ID: 1181717879

View in Genome Browser
Species Human (GRCh38)
Location 22:24747503-24747525
Sequence TAGAGCAACAACTCACAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 617}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181717879 Original CRISPR TAGAGCAACAACTCACAGAA TGG Intronic
900933246 1:5749500-5749522 GAGAGCAACGACCCACAGAAAGG + Intergenic
900971572 1:5994923-5994945 CAGAGCACCAACACACAGGAAGG - Intronic
903105606 1:21076994-21077016 TAAAGAGACAACTTACAGAACGG + Intronic
905011667 1:34751267-34751289 GAGAGCAACAGCCCACAGAGTGG + Intronic
905486804 1:38304161-38304183 TAGAGCTACAACTATCAAAATGG - Intergenic
906313795 1:44772940-44772962 TAAAGAGACAACCCACAGAATGG + Intergenic
906395791 1:45463170-45463192 TGAAGAGACAACTCACAGAATGG - Intronic
906814853 1:48868180-48868202 TAGAGCAATGACTCTCAAAATGG - Intronic
908023371 1:59921622-59921644 TAGACCAAAAATTCTCAGAAGGG - Intronic
909520302 1:76560386-76560408 TGAAGCGACAACCCACAGAATGG + Intronic
909724127 1:78813181-78813203 CTGAGCCAGAACTCACAGAAGGG + Intergenic
910025683 1:82648056-82648078 TGAAGCAATAACTGACAGAATGG + Intergenic
910183490 1:84510213-84510235 TGAAGAGACAACTCACAGAATGG + Intergenic
910715931 1:90230282-90230304 TGGAGAGACAACCCACAGAAAGG - Intergenic
910725313 1:90331891-90331913 TAAAGAGACAACACACAGAATGG + Intergenic
910813258 1:91259592-91259614 TAAAGAAACAACCTACAGAAAGG + Intergenic
911691937 1:100844861-100844883 TAGAAGGACAACTAACAGAAAGG - Intergenic
911768853 1:101713545-101713567 TAGAGAAACAGCTCATTGAATGG + Intergenic
912092997 1:106105215-106105237 TAAAGGAACAACCTACAGAATGG - Intergenic
912110677 1:106338260-106338282 TGGAGTGACAACCCACAGAATGG - Intergenic
912117457 1:106424453-106424475 TGAAGAAACAACCCACAGAATGG + Intergenic
912632804 1:111261687-111261709 TGAAGAGACAACTCACAGAATGG - Intergenic
913244658 1:116860978-116861000 GAGAGCAACAACTCCCACTATGG - Intergenic
913411194 1:118553847-118553869 TAAACTAACAACCCACAGAATGG + Intergenic
913477596 1:119253227-119253249 TAGAGCAAGAAATCAGAGATGGG - Intergenic
914348312 1:146818492-146818514 TAGACTGACAACCCACAGAATGG - Intergenic
916225065 1:162481512-162481534 TAAAGAGACAACCCACAGAATGG + Intergenic
916419976 1:164627956-164627978 TAGAGCAAGAACCCCAAGAATGG + Intronic
916453988 1:164951737-164951759 CAGAGCAACAACCCAAAAAAAGG + Intergenic
916883094 1:169041232-169041254 TGAAGAGACAACTCACAGAATGG + Intergenic
917349792 1:174064908-174064930 TAAAGAGACAACCCACAGAATGG + Intergenic
917386712 1:174484340-174484362 TCAAGCAACAACCCACAGAATGG - Intronic
917583402 1:176398816-176398838 TAAAGAAACAACCCACAAAATGG - Intergenic
918003725 1:180522604-180522626 TAGAGAAACAGCTCAAAGTATGG - Intergenic
918776590 1:188639347-188639369 TGGAGGAACAACACACAGCAGGG - Intergenic
918941512 1:191004671-191004693 TGAAGAAACAACCCACAGAATGG - Intergenic
919096246 1:193040200-193040222 TAAAGCGACAACCCACAGAATGG + Intronic
919316426 1:195976374-195976396 TGAAGCAATAACCCACAGAATGG - Intergenic
919511731 1:198473702-198473724 TGAAGAAACAACCCACAGAATGG + Intergenic
919938398 1:202270031-202270053 TAGAGAAATAAATCCCAGAAAGG + Intronic
921019283 1:211221733-211221755 GAGACCAAGAACTCACAGAAAGG + Intergenic
921683076 1:218057189-218057211 TGAAACAACAACCCACAGAATGG - Intergenic
922771686 1:228188031-228188053 TGGAGAGACAACCCACAGAATGG - Intergenic
923194903 1:231656032-231656054 TAAACACACAACTCACAGAATGG - Intronic
923600292 1:235396920-235396942 TGAAGAGACAACTCACAGAATGG - Intronic
923878887 1:238081819-238081841 TGAAGAAACAACCCACAGAATGG - Intergenic
924203493 1:241685816-241685838 TAGAGCAGCACATCACAGATTGG - Intronic
924435719 1:244039967-244039989 TAGAGGAACAACACAAAGGAAGG - Intergenic
924647304 1:245890284-245890306 TAAAGAGACAACCCACAGAATGG + Intronic
924687929 1:246314986-246315008 TTGGGCATCAACTAACAGAAAGG + Intronic
924832397 1:247611291-247611313 TAAAGAGACAACCCACAGAATGG + Intergenic
1063397243 10:5700920-5700942 TAAAGAGACAACCCACAGAATGG - Intronic
1063783556 10:9354067-9354089 TAGATTGACAACTCACAGAATGG + Intergenic
1064385215 10:14884591-14884613 TGGAAAGACAACTCACAGAATGG - Intronic
1064618930 10:17194361-17194383 TAAACAGACAACTCACAGAATGG + Intronic
1064731724 10:18338192-18338214 TATATAAAGAACTCACAGAACGG + Intronic
1065067224 10:21982454-21982476 TAAATAAACAACCCACAGAATGG + Intronic
1065223486 10:23519725-23519747 TAAACGGACAACTCACAGAATGG - Intergenic
1065426507 10:25610248-25610270 TGAAGACACAACTCACAGAATGG - Intergenic
1066157961 10:32698122-32698144 TAGAAGAAAAACTAACAGAAAGG + Intronic
1066568380 10:36745189-36745211 TGGAACAACAACTCAAAGAATGG + Intergenic
1067541162 10:47154621-47154643 TAGAGCAATAACACAGATAATGG - Intergenic
1068315621 10:55337864-55337886 TATAGAGACAATTCACAGAATGG + Intronic
1068445034 10:57109703-57109725 TGAAGCAACAACCCACAGAATGG + Intergenic
1068591641 10:58858907-58858929 TGAAGACACAACTCACAGAATGG - Intergenic
1068641991 10:59419409-59419431 TGAAGAGACAACTCACAGAATGG + Intergenic
1068833883 10:61530561-61530583 TGAAGAGACAACTCACAGAATGG + Intergenic
1068889045 10:62129411-62129433 TAAAACAACAACTCCAAGAATGG + Intergenic
1069276918 10:66604135-66604157 TAAAGCGACAACCTACAGAATGG + Intronic
1069368197 10:67715570-67715592 TAGAGTAACAGTTCAGAGAAGGG - Intergenic
1069397357 10:68004336-68004358 TGAAGAAACAACTCACAGAATGG - Intronic
1070454172 10:76593447-76593469 TAGATGAACAACCTACAGAATGG - Intergenic
1071278753 10:84080170-84080192 TAGAGCAGCAGCTCTCAAAATGG - Intergenic
1071885698 10:89948226-89948248 TGAAGAAACAACCCACAGAATGG + Intergenic
1071918520 10:90323898-90323920 TAGAGGAACTAGTCAGAGAAAGG - Intergenic
1072103523 10:92251998-92252020 TCGAATAAAAACTCACAGAATGG + Intronic
1073380621 10:103075382-103075404 AAGAGCAACAACACCCAGACTGG + Intronic
1073552817 10:104418926-104418948 CAGAGCAAAAACCCACAGACAGG - Intronic
1073599169 10:104830073-104830095 TAGAGGAACAACACACACCAGGG - Intronic
1073658717 10:105448025-105448047 TAAACCAACAACCCACAGAATGG - Intergenic
1073901441 10:108226557-108226579 TATAGCATCAATTCACTGAATGG + Intergenic
1073904990 10:108268174-108268196 TAAAGAGACAACCCACAGAATGG - Intergenic
