGTGG - Intronic
1191716304 X:64196097-64196119 CTCACAGAGCATAGGAGCAAGGG - Intronic
1193588371 X:83356247-83356269 ATTACAGAGTAGAAGAAAGATGG - Intergenic
1195758449 X:108221997-108222019 ATTGGAGAGGAGAGGAGAGAGGG - Intronic
1195806310 X:108771392-108771414 ATTGCAGAGCAGTGGAGAAAGGG + Intergenic
1196773935 X:119321756-119321778 ATTACAGGGTGGAGGAGCGGAGG + Intergenic
1196988771 X:121304488-121304510 ATTCCAGGGCATAGGAGCCATGG - Intergenic
1197887041 X:131229361-131229383 ATGAAAGAGGAGAGGAGAGAGGG - Intergenic
1197998358 X:132405282-132405304 GTCACAGAGCAGAGAAGAGAGGG + Intronic
1199233674 X:145467612-145467634 ATGACAAGGCACAGGAGCGATGG - Intergenic
1199712986 X:150484997-150485019 ATCACAGAGCACTGGAGTGAGGG + Intronic
1200043504 X:153387519-153387541 AGGACAGAGCAGAGCAGGGAGGG + Intergenic
1202104091 Y:21343730-21343752 ATCTCAGAGCAGAGGAGCAAAGG + Intergenic