ID: 1181719260

View in Genome Browser
Species Human (GRCh38)
Location 22:24761312-24761334
Sequence CCCCCACTTGCTCTCCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181719260_1181719266 18 Left 1181719260 22:24761312-24761334 CCACAAAGGAGAGCAAGTGGGGG 0: 1
1: 0
2: 5
3: 28
4: 210
Right 1181719266 22:24761353-24761375 GTAACCTAAACGCCAAGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 20
1181719260_1181719263 -7 Left 1181719260 22:24761312-24761334 CCACAAAGGAGAGCAAGTGGGGG 0: 1
1: 0
2: 5
3: 28
4: 210
Right 1181719263 22:24761328-24761350 GTGGGGGTGGTCAGTGATGAAGG 0: 1
1: 0
2: 6
3: 43
4: 425
1181719260_1181719265 15 Left 1181719260 22:24761312-24761334 CCACAAAGGAGAGCAAGTGGGGG 0: 1
1: 0
2: 5
3: 28
4: 210
Right 1181719265 22:24761350-24761372 GAGGTAACCTAAACGCCAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1181719260_1181719269 29 Left 1181719260 22:24761312-24761334 CCACAAAGGAGAGCAAGTGGGGG 0: 1
1: 0
2: 5
3: 28
4: 210
Right 1181719269 22:24761364-24761386 GCCAAGCGGAGGGAGTTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1181719260_1181719267 19 Left 1181719260 22:24761312-24761334 CCACAAAGGAGAGCAAGTGGGGG 0: 1
1: 0
2: 5
3: 28
4: 210
Right 1181719267 22:24761354-24761376 TAACCTAAACGCCAAGCGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 43
1181719260_1181719264 -4 Left 1181719260 22:24761312-24761334 CCACAAAGGAGAGCAAGTGGGGG 0: 1
1: 0
2: 5
3: 28
4: 210
Right 1181719264 22:24761331-24761353 GGGGTGGTCAGTGATGAAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181719260 Original CRISPR CCCCCACTTGCTCTCCTTTG TGG (reversed) Intronic
900100426 1:960050-960072 CCCTAACTTGCTCTCCTCCGGGG - Intergenic
900243529 1:1627651-1627673 CTCCCACTTCCTCTCCTGTCAGG + Exonic
901119316 1:6877526-6877548 CTCCCATTTGTTCTCATTTGTGG + Intronic
901631390 1:10649854-10649876 CCCTCCCTCTCTCTCCTTTGTGG - Intronic
901691198 1:10974248-10974270 CACACACTTTCTCCCCTTTGAGG + Intronic
902758304 1:18564060-18564082 CCCGCCCTTGCTCTCCTCTCTGG - Intergenic
908818046 1:68053966-68053988 CCAACAATTGCTCTCCTTGGTGG + Intergenic
914392727 1:147236801-147236823 CGCACACTTCCTCTCCTCTGAGG - Intronic
914462881 1:147900988-147901010 CCCCCCCTTCCTGTCCTTTCTGG - Intergenic
918647566 1:186920717-186920739 CCCCCTTTTCCTCTCCTTTCAGG + Intronic
919968587 1:202554945-202554967 CCTCCACATGCTCTCATTTGTGG + Intronic
920029260 1:203026790-203026812 CCGCCCCTCGCCCTCCTTTGCGG + Intronic
920046531 1:203136346-203136368 CCCCCATGTCCTCTCCCTTGGGG - Intronic
920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG + Intronic
920586284 1:207165511-207165533 CCTCCACTTGCACTCCTTGAGGG + Intergenic
