ID: 1181726813

View in Genome Browser
Species Human (GRCh38)
Location 22:24817111-24817133
Sequence ACCACAGATGTCCACATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181726811_1181726813 8 Left 1181726811 22:24817080-24817102 CCAGACAGGGAGATGGAAGGCAG 0: 1
1: 0
2: 0
3: 46
4: 330
Right 1181726813 22:24817111-24817133 ACCACAGATGTCCACATCAAAGG 0: 1
1: 0
2: 0
3: 18
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181726813 Original CRISPR ACCACAGATGTCCACATCAA AGG Intronic
903379664 1:22887749-22887771 ACCACAGGTGGCCTCATGAATGG - Intronic
903669014 1:25024651-25024673 GCCACAGCTGTCTGCATCAATGG - Intergenic
905585694 1:39115910-39115932 ACTACAGATGTCCAAAATAAAGG + Intronic
908008916 1:59755707-59755729 GCAACAGATGTGCACATAAACGG - Intronic
916040170 1:160954831-160954853 TCCACAGCTCTCCACATAAAGGG - Intergenic
918228140 1:182505360-182505382 ACCACCAATCTCCACATCAGTGG - Intronic
919654455 1:200183802-200183824 ACCACAGACATCCAAAACAAGGG + Intergenic
920437833 1:205959631-205959653 ACCACAGGTGTCCCCACCATGGG + Intergenic
923301248 1:232642746-232642768 TCCAGTGAAGTCCACATCAAAGG + Intergenic
1063751799 10:8957444-8957466 ACAACAGATGTCCAATTCACAGG + Intergenic
1065404538 10:25349283-25349305 ATCACAGGTGTCCTCATGAAGGG - Intronic
1065824663 10:29559089-29559111 AACATAGATTTCCACAGCAATGG - Intronic
1068341344 10:55707981-55708003 AGCACCAATATCCACATCAAAGG - Intergenic
1068928545 10:62565069-62565091 ACCACACATGTCCATTTAAATGG + Intronic
1072237982 10:93469552-93469574 ACCAGAGATGTCCAGCTCAAAGG + Intronic
1072304860 10:94097349-94097371 ACCACACAGGCACACATCAAGGG + Intronic
1073371386 10:102992728-102992750 ACCACAGTAGTTCACAGCAAGGG + Intronic
1075159468 10:120010657-120010679 ATGACTGGTGTCCACATCAAAGG - Intergenic
1081840631 11:46198967-46198989 AGCACAGAGGCCCACATCCAAGG + Intergenic
1085321734 11:75578562-75578584 ACCATAGATGTCTTCAGCAAAGG + Intergenic
1086749601 11:90474964-90474986 GTCACAAATGTCCACATGAAAGG + Intergenic
1087840737 11:102918313-102918335 AGTACAAATGTCCACATCAATGG - Intergenic
1088489444 11:110372486-110372508 ATTACAGATGCCCACATCCAAGG + Intergenic
1090302720 11:125659742-125659764 ACCACAGAAGTGCACTTTAAAGG - Intronic
1093337362 12:17922030-17922052 ACCACATATGTAGATATCAAAGG + Intergenic
1096347085 12:50858789-50858811 ATCACAGCTGTCCACATTAAAGG - Exonic
1098741863 12:74182693-74182715 ATCACAGATGACCATATAAAAGG + Intergenic
1099071729 12:78052820-78052842 CACACATATGTCCACATCTAAGG - Intronic
1101427776 12:104601921-104601943 GCAGCAGATGTCCACACCAAAGG - Exonic
1103991025 12:124799594-124799616 ACCACAGATTTCTGAATCAATGG + Intronic
1105588465 13:21767328-21767350 ACGACAGATGCCCACAGCACTGG - Intergenic
1106376056 13:29189310-29189332 AAAAAAGATGTCCACAACAAAGG - Intronic
1106504408 13:30358498-30358520 ACCACAGATGCCCTCAGCAGAGG + Intergenic
1111350088 13:87016722-87016744 AGAACAAATGTCCAAATCAATGG - Intergenic
1113583455 13:111446279-111446301 ACCACAGATTACATCATCAAAGG - Intergenic
1119627641 14:76194104-76194126 AACACAGGTGACAACATCAAAGG - Intronic