1074029558 10:109672490-109672512 TAAACAGACAACTCACAGAATGG + Intergenic
1074217829 10:111404884-111404906 CAGAGGAACAAATAACAGAAAGG - Intergenic
1074408824 10:113205733-113205755 TAAAGCAACTACCCACAGAATGG + Intergenic
1074408905 10:113206878-113206900 TAAAGCAACTACCCACAGAATGG + Intergenic
1074804552 10:117035530-117035552 TGAAGAGACAACTCACAGAATGG + Intronic
1074812438 10:117119247-117119269 TAAAGAGACAACCCACAGAATGG + Intronic
1074874857 10:117605864-117605886 AACAGAAACAATTCACAGAACGG - Intergenic
1076095045 10:127726467-127726489 TGAAGAGACAACTCACAGAATGG + Intergenic
1077721072 11:4629379-4629401 TAAACAAACAACTTACAGAATGG - Intergenic
1077879196 11:6334832-6334854 TTGAGCCACCACTCAAAGAATGG - Intergenic
1078124553 11:8547661-8547683 TGAAGCAACAACCTACAGAATGG - Intronic
1078494732 11:11805105-11805127 TAAAGAAACAACATACAGAATGG + Intergenic
1078684664 11:13517522-13517544 TAAAGTAACAACCCACACAATGG - Intergenic
1078898309 11:15617799-15617821 AAGAGAGACAACTCAAAGAAAGG + Intergenic
1079742282 11:24077675-24077697 TTTAGAAACAACACACAGAAGGG - Intergenic
1079836868 11:25346578-25346600 TAAAACAACAACCTACAGAATGG - Intergenic
1080315862 11:30947770-30947792 TAAAGAGACAACCCACAGAATGG + Intronic
1080947700 11:36993483-36993505 TAAACCAACAATTCACAGAGAGG - Intergenic
1081011564 11:37819516-37819538 TGAAGCGACAACCCACAGAATGG + Intergenic
1083133870 11:60653237-60653259 TATAGCAGCAACCTACAGAATGG - Intergenic
1084989733 11:72910931-72910953 TGAAGCAACAACCCACAGAATGG - Intronic
1085147842 11:74218938-74218960 TGAAGAAACAACCCACAGAATGG + Intronic
1085648154 11:78241473-78241495 GAGATCAACAAATTACAGAAAGG + Intronic
1085749066 11:79144004-79144026 TAAAGAGACAACCCACAGAATGG + Intronic
1085998407 11:81950544-81950566 TAAACCAATAACCCACAGAATGG - Intergenic
1086496987 11:87414493-87414515 TAAACCAACAACATACAGAATGG + Intergenic
1086587220 11:88467499-88467521 TGAAGAGACAACTCACAGAATGG - Intergenic
1086747223 11:90444238-90444260 AAGAGCAAAAACTCACTGAAAGG + Intergenic
1086759814 11:90613837-90613859 TAAAGAGACAACCCACAGAATGG - Intergenic
1086838138 11:91652109-91652131 TCAAGAAACAACACACAGAATGG - Intergenic
1086985778 11:93247651-93247673 TAAAGAGACAACCCACAGAATGG - Intergenic
1087414039 11:97829864-97829886 TAAACCAACAACATACAGAATGG + Intergenic
1087987635 11:104704170-104704192 TAGAGACAAAACTCATAGAAAGG + Intergenic
1088018476 11:105089630-105089652 TAAAGAAAAAACTCACAGAATGG + Intronic
1088387667 11:109277106-109277128 TGGAGTGACAACCCACAGAATGG - Intergenic
1088603466 11:111505681-111505703 TAAAAAGACAACTCACAGAATGG + Intronic
1090515275 11:127418435-127418457 TAAAGAGACAACCCACAGAACGG - Intergenic
1091126125 11:133099854-133099876 TAAATGAACAACTTACAGAATGG - Intronic
1091867030 12:3848856-3848878 TGAAGAAACAAGTCACAGAATGG + Intronic
1092685807 12:11044495-11044517 TAAAGAGACAACCCACAGAATGG + Intronic
1092690228 12:11100819-11100841 TAGAGAAAAAAATCATAGAAAGG - Intronic
1092706065 12:11286149-11286171 GAGAGCTTCAACTGACAGAAAGG - Intergenic
1093858827 12:24138181-24138203 CAGTGCACCAACTCAGAGAACGG + Intergenic
1094391500 12:29956094-29956116 TACAAAGACAACTCACAGAATGG + Intergenic
1094440967 12:30476507-30476529 TGAAGAGACAACTCACAGAATGG + Intergenic
1094836581 12:34324974-34324996 TACAGCAAGAAGGCACAGAAGGG - Intergenic
1095170046 12:39023773-39023795 TAAAGAGACAACCCACAGAATGG + Intergenic
1095748656 12:45687405-45687427 TTGAGCAAAAATTCACAGATTGG - Intergenic
1096224475 12:49856995-49857017 TGAAGAAACAACCCACAGAATGG - Intergenic
1097207728 12:57337470-57337492 TAAGGCAACAACTCAGAAAATGG + Intronic
1097425456 12:59438697-59438719 TGAAGAGACAACTCACAGAATGG - Intergenic
1097509036 12:60513093-60513115 TGAAGCGACAACCCACAGAATGG + Intergenic
1097567975 12:61294713-61294735 TAGAAGAAAAACTAACAGAAAGG + Intergenic
1098213328 12:68188671-68188693 AAGAGAAACCACACACAGAAAGG + Intergenic
1099003654 12:77211505-77211527 TAAAGTAACAACCCACAGAATGG - Intergenic
1099100495 12:78433884-78433906 TGAAGAGACAACTCACAGAATGG - Intergenic
1099409169 12:82303455-82303477 TAGAGGTAAAACTCACAAAAGGG - Intronic
1099572653 12:84344199-84344221 TACACAAACAACTCACAGAATGG - Intergenic
1099732219 12:86519841-86519863 TAAAGTAATAACCCACAGAATGG - Intronic
1099782058 12:87208571-87208593 TGAAGAGACAACTCACAGAATGG + Intergenic
1100087112 12:90925076-90925098 TAAAGCAACCACTGACATAAGGG + Intronic
1100325695 12:93537910-93537932 TAGAGCAACATAGCAAAGAAAGG - Intergenic
1100582877 12:95952020-95952042 TGAAGAAACAACCCACAGAATGG - Intronic
1100627522 12:96350898-96350920 GAGTGAAACAACCCACAGAATGG + Intronic
1101103267 12:101416389-101416411 AAGTGAAAAAACTCACAGAATGG - Intergenic
1101162103 12:101988406-101988428 TGAAGAGACAACTCACAGAATGG - Intronic
1101271942 12:103156648-103156670 GAGAGAAACAACACACACAAGGG - Intronic
1101460952 12:104893055-104893077 TAAAGAGACAACCCACAGAATGG + Intronic
1103115449 12:118325655-118325677 TAAAGAGACAACCCACAGAATGG - Intronic
1103326331 12:120123563-120123585 TAGAGAAATAGCTCACAGGAGGG + Intergenic
1103412658 12:120723744-120723766 TAGTTCAACTACTTACAGAAGGG - Intergenic
1104102670 12:125628585-125628607 TAAAGAGACAACCCACAGAACGG - Intronic
1104726673 12:131081585-131081607 TACAACAACAGCACACAGAACGG - Intronic
1105739166 13:23304050-23304072 AAGACAAACAATTCACAGAAAGG - Intronic
1105886448 13:24646645-24646667 TAGACCAAAAATTCTCAGAAGGG - Intergenic
1107085718 13:36426052-36426074 TGAAGAGACAACTCACAGAATGG + Intergenic
1107224157 13:38026895-38026917 TGAAGAAACAACCCACAGAATGG - Intergenic
1107244603 13:38278595-38278617 TAGAGAGACAACCTACAGAATGG - Intergenic
1108240905 13:48462536-48462558 AAGTGAAACAACTCACAGAATGG - Intronic
1108982682 13:56538410-56538432 TAAACAGACAACTCACAGAATGG - Intergenic
1109148183 13:58809102-58809124 TATGGCAACAACTCACAGCAGGG - Intergenic
1109336204 13:60997967-60997989 TAAAGAAACAACCCACAGAATGG - Intergenic
1109504540 13:63283171-63283193 TAGAGAGACAACTCACAGAGTGG - Intergenic
1109935197 13:69273538-69273560 TAAATAAACAACTGACAGAATGG - Intergenic
1109944286 13:69412002-69412024 TAAACAGACAACTCACAGAATGG - Intergenic
1109966030 13:69697760-69697782 TAAACAGACAACTCACAGAAGGG + Intergenic