922861318 1:228818790-228818812 CACCCACTTCCTCCCCTCTGAGG + Intergenic
923544501 1:234914366-234914388 CCCCCACTTTGCCTCCTTTAGGG + Intergenic
923739741 1:236644352-236644374 CCTCCACTTGCTCGCCTTGGAGG - Intergenic
1063167774 10:3479467-3479489 CCCCAGCTTGCTCTCCTGCGGGG - Intergenic
1063629859 10:7723278-7723300 CCCCCACCTCCTCTCCTCTGAGG - Intronic
1063786368 10:9389453-9389475 CCTCCCCTGGCTCTCCTTTGAGG - Intergenic
1066316451 10:34252207-34252229 CCCCCAGCTGCTGTGCTTTGGGG + Intronic
1067233078 10:44425583-44425605 CCCCAACTTGCTCTCCTGGGGGG - Intergenic
1067473100 10:46550027-46550049 CCCCCAGCTGCTCTACTCTGTGG - Exonic
1067684249 10:48457511-48457533 CCCTCAGCTGCTATCCTTTGAGG - Intronic
1070910185 10:80111122-80111144 TCCACACTTGTGCTCCTTTGAGG + Intergenic
1074367939 10:112875025-112875047 CCTTCACTTGCTTTCCTTTTGGG - Intergenic
1074765431 10:116696657-116696679 CCCCCACTAGAAATCCTTTGAGG + Intronic
1075175263 10:120154493-120154515 GCCTCACTTGCTGTCCTTTCAGG + Intergenic
1075213726 10:120513578-120513600 TCCCCTCATGCTCTCCTCTGTGG - Intronic
1075676594 10:124300135-124300157 CACGGACTTGCTCCCCTTTGGGG - Intergenic
1076333565 10:129690351-129690373 CCCCCACCTTCCTTCCTTTGAGG + Intronic
1076375227 10:129979198-129979220 GCCCCACTTCCTTTCCTCTGGGG - Intergenic
1076573965 10:131451768-131451790 CCCCCACTGCCTTTGCTTTGGGG + Intergenic
1076723383 10:132402388-132402410 CCCTCATTTGCCCTCATTTGAGG + Intronic
1079942237 11:26695842-26695864 TCCCCACCTGCTCTCCTTCCAGG + Intronic
1080638995 11:34147707-34147729 CCCCGGCTGGCTCTGCTTTGGGG + Intergenic
1080723383 11:34870994-34871016 CACCCACTTCCTCTCTTTGGAGG - Intronic
1084352349 11:68611423-68611445 AAGCCACTTGCTCTCCTCTGTGG + Intronic
1085374024 11:76041381-76041403 TCTCCACCTGCTCTCCTCTGGGG - Intronic
1085523166 11:77149960-77149982 CCCCCTCTTCCTCTCCCTGGAGG + Intronic
1085871647 11:80357366-80357388 CCCCTCTTTACTCTCCTTTGAGG + Intergenic
1090124887 11:124075478-124075500 CACACACTTCCTCTCCTCTGAGG - Intergenic
1091486818 12:897576-897598 CCCCCAGCTGCTCCCCTTTCAGG + Exonic
1091995791 12:4992830-4992852 TCCCCTCTTGCTCTCCTGTGTGG - Intergenic
1092171447 12:6376022-6376044 TCCCCCCTTGCTCTCCTTCCTGG - Intronic
1094754041 12:33445294-33445316 CTGCCACTTGCTCTTCCTTGTGG - Intergenic
1096109848 12:49022036-49022058 CTCTCACCTCCTCTCCTTTGGGG + Exonic
1096805199 12:54136355-54136377 TCCCCGCTTTCTCTCCTTTTGGG - Intergenic
1097354291 12:58584224-58584246 CTTCCATTTTCTCTCCTTTGAGG + Intronic
1102313478 12:111866005-111866027 CCCCCACCTGCTACCCTTGGGGG + Intronic
1103074952 12:117974561-117974583 CCTTCACCTGCTCTCCGTTGAGG - Intergenic
1103365826 12:120382463-120382485 TACCCACTGGCTCTCCTTTGAGG - Intergenic