1121043872 14:90774027-90774049 ATGACAGATGTCCACAGCAGTGG - Intronic
1124660705 15:31548734-31548756 ATCCCAGATGACCACATCCATGG + Intronic
1130736634 15:86557287-86557309 CCCACAGCTGTCCACATGGACGG - Intronic
1133965966 16:10531962-10531984 GCCACAGCTGTCTACATCTAGGG - Exonic
1134772559 16:16822861-16822883 ACATCAGTTGTCCATATCAAGGG + Intergenic
1135617554 16:23925053-23925075 ACCCCAGATGTGCCAATCAATGG - Intronic
1137417612 16:48298510-48298532 ACCTAAGATGTCCATATAAAAGG - Intronic
1138719779 16:59066489-59066511 ACCATAGAAGTCGAGATCAAAGG - Intergenic
1138997524 16:62473365-62473387 TCCACAGATCTCTACAGCAAGGG - Intergenic
1139398712 16:66662585-66662607 GCTACAGATGTCCACAACAGAGG + Intronic
1142104961 16:88297709-88297731 ATCACAGATGTCCTCATAAGAGG - Intergenic
1149784235 17:59421950-59421972 ACCACAGACGTTTACATCATGGG + Intergenic
1153122776 18:1750422-1750444 TCTACAGATGTTCCCATCAAAGG - Intergenic
1155457502 18:26034185-26034207 GACAAAGATGTCCACAGCAATGG + Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1165198828 19:34129025-34129047 ACCACAGATGACCAAATCATAGG + Intergenic
1165850439 19:38847379-38847401 TCCCCAGTTGTCCACATCAGGGG - Exonic
1166209920 19:41299873-41299895 CCCAGTGATGACCACATCAATGG + Intronic
1168204076 19:54836436-54836458 ATCACAAGTGTCCACATGAAAGG + Intronic
925814268 2:7732397-7732419 TCCACAGGGGTCCAGATCAAAGG - Intergenic
926686336 2:15701153-15701175 TACACAGATAGCCACATCAATGG - Intronic
927301252 2:21518417-21518439 GCCACAGCTCTCCACATCCATGG + Intergenic
927636804 2:24822530-24822552 ACCCCCGATGTCAACACCAATGG - Exonic
932094269 2:68832925-68832947 ACCATTGATGTACACATCACTGG - Intergenic
936762023 2:115798405-115798427 CCCACACATCTCCACATCAGAGG + Intronic
939020355 2:136951045-136951067 ACCACAGAGAACCAAATCAATGG - Intronic
941677573 2:168360302-168360324 AATACTGATGTCCACATCCAGGG - Intergenic
942017655 2:171832946-171832968 ACAACAGCTGTCCACATCATAGG + Intronic
944463070 2:199972423-199972445 ATCACAGATGTCCTTATAAAAGG + Intronic
945338444 2:208620140-208620162 AGCCCAGATGGCCATATCAAGGG - Intronic
947588793 2:231372831-231372853 ACCAGAGATGTCCCCATTGAAGG - Intronic
947999040 2:234552731-234552753 ACCACAGATGGACACATCAGAGG - Intergenic
948300377 2:236901997-236902019 ACCACAGACGTCTACACAAATGG + Intergenic
1169125233 20:3122444-3122466 CCTACAGATTTCCACATTAAAGG + Exonic
1170882335 20:20308149-20308171 AACACAGCTTTCCACAACAATGG - Intronic
1171278857 20:23880064-23880086 ACCACCTATGTCCACAGGAAAGG + Intergenic
1171478043 20:25428822-25428844 ACGACAGATGTACAGAACAATGG - Intronic
1174565742 20:51463283-51463305 ACCACTGAGGTCCACAGCAAGGG + Intronic
1175611104 20:60352039-60352061 AGCACAGATGTCCAATGCAAGGG - Intergenic
1176097712 20:63351974-63351996 CCCACAGAAGTCCCCACCAATGG + Intronic
1178472214 21:32903885-32903907 ACCTCAAAGGGCCACATCAATGG - Intergenic
1178797622 21:35759602-35759624 ACCACAGGTGTCTACATCTGGGG + Intronic
1178912127 21:36683462-36683484 ACAACAGATGCGCACGTCAAGGG + Intergenic
1179202866 21:39242961-39242983 ACCTCTGATGGGCACATCAAAGG + Intronic