1110910917 13:80961857-80961879 TGAAGAAACAACCCACAGAATGG - Intergenic
1110965884 13:81696608-81696630 TGAAGGAACAACCCACAGAAGGG + Intergenic
1110980573 13:81891491-81891513 TGAAGAAACAACCCACAGAATGG + Intergenic
1111426412 13:88090166-88090188 TAAAGAGACAACACACAGAATGG - Intergenic
1112068560 13:95821516-95821538 TAAACCTACAACCCACAGAATGG - Intronic
1112944203 13:104906336-104906358 TGAAGGAACAACCCACAGAATGG - Intergenic
1112976749 13:105329284-105329306 CAAAGAGACAACTCACAGAATGG + Intergenic
1113546917 13:111159801-111159823 TTAAGAGACAACTCACAGAACGG - Intronic
1114006839 14:18322798-18322820 TGGAACAACAACTCAAAGAATGG + Intergenic
1114907548 14:27149628-27149650 TGGAGAGACAACCCACAGAATGG - Intergenic
1115390542 14:32850019-32850041 TAAAGAGACAACACACAGAATGG - Intergenic
1116417143 14:44692319-44692341 CAGAGCAAGAAATAACAGAAAGG + Intergenic
1116571172 14:46517487-46517509 TAAAAAGACAACTCACAGAATGG + Intergenic
1116616048 14:47140857-47140879 TGAAGAAACAACTTACAGAATGG + Intronic
1116626765 14:47274999-47275021 TGAAGCAACACCTCACAGAATGG - Intronic
1116741897 14:48766311-48766333 TAAAGAGACAACCCACAGAATGG + Intergenic
1117113187 14:52480375-52480397 TAAACAGACAACTCACAGAATGG + Intronic
1117224825 14:53645028-53645050 TAAAGAAACAACCTACAGAATGG - Intergenic
1117650059 14:57895060-57895082 TAGAGCTGCAAATCTCAGAAAGG + Intronic
1117856075 14:60035286-60035308 TAAAGCTACAACCCACAGAATGG - Intronic
1117864577 14:60132661-60132683 TAAAAAGACAACTCACAGAATGG + Intronic
1118099303 14:62578273-62578295 TAAAGAGACAACTCACACAATGG + Intergenic
1119489801 14:75021357-75021379 TAGACGGACAACTTACAGAATGG + Intronic
1119938159 14:78612139-78612161 TACAGCAACAACTTAGAGAAGGG - Intronic
1120684546 14:87523100-87523122 TAGAGCAACAAATAATAGGAAGG + Intergenic
1121420481 14:93809749-93809771 TAGATCAGAAACTCTCAGAAAGG + Intergenic
1121554123 14:94823493-94823515 GAGGGCAAAAACTCAGAGAAAGG - Intergenic
1121687564 14:95849009-95849031 TAAAGAGACAACCCACAGAATGG - Intergenic
1121725664 14:96147415-96147437 TAAGGCAACAACTAACATAATGG - Intergenic
1122508623 14:102248406-102248428 AAGAGCAGGAACTTACAGAAGGG - Intronic
1123143021 14:106099755-106099777 TAAAAAGACAACTCACAGAACGG - Intergenic
1123191056 14:106570441-106570463 TAAAAAGACAACTCACAGAACGG - Intergenic
1123390771 15:19869456-19869478 TGGAACAACAACTCAAAGAATGG + Intergenic
1123800926 15:23819754-23819776 TAGACCAAAAATTCTCAGAAGGG + Intergenic
1123828431 15:24107171-24107193 TAAAGAAACAACCTACAGAATGG - Intergenic
1123843340 15:24270752-24270774 TAAAGAAACAACCTACAGAATGG - Intergenic
1123858418 15:24436970-24436992 TAAAGAAACAACCTACAGAATGG - Intergenic
1123863052 15:24487434-24487456 TAAAGAAACAACCTACAGAATGG - Intergenic
1123868269 15:24544341-24544363 TGAAGCAACAACCCACAGAATGG - Intergenic
1124131397 15:26990561-26990583 TAAAGAGACAACTCACAGATGGG - Intronic
1124969949 15:34478203-34478225 TAGAGTCACAACTCTAAGAAAGG + Intergenic
1125145409 15:36461731-36461753 TAAACAGACAACTCACAGAATGG - Intergenic
1125761536 15:42099335-42099357 AAAAACAACAACTCACAAAATGG + Intergenic
1126534422 15:49745786-49745808 AAAGGCAACAACCCACAGAATGG + Intergenic
1127050583 15:55079448-55079470 TAAACAGACAACTCACAGAATGG + Intergenic
1127177562 15:56376692-56376714 TAAAGAGACAACCCACAGAATGG - Intronic
1128867763 15:71127852-71127874 TAAAGAGACAACCCACAGAATGG - Intronic
1129501704 15:76044996-76045018 AAAAGAAACAACCCACAGAATGG + Intronic
1129562259 15:76583474-76583496 TGAAGAAACAACCCACAGAATGG + Intronic
1130802964 15:87285569-87285591 TAAAAAGACAACTCACAGAATGG + Intergenic
1131634476 15:94216537-94216559 TGAAGAAACAACCCACAGAATGG + Intergenic
1131710489 15:95049475-95049497 TAGAAAAACAACTAACAAAATGG + Intergenic
1132349412 15:101129751-101129773 TAAAGAGACAAGTCACAGAATGG + Intergenic
1132438838 15:101838495-101838517 CAAAGAGACAACTCACAGAATGG - Intergenic
1133160144 16:3905959-3905981 TAAAGAAACAACCCACAGAATGG + Intergenic
1133171047 16:3982696-3982718 AAGAGAAAGAACCCACAGAACGG - Intronic
1134225184 16:12384655-12384677 TGAAGAAACAACCCACAGAATGG - Intronic
1134376267 16:13677522-13677544 TAAACCAACAACCCACAGAATGG - Intergenic
1134406452 16:13963335-13963357 TGAAGAAACAACCCACAGAATGG - Intergenic
1135674037 16:24399936-24399958 TGAAAAAACAACTCACAGAATGG + Intergenic
1136651169 16:31672865-31672887 TAAACAAACAACCCACAGAATGG - Intergenic
1136676174 16:31908338-31908360 TGAAGAAACAACCCACAGAATGG - Intronic
1137333234 16:47522016-47522038 TAAACCAACAAAACACAGAATGG - Intronic
1138456363 16:57123342-57123364 TAGAGCAACAACTCCCCCATGGG + Intronic
1138916908 16:61475492-61475514 TGAAGAGACAACTCACAGAATGG + Intergenic
1139407493 16:66730634-66730656 TAGAGAAACAACCCACAGGAGGG - Intronic
1139799568 16:69510994-69511016 TGAAGCAAAAACTGACAGAATGG + Intergenic
1139985725 16:70897053-70897075 TAGACTGACAACCCACAGAATGG + Intronic
1143436078 17:6926873-6926895 TGCAGAAACAACTCACAGATTGG + Intronic
1143470232 17:7169251-7169273 TAGACCAAAAATTCTCAGAAGGG - Intergenic
1144079699 17:11752737-11752759 TTTAGCTACAACACACAGAAGGG - Intronic
1144331042 17:14224452-14224474 GAGAGCACCTACTCACAGAGTGG - Intergenic
1145895027 17:28451511-28451533 TAAACAAACAACCCACAGAATGG - Intergenic
1147351624 17:39851960-39851982 TACACCAACCACTCACTGAATGG + Intronic
1147705177 17:42421349-42421371 CAGAGCCACAACTCCCGGAAAGG + Intronic
1148398665 17:47333377-47333399 GTGAGAAACAACCCACAGAAAGG - Intronic
1149165594 17:53748437-53748459 TAGACCAAAAATTCTCAGAAGGG - Intergenic
1149240905 17:54647790-54647812 TGAAGAGACAACTCACAGAATGG + Intergenic
1149948864 17:60962678-60962700 TGAAGAAACAACCCACAGAATGG - Intronic
1149999174 17:61422019-61422041 TAGAAATGCAACTCACAGAACGG + Intergenic
1150984897 17:70184728-70184750 TACAGCAACAACAAACAGAGTGG - Intergenic
1151011046 17:70496500-70496522 GAGGGAAACAACTCACATAAAGG + Intergenic
1151503277 17:74506643-74506665 TGAAGCAACAATCCACAGAATGG - Intergenic
1151762339 17:76112482-76112504 TGAAGAGACAACTCACAGAATGG + Intronic
1153837129 18:8973619-8973641 TGAAGCGACAACCCACAGAATGG - Intergenic
1154038454 18:10830733-10830755 TAAAGAGACAATTCACAGAATGG + Intronic