1103813399 12:123633824-123633846 CCACCACTTGCTCTGCGCTGAGG + Exonic
1104115472 12:125745343-125745365 CCACCACATTCTCTCCTATGTGG - Intergenic
1104437843 12:128769924-128769946 CCCCCATTTGCCCTTCCTTGGGG - Intergenic
1104641255 12:130468794-130468816 CCCACAATTTCTCTCCTCTGCGG + Intronic
1105717474 13:23081774-23081796 CCCCCACGTGCTCTGCTCTGTGG + Intergenic
1109166709 13:59044233-59044255 TCCACACCTTCTCTCCTTTGTGG - Intergenic
1109854872 13:68113730-68113752 CTCCAAATTGCTCTCCTTAGTGG - Intergenic
1112563115 13:100531344-100531366 CCCCCAAATGCTCTCCCTTCAGG + Exonic
1113861305 13:113489543-113489565 CCCCCTCTCAGTCTCCTTTGTGG + Intronic
1114543680 14:23482893-23482915 CCCCCACTTGGTCTGTTTGGTGG + Intronic
1115896052 14:38088559-38088581 CCCCCACTTGCTCTTTTGTTAGG + Intergenic
1119688772 14:76654327-76654349 CCACCACCTCCTCCCCTTTGGGG + Intergenic
1119924413 14:78479193-78479215 CCCCCACCTGCTCTCCCAAGAGG + Intronic
1121695337 14:95907949-95907971 CACACACTTCCTCTCCTCTGAGG - Intergenic
1121792565 14:96710069-96710091 GCCCCATTTCCTCACCTTTGTGG + Intergenic
1122115780 14:99526587-99526609 CCCCCACTTCCTCTTCCTGGAGG - Intronic
1123035435 14:105469977-105469999 GCCCCACCTGGTCTCCTCTGTGG - Exonic
1123100262 14:105793011-105793033 TCCCAAAATGCTCTCCTTTGAGG - Intergenic
1124200296 15:27673555-27673577 CCTCCACTTTCTCTGCTTGGAGG + Intergenic
1125680403 15:41526997-41527019 CCACCAGTTGGTCTCCTGTGGGG - Exonic
1127071225 15:55289834-55289856 CCCCACCTCGCTCTCCTTTACGG - Intronic
1127816934 15:62619330-62619352 CCTCCAGTTTCTCTCCTTAGAGG + Intronic
1131249395 15:90820524-90820546 CCACCCTGTGCTCTCCTTTGTGG + Intergenic
1131307014 15:91253845-91253867 AACCCACTTCCTCTACTTTGTGG - Intronic
1132591355 16:727691-727713 CCCCCACGTGCTCTGCTCTCCGG + Intronic
1132675319 16:1118948-1118970 CGCCCACTCGCTCTCCTTCCTGG - Intergenic
1133609739 16:7422308-7422330 AGCTCACTTGCTCTCCTGTGTGG - Intronic
1135505925 16:23036134-23036156 CCCCTAGTTGCTCAGCTTTGAGG - Intergenic
1135776267 16:25259323-25259345 CCCCCAAAAGCTATCCTTTGTGG - Intergenic
1135978128 16:27124594-27124616 CACCCACTGCCTCTCCTTTGGGG - Intergenic
1136156793 16:28388493-28388515 CTGCCACGTGCTCACCTTTGAGG + Exonic
1136206293 16:28726788-28726810 CTGCCACGTGCTCACCTTTGAGG - Exonic
1137500946 16:49011218-49011240 CCTCCACTTTCTCTCCTTTGGGG + Intergenic
1137704074 16:50521777-50521799 TCCCCAGTGACTCTCCTTTGGGG + Intergenic
1137811359 16:51355914-51355936 CCCTCACTTGCTCTTTTTTGCGG - Intergenic
1141921415 16:87138197-87138219 CCCCCAATTCCTCACCTTTTGGG - Intronic
1142230857 16:88899671-88899693 CCCCCACCTGCTCTTCCCTGGGG - Intronic
1143394169 17:6578911-6578933 CTCCCACTTGGGTTCCTTTGTGG + Exonic
