ID: 1181726814

View in Genome Browser
Species Human (GRCh38)
Location 22:24817112-24817134
Sequence CCCTTTGATGTGGACATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181726814_1181726822 17 Left 1181726814 22:24817112-24817134 CCACAGATGTCCACATCAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1181726822 22:24817152-24817174 TGGAGCTCAGCCTGTGATGCGGG 0: 1
1: 0
2: 5
3: 48
4: 316
1181726814_1181726823 20 Left 1181726814 22:24817112-24817134 CCACAGATGTCCACATCAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1181726823 22:24817155-24817177 AGCTCAGCCTGTGATGCGGGAGG 0: 1
1: 0
2: 1
3: 21
4: 166
1181726814_1181726821 16 Left 1181726814 22:24817112-24817134 CCACAGATGTCCACATCAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1181726821 22:24817151-24817173 TTGGAGCTCAGCCTGTGATGCGG 0: 1
1: 0
2: 1
3: 21
4: 209
1181726814_1181726819 -3 Left 1181726814 22:24817112-24817134 CCACAGATGTCCACATCAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1181726819 22:24817132-24817154 GGGCTGAGGGCGCCTGCATTTGG 0: 1
1: 0
2: 0
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181726814 Original CRISPR CCCTTTGATGTGGACATCTG TGG (reversed) Intronic
900950976 1:5858209-5858231 CCCTTTGGGGTGGGCAGCTGTGG + Intergenic
902512143 1:16972354-16972376 CCCTTCAGTGTGGACACCTGGGG - Exonic
902849973 1:19147553-19147575 GCCTCTGATGGGAACATCTGGGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
906458884 1:46022337-46022359 CCCTTTGTTGTTGACCTCTTTGG - Intronic
920096430 1:203489198-203489220 CCCTTTGATGAGGCCCTCAGGGG + Exonic
922011669 1:221594989-221595011 CCTCTTGAAGTGGACATTTGAGG + Intergenic
922233462 1:223705653-223705675 CCCTGTGGTGCTGACATCTGAGG + Intronic
923301249 1:232642747-232642769 ACCTTTGATGTGGACTTCACTGG - Intergenic
1066578890 10:36858427-36858449 CCCTTTTATGTGGGACTCTGGGG - Intergenic
1068501349 10:57842676-57842698 CCCTTTGATTTTGGTATCTGGGG + Intergenic
1068919219 10:62465347-62465369 CCCTTTGATGTGGACAGCCTGGG + Intronic
1069562648 10:69441658-69441680 CCTTTAGAAGGGGACATCTGGGG - Intergenic
1070916142 10:80156128-80156150 TCATTTGATGTGGATAGCTGGGG - Intronic
1072237983 10:93469553-93469575 GCCTTTGAGCTGGACATCTCTGG - Intronic
1074511455 10:114116440-114116462 TCCTTTGGTATGGACACCTGGGG + Intergenic
1075421580 10:122305043-122305065 CAGTGAGATGTGGACATCTGTGG - Intronic
1075659343 10:124182498-124182520 CGCTTTGCTGTGGACCTCCGTGG - Intergenic
1075671937 10:124268887-124268909 CCCTGAGATGGGGACACCTGAGG - Intergenic
1075955790 10:126521582-126521604 CTCTTTGATGTTTACATTTGAGG + Intronic
1078007923 11:7546520-7546542 CCCTGTCATGTTTACATCTGAGG + Intronic
1079018045 11:16886305-16886327 ATCTATGATGTGGACAACTGTGG - Intronic
1083614317 11:64018841-64018863 CCCTTTGAGGTGGGCATGTTGGG - Intronic
1085320631 11:75571919-75571941 CCCTTTGACCAGGACATCTACGG + Exonic
1085775694 11:79364437-79364459 CCTTCTGATGGAGACATCTGGGG - Intronic
1087642344 11:100768641-100768663 CTTATTGATGTAGACATCTGTGG + Intronic
1090302719 11:125659741-125659763 CCCTTTAAAGTGCACTTCTGTGG + Intronic
1093052433 12:14518620-14518642 CACTTTGATGTGGACATGGTAGG - Intronic
1094674861 12:32609944-32609966 CTCTTTGGTGTGGACATCGTAGG - Intronic
1099942572 12:89206276-89206298 CCATGTGATGTGGACAGCTGAGG - Intergenic
1104573980 12:129949718-129949740 CCCTGGGATGCGAACATCTGGGG - Intergenic
1105225466 13:18427470-18427492 CCATTTCCTGTGGACTTCTGAGG + Intergenic
1111215508 13:85135031-85135053 GAATTTGATGTGGATATCTGGGG + Intergenic
