ID: 1181709618

View in Genome Browser
Species Human (GRCh38)
Location 22:24674271-24674293
Sequence CTCTGTAATCTCTACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181709613_1181709618 22 Left 1181709613 22:24674226-24674248 CCAAGACACTGGAAGTGCTGTGA 0: 3
1: 0
2: 0
3: 27
4: 226
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data
1181709612_1181709618 28 Left 1181709612 22:24674220-24674242 CCTTCTCCAAGACACTGGAAGTG 0: 3
1: 0
2: 2
3: 21
4: 226
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data
1181709610_1181709618 30 Left 1181709610 22:24674218-24674240 CCCCTTCTCCAAGACACTGGAAG No data
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data
1181709614_1181709618 -9 Left 1181709614 22:24674257-24674279 CCTTCGCTCCTCTGCTCTGTAAT 0: 2
1: 1
2: 3
3: 20
4: 255
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data
1181709611_1181709618 29 Left 1181709611 22:24674219-24674241 CCCTTCTCCAAGACACTGGAAGT 0: 3
1: 0
2: 0
3: 18
4: 223
Right 1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181709618 Original CRISPR CTCTGTAATCTCTACCTGGA GGG Intergenic
No off target data available for this crispr