1143855181 17:9843034-9843056 CCCCCACTTCGACTCCTTTATGG + Intronic
1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG + Intergenic
1147980118 17:44268919-44268941 CCCCCAGTTTCTCTGCTCTGGGG + Intergenic
1148982377 17:51589431-51589453 CACCCACTTTTTCTCCTTTTTGG + Intergenic
1149609092 17:57946653-57946675 CTCACACTTGCTTTCCTTTCAGG + Intronic
1150250989 17:63704372-63704394 CCCCCACTTCCACCACTTTGTGG - Exonic
1155355206 18:24945231-24945253 CCTCTTCTTGCTCTCCTCTGCGG - Intergenic
1156401267 18:36742457-36742479 CCTCCTCTTACTCTCCTTTCTGG - Intronic
1160740194 19:681999-682021 TCCACACTTCCGCTCCTTTGGGG + Exonic
1161307052 19:3574028-3574050 CGCCCACTTCCACTCCTTGGGGG + Intronic
1162818575 19:13209903-13209925 CCCCAGCTTGCTCTCCTGGGAGG + Intronic
1163659714 19:18569420-18569442 CCAGCACTTGCCCTCCTTTTGGG - Intergenic
1163670746 19:18626969-18626991 CCCCCAGTTTCTCTTCTTAGTGG + Intergenic
1166059725 19:40318673-40318695 CCAGCATTTGCTGTCCTTTGAGG + Intergenic
1168050211 19:53824189-53824211 CCTCCAGGTCCTCTCCTTTGGGG - Exonic
925149454 2:1605263-1605285 TCCCCACCTGCTGTCCTGTGTGG - Intergenic
926210188 2:10863476-10863498 CCTGCAGGTGCTCTCCTTTGGGG + Intergenic
926931599 2:18046703-18046725 CCCCTTCTTGGTCTCCTTTGTGG - Intronic
929522630 2:42668179-42668201 CCCCAACTGCCTCTACTTTGAGG - Intronic
930612030 2:53554319-53554341 CACACACTTCCTCTCCTCTGTGG + Intronic
932487544 2:72093764-72093786 TCCCCCATTGCCCTCCTTTGGGG + Intergenic
933165259 2:79068486-79068508 CACCCTTTTGTTCTCCTTTGGGG - Intergenic
934690496 2:96354979-96355001 CCCCCACTTGCTTACCTTTCAGG - Intronic
934758405 2:96840090-96840112 CCCCCACTTGCTCTCAGATCGGG - Exonic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936528357 2:113257690-113257712 CCCCCACTTCCTCTTCTTTTAGG - Intronic
937067723 2:119030520-119030542 CTCCCACTTGCTCTCCTTCCTGG + Intergenic
937768023 2:125684459-125684481 CCCCCAGTTGATCTATTTTGAGG + Intergenic
938453876 2:131445690-131445712 CCCTAACTTGCTCTCCTCTGGGG - Intergenic
940214167 2:151287662-151287684 CCCCTCCTTTATCTCCTTTGCGG + Intronic
941077141 2:161018644-161018666 CCCCCACTTGCCATCCCCTGTGG + Intergenic
946123646 2:217539375-217539397 CCCCCACTGGATGTCCTTAGTGG - Intronic
946959606 2:224969989-224970011 CCCCCAGTGGCTTTCATTTGGGG + Intronic
948142419 2:235683645-235683667 GTCCAGCTTGCTCTCCTTTGAGG + Intronic
948248584 2:236507108-236507130 CCCCCACTTTTTTTCCTTTTAGG - Intronic
1168988226 20:2070052-2070074 CCTCCACTTGCTCCCGTTTTTGG - Intergenic
1169143346 20:3238181-3238203 CCCCCAATTGTTCTCCCTTTTGG - Intronic
1169218010 20:3804479-3804501 CCCCCACGTCCCCTCCTTTGAGG - Intronic
1169294501 20:4382072-4382094 CCCCAATTTCCTCTCATTTGTGG + Intergenic