1154387438 18:13907576-13907598 TGAAGAGACAACTCACAGAATGG + Intronic
1154530625 18:15341201-15341223 TGGAACAACAACTCAAAGAATGG - Intergenic
1155116311 18:22771678-22771700 TGAAGAAACAACCCACAGAATGG + Intergenic
1157894513 18:51452255-51452277 TAGAGCAAAAAGACAGAGAAAGG - Intergenic
1157942796 18:51947349-51947371 TAGAGCAAGTACAAACAGAAAGG + Intergenic
1158432716 18:57404177-57404199 TAGAGCAGTAACTCAGGGAATGG - Intergenic
1158839120 18:61364605-61364627 TAGAGTAAGAACTCACAGCTGGG - Intronic
1159371503 18:67532803-67532825 TATAGCAACAAATAACAGGAAGG + Intergenic
1160138045 18:76291002-76291024 TGAAGAGACAACTCACAGAATGG - Intergenic
1168048923 19:53814245-53814267 CAGAGCAACCACTGACAGAGGGG - Intronic
1168374566 19:55865858-55865880 TGAAACGACAACTCACAGAATGG - Intronic
925857967 2:8148991-8149013 AAGAGCACCAACTCACCGTATGG + Intergenic
925863329 2:8201515-8201537 CAAAGCAAGAACTCAGAGAATGG + Intergenic
926479134 2:13366787-13366809 TGAAGAGACAACTCACAGAATGG + Intergenic
926876449 2:17485469-17485491 TAAGGCAACAAATCTCAGAATGG - Intergenic
927309364 2:21611949-21611971 TAAAGAGACAACCCACAGAATGG - Intergenic
927353513 2:22146592-22146614 TAAACAGACAACTCACAGAATGG - Intergenic
927649951 2:24906492-24906514 TAGAGCAAAAAGGCACTGAAGGG + Intronic
928608748 2:32970201-32970223 TAAACAGACAACTCACAGAATGG - Intronic
928833009 2:35511581-35511603 TAGAGCAAGAACAGAAAGAAAGG + Intergenic
930617954 2:53613735-53613757 TAAAGAGACAACCCACAGAATGG - Intronic
930822851 2:55664616-55664638 TAGAGAAACAAAAAACAGAAGGG + Intronic
931001482 2:57789152-57789174 TGAAGACACAACTCACAGAATGG - Intergenic
931457342 2:62422297-62422319 TGAAGAGACAACTCACAGAATGG + Intergenic
932661862 2:73661666-73661688 TCAAGAGACAACTCACAGAATGG - Intergenic
933604453 2:84367512-84367534 TAAAGAAACAACCTACAGAATGG + Intergenic
933617713 2:84499967-84499989 TGAAGAGACAACTCACAGAATGG - Intergenic
935124334 2:100209985-100210007 TGAAGCAACAACTCACGGAATGG - Intergenic
935629237 2:105198703-105198725 TGAAGAGACAACTCACAGAATGG + Intergenic
936121887 2:109753668-109753690 TAAAGAGACAACCCACAGAATGG - Intergenic
936222808 2:110617804-110617826 TAAAGAGACAACCCACAGAATGG + Intergenic
936790996 2:116151810-116151832 TAAAGAAACAACCTACAGAATGG - Intergenic
936800614 2:116260646-116260668 TAGACCAAAAATTCTCAGAAAGG - Intergenic
936910517 2:117587122-117587144 TGAAGCAATAACCCACAGAATGG + Intergenic
938367610 2:130747287-130747309 TAGAGCAACAAACCACAGCCTGG + Intergenic
938529725 2:132172673-132172695 TGGAACAACAACTCAAAGAATGG - Intronic
938622741 2:133073544-133073566 TGGAACCACAGCTCACAGAAGGG + Intronic
938863642 2:135395872-135395894 TAAAGAGACAACCCACAGAATGG + Intronic
938867962 2:135443841-135443863 TAAAGTAACAAGTCACAGACTGG + Intronic
939416004 2:141898138-141898160 TTGATCAGCAAATCACAGAAGGG - Intronic
939421100 2:141970216-141970238 TAAAGCAACTACCCACAGACAGG - Intronic
939592703 2:144085035-144085057 TAGAGCAGAAACTCAAAGAGCGG - Intronic
940031645 2:149269585-149269607 TGAAGAGACAACTCACAGAATGG + Intergenic
940069262 2:149666803-149666825 TAGAGCAAGAATTCACAGAAGGG - Intergenic
940503324 2:154521723-154521745 TGAAGCAAAAACTCACAAAATGG - Intergenic
941204208 2:162551197-162551219 AACAGCAAAAACTGACAGAATGG + Intronic
941671972 2:168303869-168303891 TAAAGAGACAACCCACAGAATGG - Intergenic
942362724 2:175189335-175189357 TGGAGAGACAACCCACAGAATGG - Intergenic
942617122 2:177804161-177804183 TAAACAAACAACCCACAGAATGG + Intronic
943057402 2:182999200-182999222 TAAAGAGACAACTTACAGAATGG + Intronic
943207775 2:184922536-184922558 TGAAGAGACAACTCACAGAATGG - Intronic
944028003 2:195195162-195195184 TAAATAGACAACTCACAGAATGG + Intergenic
944099657 2:196009714-196009736 TAGAGAGACAACCTACAGAATGG + Intronic
944284763 2:197936686-197936708 TGAAGAGACAACTCACAGAATGG - Intronic
944370609 2:198978563-198978585 TAAAGAGACAACTTACAGAATGG + Intergenic
944392697 2:199234140-199234162 TAAAGCAACAAGTCATAGACTGG - Intergenic
945211178 2:207384105-207384127 TAAAGAGACAACCCACAGAATGG + Intergenic
945513564 2:210733170-210733192 TAGAGCAACAACTAAAAGTATGG + Intergenic
945823435 2:214692195-214692217 TAGAAATACAACTCACAGCATGG + Intergenic
947130534 2:226919260-226919282 TGAAGAGACAACTCACAGAATGG - Intronic
947320285 2:228909615-228909637 GTGAGCAACAACCTACAGAATGG - Intronic
1168886358 20:1261275-1261297 TAAAGCAAAAACTGACAGAATGG - Intronic
1168899390 20:1348919-1348941 TAAAGAGACAACCCACAGAATGG - Intronic
1169331809 20:4722128-4722150 TATAGCACCAACTTAGAGAAAGG - Intronic
1169897561 20:10520451-10520473 TAAAGAGACAATTCACAGAATGG - Intronic
1170636929 20:18114951-18114973 TAGAGAGACAACCCAGAGAATGG - Intergenic
1171938370 20:31298886-31298908 TAAAAAAACAACCCACAGAATGG + Intergenic
1172432500 20:34904289-34904311 TTGAGCAACGACTCAAAGATAGG + Intronic
1173737917 20:45374856-45374878 TAGACCAACATCATACAGAAGGG - Intronic
1174237856 20:49108916-49108938 TGAAAAAACAACTCACAGAATGG + Intergenic
1175343687 20:58253490-58253512 CAAAGAGACAACTCACAGAATGG + Intergenic
1175438169 20:58970062-58970084 TGAAGAGACAACTCACAGAATGG + Intergenic
1176766785 21:13027251-13027273 TGGAACAACAACTCAAAGAATGG + Intergenic
1176918256 21:14652738-14652760 TGAAGAAACAACCCACAGAATGG + Intronic
1176931072 21:14810882-14810904 AAAAGAAACAACCCACAGAATGG + Intergenic
1177338647 21:19767628-19767650 TAAACAGACAACTCACAGAATGG - Intergenic
1177367803 21:20160156-20160178 TAAACAAACAACTCACAGCATGG + Intergenic
1177401353 21:20609667-20609689 TGAAGAGACAACTCACAGAATGG + Intergenic
1177659395 21:24063330-24063352 TAAACCGACAACCCACAGAATGG - Intergenic
1178004519 21:28202740-28202762 TGTAGAGACAACTCACAGAATGG + Intergenic
1178394262 21:32226592-32226614 TAAAGCAAAAACTGACAAAATGG + Intergenic
1179158121 21:38868654-38868676 CAGAGAAACAAGTCATAGAATGG + Intergenic
1179825439 21:43962960-43962982 TAAAGCAAAAACTTACAGACAGG + Intronic
1180431348 22:15253608-15253630 TGGAACAACAACTCAAAGAATGG + Intergenic
1180513910 22:16121538-16121560 TGGAACAACAACTCAAAGAATGG + Intergenic
1180763994 22:18232720-18232742 TCATGCAACAACTGACAGAAGGG - Intergenic
1180771650 22:18391822-18391844 TCATGCAACAACTGACAGAAGGG + Intergenic