1180388804 22:12204802-12204824 ATCACAGATGTCGAAATAAATGG + Intergenic
1181726813 22:24817111-24817133 ACCACAGATGTCCACATCAAAGG + Intronic
1183957521 22:41390370-41390392 ACAAAAGATGTCAAAATCAAAGG - Intronic
1184875104 22:47269380-47269402 ACCCCAGATGTCCACCTCCTTGG - Intergenic
949529853 3:4945235-4945257 ACCATAGATTTCCAAATTAAGGG + Intergenic
950641169 3:14349423-14349445 AGCACAGATGCACACAGCAACGG + Intergenic
951869532 3:27345718-27345740 ACCACATCTGTTCACAGCAACGG + Intronic
954499608 3:50999323-50999345 ACCAGAGATCTCCACTGCAATGG - Intronic
955031962 3:55230702-55230724 CCCACAGTTGTTCACATCCATGG + Intergenic
955489241 3:59465764-59465786 ATCACAAAAGTCTACATCAAGGG - Intergenic
956383967 3:68697134-68697156 AACATAAATGTCCACACCAAAGG - Intergenic
957934052 3:86919810-86919832 ACCACTGATTCCCACATCACTGG - Intergenic
961104802 3:124231988-124232010 ACCACAGATAGACACATCAAGGG - Intronic
962813486 3:138978373-138978395 AGCACAGATGCTCACACCAATGG - Intergenic
963602473 3:147390361-147390383 ACCTCAGAAGTTCAGATCAAGGG - Intronic
967994990 3:195159780-195159802 ACCACAGAGGGCCACATGCACGG + Intronic
969867174 4:10083610-10083632 ACCAGAGCTGTCCACACAAAAGG + Intronic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
970546402 4:17134504-17134526 GCCACCGATATCCCCATCAATGG + Intergenic
979201546 4:117985221-117985243 GCCACAGATGTTCAAATCAGTGG + Intergenic
984055014 4:174917502-174917524 ACCACAGAAACCCATATCAAGGG + Intronic
987056206 5:14195303-14195325 ACCACACAAATCCAAATCAAGGG - Intronic
987517853 5:18937342-18937364 AAAACAGATGTACACATAAACGG + Intergenic
987802855 5:22720841-22720863 TCCGCAGATGTCTACAGCAAGGG - Intronic
988511771 5:31870246-31870268 ACCACATATGCCCACATATAAGG + Intronic
988602071 5:32649393-32649415 ACCACAGGTGTCCACTACCATGG - Intergenic
990694377 5:58399448-58399470 ACCAAAGATTTCCACTTCGAAGG - Intergenic
991632461 5:68670000-68670022 AACACAGAGTTACACATCAAAGG - Intergenic
993266087 5:85728168-85728190 ATCACAGATGTCCTCATAAAGGG - Intergenic
994002165 5:94792985-94793007 AACACAGATGCCCAATTCAATGG - Intronic
994091087 5:95810219-95810241 ACCACAGATGCACACCTCCATGG - Intronic
995591321 5:113702848-113702870 AAAACATTTGTCCACATCAAAGG + Intergenic
996112348 5:119580597-119580619 ACAACAGATGTTCTCAGCAATGG - Intronic
996123111 5:119693182-119693204 ACCACTGATTGCCACATAAATGG + Intergenic
997392959 5:133531949-133531971 CCCACAGATATCCACATCCTAGG + Intronic
997839877 5:137229576-137229598 ACAACAGATGTCCATAACAGGGG + Intronic
998003897 5:138644601-138644623 CCCACAGATGTGCACCTCACTGG - Intronic
999134166 5:149306726-149306748 ACAACAGATGTCAAGATGAAGGG + Intronic
1000858618 5:166430432-166430454 ACCTCAGAGGTCCACCTCACTGG + Intergenic
1000870397 5:166570038-166570060 ATGACTGATGTCCTCATCAAAGG - Intergenic
1001913270 5:175538797-175538819 GCCACAGATGTTCACCTCAAGGG - Intergenic
1003597007 6:7482539-7482561 TCCCCAGTTGTCCACATCAGGGG - Intergenic
1004660983 6:17708946-17708968 AGCATAGGTGTACACATCAATGG + Intergenic
1005090974 6:22056863-22056885 AAGACAGATGACTACATCAAAGG + Intergenic