1173284465 20:41657669-41657691 TCCCCACTTTCTCCCCTTAGGGG - Intergenic
1173455565 20:43198649-43198671 CCCCCACTTGCTCACCTTAGGGG + Intergenic
1174416611 20:50371588-50371610 CCCTCTCATCCTCTCCTTTGTGG + Intergenic
1174567923 20:51480312-51480334 GCCCCACTCTCTCTCCTGTGCGG - Intronic
1175575161 20:60055559-60055581 CTCCCACTTGCTGCCCTCTGTGG - Intergenic
1176130822 20:63496149-63496171 CACCCCCTTGCTCTCCGTCGGGG + Intronic
1179548370 21:42126855-42126877 CCTCCAAGTGCTCTCGTTTGGGG + Intronic
1181719260 22:24761312-24761334 CCCCCACTTGCTCTCCTTTGTGG - Intronic
1182856149 22:33519286-33519308 GCCCCCCTGGGTCTCCTTTGAGG - Intronic
1183409305 22:37645569-37645591 CGCCCACTTGCTGCCCTTTCCGG + Intronic
1183455175 22:37918671-37918693 CCCCCTCCTCCTCCCCTTTGCGG - Intronic
950524018 3:13513147-13513169 CCTCCACTTGCACCCCTTTGAGG - Intergenic
952841876 3:37653293-37653315 CCCCTATTTGCTCTGCCTTGGGG - Intronic
952933622 3:38378474-38378496 CCACCAGCTGCTTTCCTTTGCGG - Intronic
952963389 3:38606634-38606656 CCCACACTTGCTGTCCCTTGTGG + Intronic
954715604 3:52525232-52525254 CCCCCGCGTGCTCTACTTCGGGG - Exonic
955787729 3:62557575-62557597 CCCCCATGTTCTCTCCTCTGAGG + Intronic
957038784 3:75320070-75320092 TCCCAACTTGCTCTCCTTGATGG - Intergenic
957174114 3:76782959-76782981 CCCTCTCTTGCTCTCCTTCTTGG + Intronic
957513737 3:81224059-81224081 CCCCCACTTGCTCTGCTGGTGGG - Intergenic
957624429 3:82640855-82640877 CACACACTTCCTCTCCTCTGAGG + Intergenic
959936926 3:112038860-112038882 CCTCCTCTTGCTCTCCTATGGGG - Intronic
962143820 3:132819154-132819176 GCCCCACTGGCTCTCCTTTACGG - Intergenic
964276517 3:155013918-155013940 CTCTCACTTGCTCTCCACTGTGG - Intergenic
964343105 3:155729372-155729394 CCCCCACTTACCCTGCTGTGTGG - Intronic
966268745 3:178079734-178079756 CTCGCAGTTGGTCTCCTTTGTGG + Intergenic
966934463 3:184696816-184696838 CCCCCACTTACTCTGCTTGCTGG + Intergenic
967959425 3:194908629-194908651 CCCCCAGCTGCTCCCTTTTGGGG + Intergenic
968044438 3:195616168-195616190 CCCCCACCTCCACTGCTTTGAGG + Intergenic
969054718 4:4394427-4394449 CCCCCAGGTGCTCTCTTTTGAGG + Intronic
969513538 4:7633333-7633355 CCCCCACCTGCTTGCCTTTGGGG + Intronic
976675468 4:87697774-87697796 CACACACTTCCTCTCCTCTGAGG - Intergenic
977618626 4:99111540-99111562 CCTTCACTTCCTCTCCTTGGGGG + Intergenic
978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG + Intergenic
978463587 4:108984466-108984488 CCCCCTCATGGTCTCCTGTGCGG - Intronic
979287315 4:118940845-118940867 CCCCATCTCGCTCTGCTTTGAGG + Intronic
981349512 4:143712596-143712618 ACCCCAGTTGCTTTCCTTTTTGG + Intergenic
983697480 4:170549650-170549672 CTGCCACTTGCTCTCTTTTTTGG - Intergenic