1180803027 22:18641436-18641458 TCATGCAACAACTGACAGAAGGG + Intergenic
1181218688 22:21353824-21353846 TCATGCAACAACTGACAGAAGGG - Intergenic
1181390772 22:22579374-22579396 GAGACCAACAACACACAGCAGGG + Intergenic
1181454705 22:23051805-23051827 TAAAGAGACAACTCACAGAGTGG + Intergenic
1181717879 22:24747503-24747525 TAGAGCAACAACTCACAGAATGG + Intronic
1203233487 22_KI270731v1_random:132813-132835 TCATGCAACAACTGACAGAAGGG + Intergenic
949316620 3:2763419-2763441 TAAAGAGACAACACACAGAATGG - Intronic
951028471 3:17854729-17854751 TGAAGAAACAACCCACAGAATGG - Intronic
951380199 3:21974625-21974647 TGAAGAAACAACCCACAGAATGG + Intronic
951397431 3:22186379-22186401 CACAGGAACAAGTCACAGAAGGG + Intronic
951793527 3:26513198-26513220 TGAAGAAACAACCCACAGAATGG - Intergenic
952923505 3:38305391-38305413 TTGAGCCAAAACTCTCAGAAGGG - Intronic
953087749 3:39688433-39688455 TGAAGAGACAACTCACAGAATGG + Intergenic
954471630 3:50701523-50701545 TAAAGAGACAACACACAGAATGG - Intronic
954529409 3:51305198-51305220 TAATGCAAAAACTGACAGAATGG - Intronic
955584827 3:60465309-60465331 TGAAGAGACAACTCACAGAATGG - Intronic
956635207 3:71357032-71357054 GGGAGCAACAAATCACAGAAAGG + Intronic
956927201 3:74002330-74002352 TAGAGACACAACTCACAGGCTGG + Intergenic
957006908 3:74959406-74959428 TAGAGAAACAACTCACCGAATGG - Intergenic
957421101 3:79971442-79971464 TAAAGCAACAACCTGCAGAATGG + Intergenic
957659746 3:83132846-83132868 TAGACCACTTACTCACAGAAGGG + Intergenic
958175869 3:89995809-89995831 TGGAGCAACAAATGACACAAAGG + Intergenic
958557622 3:95700671-95700693 GAGAGAGACAACCCACAGAATGG + Intergenic
958831081 3:99090159-99090181 TAAAGAGACAACTTACAGAATGG + Intergenic
958842402 3:99223339-99223361 TGCAGAGACAACTCACAGAATGG + Intergenic
959443663 3:106410982-106411004 AAAAGAGACAACTCACAGAATGG - Intergenic
959950300 3:112174223-112174245 AGGGGCAACAACTTACAGAATGG - Intronic
960499295 3:118417372-118417394 TGAAGAAACAACCCACAGAATGG + Intergenic
960748737 3:120921413-120921435 TAAAGAGACAACCCACAGAATGG - Intronic
961355786 3:126339176-126339198 CAGAGCAGGACCTCACAGAATGG + Intergenic
961909820 3:130302844-130302866 TAGAGCAATAATTCAGGGAAAGG + Intergenic
962058038 3:131894426-131894448 TAAAGAGACAACTTACAGAATGG + Intronic
962124010 3:132595507-132595529 TAAAGAGACAACTTACAGAATGG + Intronic
962470257 3:135701273-135701295 TAAACAAACAACCCACAGAATGG + Intergenic
962698804 3:137977182-137977204 TGAAGAGACAACTCACAGAATGG - Intergenic
962974712 3:140436009-140436031 TGAAGAGACAACTCACAGAATGG - Intronic
963013035 3:140792697-140792719 TAAAGTGACAACTCACAAAATGG + Intergenic
964234979 3:154514619-154514641 TAAAGAGACAACCCACAGAATGG - Intergenic
964828383 3:160855428-160855450 TAAACCAACAGCCCACAGAATGG + Intronic
965010124 3:163077343-163077365 TAAAGAGACAACTCACAGAATGG + Intergenic
965236489 3:166130868-166130890 TAAAGAGACAACCCACAGAATGG - Intergenic
965237722 3:166147836-166147858 TGAAGAGACAACTCACAGAATGG + Intergenic
965348919 3:167588874-167588896 TGAAGAAACAACCCACAGAACGG - Intronic
965571390 3:170177237-170177259 TAGAGCCCCAACATACAGAATGG - Intronic
965620134 3:170634653-170634675 AAAAGCCACAACTCACAGAAGGG - Intronic
966090150 3:176124308-176124330 TGTAAAAACAACTCACAGAACGG - Intergenic
966138156 3:176724536-176724558 TAAAGAGACAACCCACAGAATGG - Intergenic
966403864 3:179574967-179574989 TAGAGCAACAGCGTAAAGAATGG - Intronic
966491825 3:180536161-180536183 TGAAGAAACAACCCACAGAATGG + Intergenic
966753396 3:183344360-183344382 TAAAGGAACAAGTCACAGATTGG + Intronic
967137781 3:186527044-186527066 TAAAGAGACAACCCACAGAATGG + Intergenic
967308185 3:188079686-188079708 TAAAGAAACAAATCACAGACTGG + Intergenic
967538802 3:190640707-190640729 TAGAGCAAGAACTCAAAACAGGG + Intronic
971084825 4:23261082-23261104 TAAAAAAACAACACACAGAATGG - Intergenic
971694079 4:29875008-29875030 TAAACAAACAACTCACAGAATGG - Intergenic
971722717 4:30267359-30267381 TAGGACGACAACTTACAGAAAGG + Intergenic
971838076 4:31795183-31795205 TAAAGAGACAACCCACAGAATGG - Intergenic
972580353 4:40390096-40390118 TAAAGCAATAATTCACAGAATGG + Intergenic
972974113 4:44612599-44612621 TGGAGCAACCATCCACAGAATGG - Intergenic
973143841 4:46800817-46800839 TAAACAGACAACTCACAGAATGG + Intronic
973215203 4:47660379-47660401 TGAAGAGACAACTCACAGAATGG + Intronic
974248568 4:59355708-59355730 TAAACCAACAGCTTACAGAATGG - Intergenic
974323137 4:60378417-60378439 CAGAGCCACAGCTCATAGAAGGG - Intergenic
974352491 4:60767514-60767536 TAAAGAGACAACCCACAGAATGG - Intergenic
974372700 4:61038125-61038147 TAAACCAACAACCCACAGAGTGG - Intergenic
974905973 4:68057562-68057584 TGAAGAGACAACTCACAGAATGG + Intronic
974987508 4:69046527-69046549 TAAACAGACAACTCACAGAATGG - Intronic
975284532 4:72601905-72601927 TAGAACAAAAAGGCACAGAAAGG - Intergenic
975346512 4:73298664-73298686 TAAAGAAACGACCCACAGAATGG + Intergenic
975390232 4:73807676-73807698 TAAACAGACAACTCACAGAATGG + Intergenic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
976017350 4:80573399-80573421 TAAAGAGACAACCCACAGAATGG - Intronic
976128882 4:81862976-81862998 TAAAGAGACAACCCACAGAATGG + Intronic
976772790 4:88672134-88672156 TTCAGCATCAAGTCACAGAAAGG - Intronic
976908604 4:90271695-90271717 TAAAGAGACAACCCACAGAATGG + Intronic
977641748 4:99365157-99365179 TGAAGAGACAACTCACAGAATGG - Intergenic
977762405 4:100754982-100755004 TTAAGCAACAACCCACAGAATGG + Intronic
977773228 4:100884281-100884303 TGAAGGGACAACTCACAGAATGG - Intergenic
978098403 4:104807391-104807413 TAAAGAAACAACTGATAGAATGG + Intergenic
978614306 4:110578632-110578654 TAGACAGACAACTTACAGAATGG - Intergenic
978655150 4:111057048-111057070 TAAGGAAACAACCCACAGAATGG + Intergenic
978663935 4:111160619-111160641 CAGAGATACAACCCACAGAATGG + Intergenic
979028822 4:115612753-115612775 TAAAAAAGCAACTCACAGAAAGG + Intergenic
979142239 4:117191594-117191616 TAAAGAGACAACACACAGAATGG - Intergenic
979480561 4:121211802-121211824 TAGAGTTACCACACACAGAAAGG + Intronic
979564567 4:122139645-122139667 TGAAACAACAACCCACAGAATGG - Intergenic
979682555 4:123477871-123477893 CAGAAAAACAACTCCCAGAAAGG + Intergenic