1007205435 6:40146265-40146287 ACCACACTAGTCCATATCAATGG + Intergenic
1010060981 6:71622756-71622778 TCCAAAGATGTCAAAATCAATGG - Intergenic
1011487437 6:87857313-87857335 ACCTAAAATGTCAACATCAATGG - Intergenic
1012233432 6:96786351-96786373 ACAACACAAGTGCACATCAAGGG - Intergenic
1012266956 6:97156661-97156683 AACACAGATGTCCAGACCAATGG - Intronic
1012506686 6:99954764-99954786 ACCACAGATGTCCACATGGGTGG + Intronic
1013096662 6:106951721-106951743 ACAACCCATGTCCACGTCAACGG + Intergenic
1013145498 6:107386895-107386917 ACCACAGAAGTCCAAAGCTAGGG + Intronic
1013981184 6:116131624-116131646 AACACAGATGTCCACCTATAGGG - Intronic
1014723687 6:124950359-124950381 TCCACAGAGGCACACATCAATGG - Intergenic
1015484580 6:133754269-133754291 AACCCAGATCTCCAAATCAATGG - Intergenic
1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG + Intronic
1017764109 6:157593035-157593057 ACCAAAGAAGTCATCATCAATGG + Exonic
1022534124 7:31085234-31085256 ACCACAGATGCCCACATGGAGGG + Intronic
1027369219 7:77490779-77490801 ACCACATATTTCCACATGAGTGG + Intergenic
1027962162 7:84959796-84959818 ACCTCACATGTCTACAGCAAGGG - Intergenic
1028746808 7:94336708-94336730 ACCACCTATGTCCACGTGAATGG + Intergenic
1030917029 7:115328170-115328192 AGGACAGATGTACACATGAAAGG + Intergenic
1032933931 7:136707163-136707185 GCTACAGATGTGAACATCAATGG + Intergenic
1036750202 8:11439034-11439056 ACATCAGATGTCCAAGTCAAGGG - Intronic
1037131977 8:15417517-15417539 ACCACAGATGTCCAGCTAAGAGG + Intronic
1041222770 8:55668602-55668624 ACAACAGAACTCCACATCACTGG + Intergenic
1042866854 8:73364206-73364228 TCATCAGATGTCCACATGAAAGG - Intergenic
1045504132 8:102766776-102766798 ACCACAGAGGTTCTCATCAAAGG - Intergenic
1046508099 8:115162133-115162155 ACCATAAATGTCCAAATAAAAGG - Intergenic
1046869420 8:119188785-119188807 ACCACCGATGTTCACCTCAAAGG + Intronic
1047250916 8:123181732-123181754 AACCCAGATGTCCACAGCAGTGG + Intronic
1048880134 8:138865002-138865024 ACAACAGATGTGAACATAAATGG - Intronic
1050026141 9:1336173-1336195 ACCTCAGAGGTCCAAATCAGGGG - Intergenic
1050760812 9:9068245-9068267 AGCCCAGATGTCCACTTCAATGG - Intronic
1051046020 9:12874570-12874592 AAGACAGATGTACACACCAATGG + Intergenic
1051488363 9:17633311-17633333 ACAATGGATGTGCACATCAATGG - Intronic
1054797239 9:69313762-69313784 TCCACAGATTTCTACAGCAAAGG + Intergenic
1054960800 9:70966820-70966842 ACAACAAATCTCCACATCAAAGG + Intronic
1055792203 9:79934979-79935001 ACCACAGATCTCCAAGTCAGGGG - Intergenic
1055975697 9:81952746-81952768 ACAACAGATGTACACAGCATTGG + Intergenic
1187233279 X:17442895-17442917 CCCACAGCTGTCCACATGAAGGG - Intronic
1188807583 X:34610860-34610882 ACCACAAAGGTCAGCATCAAAGG - Intergenic
1191089970 X:56609414-56609436 TCCACAGATATCTACAGCAAGGG + Intergenic
1193901820 X:87189110-87189132 ACCACACTTGTCCACATCCCTGG - Intergenic
1194003172 X:88457291-88457313 TTCACAGATTTCCACAACAATGG - Intergenic
1196270776 X:113708218-113708240 AGCACAGATGGCTACATAAAAGG - Intergenic
1200304930 X:155015065-155015087 AGCACAGATATACACATCTATGG + Intronic