984325214 4:178242122-178242144 CACCCACTTCCTTTCCTCTGAGG + Intergenic
984568807 4:181365231-181365253 TGGCCAGTTGCTCTCCTTTGGGG + Intergenic
984961525 4:185102210-185102232 CCCCAACTTTCTCTGCTTTCCGG - Intergenic
985075015 4:186205677-186205699 TCCACATTTTCTCTCCTTTGTGG - Intronic
985604915 5:853331-853353 CCCCGACTCGCTGTCCTCTGCGG - Intronic
985605459 5:855489-855511 CCCCAGCTTGCTGTCCTCTGTGG - Intronic
987835425 5:23154588-23154610 CCTCCACTTGCTTGCCTTTCTGG - Intergenic
988565895 5:32320067-32320089 CATGCACTTCCTCTCCTTTGAGG - Intergenic
990040973 5:51378591-51378613 CCCCCACTTGACCTCCTCCGAGG + Intergenic
992180888 5:74197394-74197416 CCTCCACGTGGTCTCCATTGAGG - Intergenic
992930368 5:81637232-81637254 CCCACACTCCCTCTCCTTAGAGG + Intronic
996362409 5:122664600-122664622 CCTCCACTTGGTCTGCTTGGTGG - Intergenic
997432006 5:133847347-133847369 CCACCTCTGGCTCCCCTTTGGGG + Intergenic
997629559 5:135356547-135356569 CCCCTGCTTGCTTTCCTTTAAGG + Intronic
999389506 5:151180067-151180089 CTTCCTCTTCCTCTCCTTTGAGG + Intergenic
999631930 5:153580314-153580336 CCCTCTCTTGCTCTCCCTTCAGG + Intronic
1001600309 5:172924076-172924098 CATCCACAAGCTCTCCTTTGGGG + Exonic
1001722270 5:173866635-173866657 CCCCCAGATGGTCTCCTCTGAGG - Intergenic
1001877098 5:175210927-175210949 CCCTCACTTGCTGTCTCTTGTGG - Intergenic
1003654960 6:7998533-7998555 GCCCCACTCGCTGTCCCTTGGGG + Intronic
1005651586 6:27890044-27890066 CCTGCACATGCTGTCCTTTGGGG - Intergenic
1005960514 6:30689979-30690001 CCCACACTTGGTCTCCCTTGGGG + Intronic
1005991125 6:30902836-30902858 CACCCGCTTGCTTTCCTCTGTGG + Intergenic
1006251905 6:32794634-32794656 CCCTAACTTCCTCTCCTCTGTGG - Intergenic
1006417622 6:33913965-33913987 TCCACCCTTTCTCTCCTTTGTGG - Intergenic
1006817484 6:36862233-36862255 GCCCCACTGGCTCTCCTTATAGG - Intronic
1007277161 6:40683013-40683035 CCCACACTTGCTATCATGTGGGG - Intergenic
1007336834 6:41160470-41160492 CCCAGATTTGTTCTCCTTTGGGG + Intronic
1007729786 6:43938905-43938927 CCGCCACTTCCCCTCCTGTGTGG + Intergenic
1009275989 6:61680994-61681016 CCCCCTCTGGCTGACCTTTGCGG + Exonic
1011617694 6:89212121-89212143 CCTCCACCTGCTCTCCTTCCTGG + Intronic
1013236041 6:108198671-108198693 CACCCACTTCCTCCCCTCTGAGG - Intergenic
1015843755 6:137497346-137497368 CCCCCACTTCCCATCCGTTGCGG + Intergenic
1017259620 6:152371519-152371541 CCCCCATTTGCCCTGTTTTGTGG - Intronic
1021049865 7:15969918-15969940 CTCCTTCTTGGTCTCCTTTGAGG - Intergenic
1022030595 7:26488445-26488467 CCCCCTCCTGCTCTCCTGGGTGG + Intergenic
1022985103 7:35645859-35645881 ACACCACTTGCCCTCCTTAGAGG - Intronic
1023273934 7:38497740-38497762 CCCACTCTTGCTTTCCTTTGAGG - Intronic