980255690 4:130378124-130378146 TATATCAACAACCTACAGAATGG - Intergenic
980850685 4:138377670-138377692 TGAAGAAACAACCCACAGAATGG + Intergenic
980926917 4:139147091-139147113 TAAAGAGACAACCCACAGAATGG + Intronic
980960138 4:139466911-139466933 TGAAGAGACAACTCACAGAATGG - Intronic
981558254 4:146018756-146018778 TAAAGAGACAACCCACAGAATGG - Intergenic
982409221 4:155055177-155055199 TAAAACAATAACTCACAGAATGG + Intergenic
982625645 4:157762646-157762668 TAAAGCAACAAATCATAAAAAGG + Intergenic
983017661 4:162634226-162634248 TGAAGAGACAACTCACAGAATGG + Intergenic
983458277 4:167992955-167992977 TGAAGCGACAACCCACAGAAGGG - Intergenic
983588435 4:169381530-169381552 TGAAGAAACAACCCACAGAATGG + Intergenic
983876965 4:172888124-172888146 TACACAAACAACCCACAGAATGG - Intronic
984239321 4:177198713-177198735 TAAAGAGACAACCCACAGAATGG - Intergenic
984301940 4:177931202-177931224 AAGTGAAATAACTCACAGAAAGG - Intronic
985294119 4:188416371-188416393 TAGAGCAAAAACACAGAGAAAGG - Intergenic
986227838 5:5833272-5833294 TAAACAGACAACTCACAGAATGG + Intergenic
986317861 5:6602833-6602855 TATAACACCAACTCCCAGAATGG + Intronic
986601998 5:9481758-9481780 TAGACCAGGAAATCACAGAAAGG + Intronic
986913241 5:12584142-12584164 TAAAAAGACAACTCACAGAATGG - Intergenic
987730963 5:21772108-21772130 AAGCCCAACAACTCACTGAATGG - Intronic
987916493 5:24221383-24221405 TAAACAGACAACTCACAGAATGG - Intergenic
988002940 5:25372554-25372576 TGAAGAGACAACTCACAGAATGG + Intergenic
988894925 5:35662364-35662386 TATACCAACAACCTACAGAATGG - Intronic
989070106 5:37501195-37501217 TAAAGAGACAACCCACAGAATGG - Intronic
989196728 5:38723758-38723780 GAGATCAAGCACTCACAGAATGG - Intergenic
989313619 5:40051080-40051102 GACAGCAACAAATCAAAGAAGGG + Intergenic
989758120 5:44980879-44980901 TAAACAAACAACTTACAGAATGG + Intergenic
990337254 5:54786860-54786882 TAGAGCTACAAGACAGAGAAAGG - Intergenic
990355586 5:54962978-54963000 TTGAGGAAAAACCCACAGAAGGG + Intergenic
990593454 5:57290031-57290053 TGAAGAAACAACCCACAGAATGG + Intergenic
990932370 5:61107523-61107545 TGAAGAGACAACTCACAGAATGG - Intronic
991894906 5:71384875-71384897 TTTATCAACAAGTCACAGAATGG - Intergenic
992669066 5:79040663-79040685 TAAAAAAACAACCCACAGAATGG + Intronic
993249325 5:85497224-85497246 TAGACAGACAACCCACAGAATGG - Intergenic
993425422 5:87757787-87757809 TAAAGACACAACCCACAGAATGG - Intergenic
993914680 5:93729216-93729238 CAGAGGAACAACACAAAGAAAGG - Intronic
993931903 5:93951269-93951291 TGGAGAGACAACCCACAGAAGGG - Intronic
994445347 5:99864967-99864989 TAAAGGAAAAACTCACAAAAGGG + Intergenic
994467269 5:100153788-100153810 TAAAAAAACAACTCACAGAATGG + Intergenic
994488277 5:100407367-100407389 TGGAGCAGCTACTCACATAACGG - Intergenic
994788227 5:104190091-104190113 TATAGCAACAACTGGCTGAAAGG + Intergenic
995420976 5:111966457-111966479 AAGAGAAACTACTAACAGAAGGG + Intronic
995615375 5:113956936-113956958 TAAAGAAACAACTGACAGAATGG - Intergenic
995631920 5:114143432-114143454 TAGACCAAAAATTCTCAGAAGGG + Intergenic
995632558 5:114149833-114149855 TAGACCAAAAATTCTCAGAAGGG + Intergenic
995697957 5:114900831-114900853 TAGAGCAAGGAGGCACAGAAGGG - Intergenic
996504008 5:124248789-124248811 TAAACAAACAACTCACAGAGTGG + Intergenic
997006758 5:129826342-129826364 TAAACCAACAACTTAGAGAATGG + Intergenic
998047041 5:138996461-138996483 TGGAGAGACAACCCACAGAATGG - Intronic
998387305 5:141764914-141764936 AAGAGAAAGAACTCACAGAAAGG + Intergenic
998585573 5:143423186-143423208 TGAAGAGACAACTCACAGAATGG + Intronic
998811237 5:145967958-145967980 TAGAGAAATAACTCACCGTAGGG - Intronic
998845425 5:146304435-146304457 TAAAGAAACAAATCATAGAATGG - Intronic
999560452 5:152795952-152795974 TAAAGAGACAACCCACAGAATGG + Intergenic
999939404 5:156524841-156524863 TAAATCACCAAGTCACAGAAAGG - Intronic
1000731999 5:164846277-164846299 TAAAGAGACAACACACAGAATGG - Intergenic
1001028251 5:168242579-168242601 GTGAGCAACAACTCAAACAATGG + Intronic
1001492140 5:172163438-172163460 AATAGCAACCACTCACAGCAAGG + Intronic
1002555519 5:180035643-180035665 CAAAGCAAAAACTGACAGAATGG - Intronic
1003355269 6:5363336-5363358 TGAAGAGACAACTCACAGAATGG - Intronic
1003437650 6:6107296-6107318 TGAAGAGACAACTCACAGAATGG - Intergenic
1003485428 6:6572266-6572288 TGAAGAGACAACTCACAGAATGG - Intergenic
1003769351 6:9280675-9280697 TGAAGAAACAACCCACAGAATGG + Intergenic
1005903716 6:30242131-30242153 TAGAGCAAGAACTCACCAAAAGG + Intergenic
1005907752 6:30279517-30279539 TAAAGAGACAACCCACAGAATGG - Intergenic
1007022527 6:38536048-38536070 TGAAGAAACAACTCACATAATGG + Intronic
1009373104 6:62932832-62932854 TAAAGTGACAACCCACAGAATGG - Intergenic
1009522850 6:64706515-64706537 TAAATAGACAACTCACAGAATGG + Intronic
1009796875 6:68480599-68480621 TGAAGACACAACTCACAGAATGG + Intergenic
1009892324 6:69701744-69701766 TATAGCATTAACTCAAAGAATGG - Intronic
1010464037 6:76145932-76145954 TGAAGGAACAGCTCACAGAATGG + Intergenic
1010481821 6:76364371-76364393 TGAAGAGACAACTCACAGAATGG - Intergenic
1010611243 6:77955994-77956016 TGAAGAAACAACACACAGAATGG + Intergenic
1011033635 6:82950067-82950089 TGAAGAGACAACTCACAGAATGG + Intronic
1011447520 6:87457873-87457895 TGAAGAGACAACTCACAGAATGG + Intronic
1011520914 6:88204976-88204998 TGAAGAGACAACTCACAGAATGG + Intergenic
1011873193 6:91923073-91923095 TGAAGCGACAACCCACAGAATGG + Intergenic
1012027122 6:94009838-94009860 TGAAGAAGCAACTCACAGAATGG + Intergenic
1012050316 6:94333990-94334012 TGAAGTAACAACCCACAGAATGG + Intergenic
1012698739 6:102424158-102424180 TGAAGATACAACTCACAGAATGG + Intergenic
1012885223 6:104838790-104838812 TAAAGAAACAACCCATAGAATGG + Intronic
1013256053 6:108386874-108386896 TAGAACAACAACTAAAATAAAGG + Intronic
1013558535 6:111281813-111281835 CAAAGAAACAACCCACAGAATGG - Intergenic
1014817433 6:125951336-125951358 TTCAGCAACTACTGACAGAAAGG - Intergenic
1014840386 6:126212715-126212737 TAAAGAGACAACCCACAGAATGG - Intergenic
1015809888 6:137151605-137151627 TAAAAAGACAACTCACAGAATGG + Intronic
1016194712 6:141320117-141320139 TAAAGAGACAACCCACAGAATGG + Intergenic
1016238612 6:141900223-141900245 TAGATAAAGAACTCAAAGAAAGG + Intergenic
1016567167 6:145468841-145468863 TGAAGGAACAACCCACAGAATGG + Intergenic
1016641718 6:146357045-146357067 TAGAGCAAGAAATCTGAGAAAGG - Intronic
1017369077 6:153683348-153683370 TAAAGAGATAACTCACAGAATGG + Intergenic
1017845625 6:158255534-158255556 TACAGCAACAACTCTAAGAATGG + Intronic
1017997999 6:159550382-159550404 TTGAGAGACAACCCACAGAATGG - Intergenic
1018753557 6:166828880-166828902 TGAAACAACAACCCACAGAATGG + Intronic
1018917166 6:168141041-168141063 CAGAGAGACAACCCACAGAATGG - Intergenic
1019660098 7:2219437-2219459 TAGACCATCAACGCACTGAAGGG - Exonic
1020392977 7:7679976-7679998 TAAAGAGACAACCCACAGAATGG - Intronic
1020939756 7:14517516-14517538 TAGAGTAACAACCTACAGATTGG + Intronic
1021771513 7:24006710-24006732 TAAAGAAACAACCTACAGAATGG - Intergenic
1021843158 7:24739180-24739202 TGAAGAGACAACTCACAGAATGG + Intronic
1022853258 7:34288611-34288633 TAAAATGACAACTCACAGAATGG + Intergenic
1024110359 7:46139943-46139965 CAAAGCAACTACTCACAAAATGG - Intergenic
1024286395 7:47761682-47761704 TGAAGAAACAACCCACAGAATGG - Intronic
1024331876 7:48162916-48162938 AAGACCAAGAACTCACTGAAAGG - Intergenic
1024336155 7:48207735-48207757 TTAAGAAACAACTCGCAGAATGG - Intronic
1024490184 7:49973394-49973416 TAAAAATACAACTCACAGAATGG + Intronic
1024778195 7:52813382-52813404 TAAAAAGACAACTCACAGAATGG - Intergenic
1024854582 7:53763400-53763422 TAAACCAACAACCCACAGAGTGG + Intergenic
1026028812 7:66771070-66771092 AAAAGGAACAACACACAGAATGG - Intronic
1028187520 7:87805035-87805057 GAGATCAGCAGCTCACAGAATGG + Intronic
1028327536 7:89545603-89545625 TAGACCAGCAATTCTCAGAAGGG + Intergenic
1029905150 7:104084886-104084908 TAAAAATACAACTCACAGAATGG - Intergenic
1030369184 7:108677871-108677893 TGAAGAGACAACTCACAGAATGG - Intergenic
1030407821 7:109136937-109136959 TAAAGAGACAACTCACATAATGG - Intergenic
1030759711 7:113335335-113335357 TAAAGAAACAACCCACAGAATGG - Intergenic
1031155830 7:118110780-118110802 TAGAGCAACAAACCACAGAGCGG - Intergenic
1031231216 7:119109125-119109147 TAAAGAGACAACCCACAGAATGG - Intergenic
1031305764 7:120124726-120124748 AAGCGCAACAACTCAAAGCAGGG - Intergenic
1031357575 7:120806144-120806166 TAGACCACCAACACATAGAAGGG - Intronic
1031550714 7:123108912-123108934 TAAACAAACAACTCACAGAATGG - Intergenic
1032828914 7:135602492-135602514 TAGAGCAACAGTTCTCAGAATGG - Intronic
1033816299 7:145077577-145077599 TAAACATACAACTCACAGAATGG - Intergenic
1034606673 7:152322752-152322774 TAAAGAGACAACCCACAGAATGG + Intronic
1034855819 7:154545640-154545662 TAGAGCAAAAATTATCAGAAGGG + Intronic
1034857207 7:154563045-154563067 TAGAGAAACAAATCAGAGAAAGG + Intronic
1035349260 7:158234172-158234194 TGAAGAAACAACCCACAGAATGG + Intronic
1035479123 7:159167914-159167936 TAGAGAGACAACCCACAGCATGG + Intergenic
1036744117 8:11391822-11391844 GACAGCCACAGCTCACAGAAGGG + Intronic
1039307909 8:36283516-36283538 TATAGAGACAACCCACAGAATGG - Intergenic
1040405136 8:47093932-47093954 TAAACCAACAACCCATAGAATGG + Intergenic
1040626351 8:49153777-49153799 TAAACAGACAACTCACAGAATGG - Intergenic
1041289531 8:56295988-56296010 TTGAGCAGAAACTCACAGAAGGG + Intergenic
1041456752 8:58068795-58068817 TAGATAAACAACTCTCAGAACGG + Intronic
1041582676 8:59480426-59480448 TGAAGAGACAACTCACAGAATGG - Intergenic
1041816744 8:61981390-61981412 AAGAAAGACAACTCACAGAATGG + Intergenic
1041866170 8:62576168-62576190 TGGAGGGACAACTCTCAGAATGG + Intronic
1042280598 8:67052266-67052288 GAGAGCATCAACACACAAAAAGG + Intronic
1042894330 8:73650688-73650710 TTGATCTACAACTCACAAAAAGG + Intronic
1042898875 8:73701329-73701351 TGAAGAAACAACCCACAGAATGG + Intronic
1042969210 8:74390402-74390424 TAGAAGAAAAACTAACAGAAAGG - Intronic
1043981723 8:86649849-86649871 TAAACAGACAACTCACAGAATGG + Intronic
1044222310 8:89683556-89683578 TAAAGAGACAACCCACAGAATGG + Intergenic
1044513431 8:93110618-93110640 TAGAGCTTCATCTCACAGAGGGG - Intergenic
1045147468 8:99362953-99362975 TGAAGAAACAACACACAGAATGG - Intronic
1045591274 8:103601147-103601169 TGAATCAACAACCCACAGAATGG - Intronic
1046095479 8:109554427-109554449 TAAAACTACAACTCACAGAAGGG - Intronic
1047051107 8:121114401-121114423 TAAAGCAACAACTGAAACAATGG + Intergenic
1047106136 8:121732663-121732685 TAAAGAGACAACCCACAGAATGG - Intergenic
1047593149 8:126348679-126348701 TAGACAGACAACCCACAGAATGG + Intergenic
1047602640 8:126441701-126441723 TAAAACGACAACCCACAGAATGG + Intergenic
1047834695 8:128675717-128675739 TAAACCAACAACCTACAGAATGG - Intergenic
1048105861 8:131408606-131408628 TGGAGAGACAACCCACAGAATGG - Intergenic
1048427704 8:134338206-134338228 AAGAGGAAAAACACACAGAATGG - Intergenic
1048490586 8:134888844-134888866 AAAAGCAACAACCCACAGAATGG - Intergenic
1048679367 8:136822720-136822742 TAAACCAACAACCCATAGAATGG + Intergenic
1049489923 8:142891062-142891084 TGAAGCGACAACCCACAGAATGG - Intronic
1049678846 8:143906335-143906357 AAGAGCAACTATTCAAAGAATGG - Intergenic
1049833639 8:144718696-144718718 AAGCGCAGCAAATCACAGAATGG + Intergenic
1049858337 8:144879101-144879123 TGAAACAACACCTCACAGAATGG + Exonic
1050278937 9:4030384-4030406 TGAAGAGACAACTCACAGAATGG - Intronic
1050282687 9:4067639-4067661 TAGAGCAAACACTCACAAAGGGG + Intronic
1050663494 9:7909423-7909445 TAGACTATCAACTCCCAGAAGGG + Intergenic
1051208054 9:14710797-14710819 TAAAGAGACAACCCACAGAATGG + Intergenic
1051589609 9:18763435-18763457 TGAAGCGACAACCCACAGAATGG - Intronic
1051833993 9:21313973-21313995 TAGAGTAACAACCTACAGAATGG + Intergenic
1052094877 9:24371485-24371507 TAAAGAAACAACCCATAGAATGG + Intergenic
1052452055 9:28643738-28643760 TAAAGAGACAACCCACAGAATGG + Intronic
1052692012 9:31826873-31826895 TGAAGAAACAACCCACAGAATGG + Intergenic
1055037596 9:71835057-71835079 TGAAGGAACAACCCACAGAATGG + Intergenic
1055243350 9:74211570-74211592 TGAAGAAACAACCCACAGAATGG - Intergenic
1055543882 9:77346463-77346485 TAAAGAGACAACGCACAGAATGG - Intronic
1055994028 9:82138196-82138218 TAAACAGACAACTCACAGAATGG - Intergenic
1056842324 9:90008448-90008470 TAGAGCAAAAAAGCAGAGAAAGG - Intergenic
1058218665 9:102267547-102267569 TGTAGAAACAACCCACAGAATGG - Intergenic
1058406413 9:104680426-104680448 CAAAGCGACAACCCACAGAATGG + Intergenic