1023614511 7:42006250-42006272 CCCCCACTAACTCTGCATTGAGG - Intronic
1028229662 7:88291538-88291560 CCTCAACTTGATCTCCCTTGTGG - Intronic
1029960483 7:104684903-104684925 GCACCACTTGCCCTCTTTTGAGG + Intronic
1030478163 7:110064677-110064699 CCCACACTTACATTCCTTTGGGG - Intergenic
1031123028 7:117742717-117742739 ACCCCAGGTGCTCTCATTTGTGG - Intronic
1031165541 7:118223505-118223527 ACCGCAATTGCTCTCTTTTGTGG - Intronic
1031800356 7:126235725-126235747 TGCCCACTTCCTCTACTTTGAGG + Intergenic
1033787157 7:144746418-144746440 CTCCCTCTTGTTCTCCGTTGAGG - Intronic
1034319262 7:150164389-150164411 CTCCCACTGGCTCTACTTTGAGG - Intergenic
1034773499 7:153802819-153802841 CTCCCAGTGGCTCTACTTTGAGG + Intergenic
1037492515 8:19409650-19409672 CCCCCACATCCTGTCCTCTGGGG + Intronic
1038425408 8:27461241-27461263 CCCCCACGGCCCCTCCTTTGAGG + Exonic
1039024450 8:33242463-33242485 CATCCACTTGGTGTCCTTTGTGG + Intergenic
1039101784 8:33949119-33949141 CCCCCACTTGCTGCCATATGGGG - Intergenic
1039800316 8:40948952-40948974 CCCCCACTCCCTCGCCCTTGTGG - Intergenic
1040464573 8:47682369-47682391 CTCCCACTTCCTCTCCTCTCAGG - Intronic
1040731107 8:50448097-50448119 CTCCCACTTGTTCTGCTTTTTGG - Intronic
1045002213 8:97888261-97888283 CCCCCACCTGCCCACTTTTGGGG - Intronic
1045799072 8:106080509-106080531 TCTCAGCTTGCTCTCCTTTGGGG + Intergenic
1046459721 8:114518052-114518074 CAAACACTTGCTCCCCTTTGAGG - Intergenic
1047228637 8:122977327-122977349 CCCCAACTTTCTTTCCATTGAGG - Intergenic
1047787321 8:128166545-128166567 CCTTCACTTGCTCTCCTTTGTGG - Intergenic
1049719909 8:144111028-144111050 GCCCCCCTTGCTCACCTTGGGGG + Intronic
1050613136 9:7373774-7373796 CTTCCACTTGAGCTCCTTTGGGG + Intergenic
1052125757 9:24772789-24772811 TCTCCACTAGCTCTACTTTGTGG - Intergenic
1057693918 9:97310399-97310421 CCCCCGCCTGCTCTCATCTGAGG - Intronic
1057794397 9:98145175-98145197 TCCCCACTTGGTCACCTGTGGGG + Intronic
1059790925 9:117641392-117641414 CCTCCACCTGCTGTCTTTTGAGG - Intergenic
1060741368 9:126099684-126099706 CCCCTGCGTGCTCACCTTTGAGG + Intergenic
1061591099 9:131598139-131598161 GCCCCACCTGCTCTCCTCTGTGG + Intronic
1061988568 9:134144845-134144867 CCTACATTTGCTCACCTTTGTGG - Intronic
1189460437 X:41238309-41238331 CCCCCACTTGCTTACCTTTGAGG - Intergenic
1191044440 X:56120731-56120753 GCCCCACCTCCTCCCCTTTGAGG + Intergenic
1195695250 X:107662267-107662289 CCTCCACTTCCTCTCCCTAGAGG + Intergenic
1196003162 X:110807970-110807992 CACCCACCTTCTCTCTTTTGTGG + Intergenic
1196765028 X:119235710-119235732 CCCCCATTCGCTCTCCTTGATGG - Intergenic
1202304392 Y:23452920-23452942 CCTCCACGTGCTCTCATTTGTGG + Intergenic
1202566418 Y:26217671-26217693 CCTCCACGTGCTCTCATTTGTGG - Intergenic