1058489920 9:105487038-105487060 TACAGCAAGAACTCAAAAAAAGG + Intronic
1059594948 9:115709644-115709666 TAAACAGACAACTCACAGAATGG - Intergenic
1060167157 9:121427431-121427453 TGAATAAACAACTCACAGAATGG + Intergenic
1061562020 9:131410659-131410681 TAGATAAACCACTCAGAGAAGGG - Intronic
1185667556 X:1778518-1778540 TAAACACACAACTCACAGAATGG - Intergenic
1186601697 X:11044698-11044720 TGGAGCGACAACCCACAGAATGG - Intergenic
1187991903 X:24883283-24883305 TAAACAGACAACTCACAGAATGG - Intronic
1188420059 X:29981523-29981545 TGTAACAACAACCCACAGAATGG - Intergenic
1188733443 X:33681984-33682006 TGAAGCATCAACTCACAGAATGG - Intergenic
1189424688 X:40887757-40887779 TAAACAGACAACTCACAGAATGG - Intergenic
1189805455 X:44731025-44731047 TAAAAAGACAACTCACAGAATGG + Intergenic
1189817470 X:44838399-44838421 TAAACAGACAACTCACAGAATGG + Intergenic
1189844621 X:45122904-45122926 TGAAGAGACAACTCACAGAATGG - Intergenic
1189868382 X:45355197-45355219 TGAAGGAACAACCCACAGAATGG - Intergenic
1189873776 X:45412709-45412731 TGAAGAAACAACCCACAGAATGG - Intergenic
1191058967 X:56274448-56274470 TGAAGAGACAACTCACAGAATGG - Intronic
1191770047 X:64745383-64745405 TAAAGAGAGAACTCACAGAATGG - Intergenic
1191834292 X:65447643-65447665 TAAACAAACAACTCACAGAATGG + Intronic
1192058552 X:67799084-67799106 TACAGCAAAAACTGACAGATGGG + Intergenic
1192677799 X:73217397-73217419 TAAAGAGACAACTTACAGAATGG + Intergenic
1192749380 X:73972695-73972717 TAAAGCAACAACCCACAAACTGG - Intergenic
1192837623 X:74818664-74818686 TAAACAGACAACTCACAGAATGG + Intronic
1192947191 X:75977159-75977181 TAGAGAAACAATGCACTGAATGG - Intergenic
1193102488 X:77630933-77630955 TAAAAAGACAACTCACAGAATGG + Intronic
1193125874 X:77869456-77869478 TAAACCAACAACCCACAGAGTGG + Intronic
1193279955 X:79635727-79635749 TAAAGAGACAACCCACAGAATGG - Intergenic
1193381275 X:80819172-80819194 TAAAGCAAAAACTGATAGAAAGG + Intergenic
1193466996 X:81861504-81861526 TAAAGAAACAACCTACAGAATGG + Intergenic
1193488018 X:82111329-82111351 TGAAGAGACAACTCACAGAATGG - Intergenic
1193529010 X:82631432-82631454 TGAAGCAACAACCTACAGAACGG + Intergenic
1193566901 X:83087665-83087687 TAAACCAACAACCCTCAGAATGG - Intergenic
1193585291 X:83313903-83313925 TAAAGAGACAACCCACAGAATGG + Intergenic
1193594992 X:83435220-83435242 TAGGAAAACAACTAACAGAAAGG - Intergenic
1193664944 X:84304666-84304688 TGAAGCAAAAACCCACAGAATGG + Intergenic
1193683229 X:84547333-84547355 TGAAGAAACAACACACAGAATGG - Intergenic
1193703844 X:84795892-84795914 TAGACCAACAACCTACAAAATGG + Intergenic
1193714484 X:84921704-84921726 TACACAGACAACTCACAGAATGG - Intergenic
1193818817 X:86137078-86137100 TAGAGAAACAGCACACACAAAGG + Intergenic
1193842450 X:86423601-86423623 TGAAGACACAACTCACAGAATGG - Intronic
1193908394 X:87270893-87270915 TGAAGAAACAACCCACAGAATGG + Intergenic
1193944760 X:87722019-87722041 TAGAGCAATAAATCATACAAAGG - Intergenic
1194107116 X:89784019-89784041 TGAAGAGACAACTCACAGAATGG + Intergenic
1194136957 X:90156965-90156987 TGAAGAAACAACCCACAGAATGG + Intergenic
1194285208 X:92001837-92001859 TGAAGCAATAACTTACAGAATGG - Intronic
1194382235 X:93208510-93208532 TAAAGAAACAACTTACACAATGG + Intergenic
1194559828 X:95406384-95406406 TAAACAGACAACTCACAGAATGG + Intergenic
1194568886 X:95528415-95528437 TGAAGAAACAACCCACAGAATGG + Intergenic
1194823939 X:98538867-98538889 TGAAGAGACAACTCACAGAATGG + Intergenic
1195122450 X:101769162-101769184 TGAAGAAACAACCCACAGAATGG - Intergenic
1195179925 X:102348142-102348164 TAAACAGACAACTCACAGAATGG - Intergenic
1195735271 X:108006391-108006413 TAAACAGACAACTCACAGAATGG + Intergenic
1195819847 X:108932146-108932168 TAAAGGGACAACCCACAGAATGG - Intergenic
1195872058 X:109496864-109496886 TGAAGAGACAACTCACAGAAAGG - Intergenic
1195897129 X:109757977-109757999 CAAAGAAACAACCCACAGAATGG + Intergenic
1196157224 X:112443877-112443899 TGGAGAGACAACCCACAGAATGG - Intergenic
1196219311 X:113093094-113093116 TAAAGAGACAACTCACAGACGGG + Intergenic
1196305108 X:114092916-114092938 TAAAGAGACAACCCACAGAATGG + Intergenic
1196361592 X:114867443-114867465 TGAAGAAACAACCCACAGAATGG - Intronic
1196481257 X:116152447-116152469 TGAAGCGACAACCCACAGAATGG + Intergenic
1197101214 X:122657722-122657744 TAAAGAAACCACTCACAGAATGG + Intergenic
1197165416 X:123371813-123371835 TGAAGAAACAACCCACAGAATGG - Intronic
1197286199 X:124597934-124597956 TGAAGAAACAACCCACAGAATGG + Intronic
1197456906 X:126688099-126688121 TGAAGAGACAACTCACAGAATGG + Intergenic
1197508338 X:127337349-127337371 TGGAGAGACAACTCACAGAATGG - Intergenic
1197525773 X:127561034-127561056 TGAAGGAACGACTCACAGAATGG - Intergenic
1197630721 X:128854392-128854414 TGAAGAAACAACTTACAGAATGG + Intergenic
1197798728 X:130327092-130327114 TGAAAAAACAACTCACAGAATGG - Intergenic
1197945695 X:131837120-131837142 GAAAGAAAAAACTCACAGAATGG + Intergenic
1197953401 X:131921710-131921732 TAAAGAGACAACCCACAGAATGG + Intergenic
1198813060 X:140555739-140555761 TGAAGAAACAACCCACAGAAAGG + Intergenic
1198859490 X:141054585-141054607 TAAAGAAACAACCCACAGACTGG - Intergenic
1198882578 X:141296951-141296973 TAAAGAAACAACCCACAGAATGG + Intergenic
1198903204 X:141532805-141532827 TAAAGAAACAACCCACAGACTGG + Intergenic
1198994895 X:142563248-142563270 TAAAGAGACAACCCACAGAATGG - Intergenic
1199263637 X:145804931-145804953 TAAAGCGACAACTTACAGAATGG + Intergenic
1199329292 X:146540319-146540341 CAGGGCAACAATTCAAAGAATGG - Intergenic
1199424694 X:147687388-147687410 TAAACCAACAACTTACAGAATGG + Intergenic
1199487934 X:148368634-148368656 TAAAGGAACAACCCACAGAGTGG + Intergenic
1199580982 X:149359462-149359484 TGAAGAGACAACTCACAGAATGG - Intergenic
1199828279 X:151522532-151522554 TAAAACAACAACTTACTGAATGG - Intergenic
1199888827 X:152053310-152053332 TAGATCATCTACTCACAGAGAGG - Intergenic
1199925890 X:152463663-152463685 TAAAGAGACAACTTACAGAATGG + Intergenic
1200385899 X:155890659-155890681 TAAAGCAAAAACTGACTGAAGGG - Intronic
1200459074 Y:3431881-3431903 TGAAGAGACAACTCACAGAATGG + Intergenic
1200602776 Y:5226379-5226401 TGAAGCAATAACTTACAGAATGG - Intronic
1200679156 Y:6188815-6188837 TAAAGAAACAACCAACAGAATGG + Intergenic