1113635016 13:111913436-111913458 CCTTTAGATGTGGAAACCTGAGG - Intergenic
1117579563 14:57138519-57138541 CCCTTTGATGTGTACAACATGGG + Intergenic
1130736633 15:86557286-86557308 CCCGTCCATGTGGACAGCTGTGG + Intronic
1131615777 15:94015861-94015883 CCTATTGATGTTGACATATGGGG + Intergenic
1131699747 15:94921521-94921543 CCCTTTGATGTGAACTTAGGAGG - Intergenic
1132401030 15:101505598-101505620 CCTTTTAATGTGCGCATCTGGGG - Intronic
1136046262 16:27617626-27617648 CCACTTGGAGTGGACATCTGTGG - Intronic
1137417611 16:48298509-48298531 ACCTTTTATATGGACATCTTAGG + Intronic
1137727842 16:50669052-50669074 CACTTTGACGTGGACATCTCGGG + Intronic
1138803210 16:60060348-60060370 CCCTTCTTTGTGTACATCTGAGG + Intergenic
1144337148 17:14281586-14281608 CGCTTGGTTGTGCACATCTGTGG - Intergenic
1144778165 17:17795272-17795294 CCCTTTGCTGATGCCATCTGAGG - Exonic
1147306701 17:39569097-39569119 CCCTTTGATTTGGACATTAGAGG + Intergenic
1150213091 17:63452265-63452287 CCCTTTGATGGGGACAGGAGTGG - Intergenic
1152142871 17:78548646-78548668 CCCTTTGCTGTTCACACCTGAGG + Intronic
1154527908 18:15312052-15312074 CCATTTCCTGTGGACTTCTGAGG - Intergenic
1157218844 18:45809745-45809767 CCTTTTGATGTGGGCATTTAGGG - Intergenic
1157973709 18:52300542-52300564 AGTTTTGATGGGGACATCTGTGG - Intergenic
1158652648 18:59301356-59301378 CCTTTGGACCTGGACATCTGAGG - Intronic
1158818595 18:61132225-61132247 CACTTTGAGGTGGAGCTCTGCGG + Intergenic
1159017237 18:63111197-63111219 CATTTGGATGTGGACATCTTTGG - Intergenic
1159972562 18:74671777-74671799 CACTGTGATGTGGACACCTTTGG + Intronic
1159972717 18:74673581-74673603 TACTGTGATGTGGACATCTTTGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165151411 19:33762707-33762729 CCATTTGGTGTGCACATTTGTGG + Intronic
1165198829 19:34129026-34129048 GCCTATGATTTGGTCATCTGTGG - Intergenic
1165771174 19:38381198-38381220 CCCTTGGCTGTTGACATGTGTGG + Intronic
1165850438 19:38847378-38847400 GCCCCTGATGTGGACAACTGGGG + Exonic
1167384502 19:49155992-49156014 CTCTGTGATGGGGACAGCTGTGG - Intergenic
1168526500 19:57092610-57092632 CCCTTAGCTGTAAACATCTGAGG - Intergenic
925142770 2:1561318-1561340 CCCTTTAAAGTGGAGAGCTGGGG + Intergenic
925814267 2:7732396-7732418 TCCTTTGATCTGGACCCCTGTGG + Intergenic
927462773 2:23313243-23313265 TCCTATCATCTGGACATCTGAGG - Intergenic
927890431 2:26744735-26744757 CCTTTTTATGTGGACATGTGAGG - Intergenic
931255051 2:60563858-60563880 CCCTTAAATGTGAACATCAGTGG - Intergenic
931894305 2:66712212-66712234 CCCTTTGTACTGGACCTCTGGGG + Intergenic
936036983 2:109120816-109120838 CCCTTGGCTTTGGACATGTGAGG - Intergenic
936762024 2:115798406-115798428 TCCTCTGATGTGGAGATGTGTGG - Intronic
937608352 2:123828601-123828623 AGCTTTGAAGTGGATATCTGAGG + Intergenic
938527007 2:132143509-132143531 CCATTTCCTGTGGACTTCTGAGG - Intergenic
938596461 2:132792383-132792405 CCATTTGTTGTAGGCATCTGTGG - Intronic
942538015 2:176985714-176985736 CCCTGTGATGGGCCCATCTGAGG - Intergenic
946947952 2:224842039-224842061 AGCTTTGATGTGGACATTTCTGG + Intronic
947000845 2:225454508-225454530 CAATTGGATGTGGACATCTTTGG - Intronic
947318330 2:228889003-228889025 CACTTGCATGTGGATATCTGTGG - Intronic
947588792 2:231372830-231372852 CCCTTCAATGGGGACATCTCTGG + Intronic
947999039 2:234552730-234552752 TCCTCTGATGTGTCCATCTGTGG + Intergenic
1169531214 20:6487223-6487245 CCCTGTGTTGTGGAAATCTGAGG + Intergenic
1171278858 20:23880065-23880087 CCCTTTCCTGTGGACATAGGTGG - Intergenic
1176097713 20:63351975-63351997 CCCATTGGTGGGGACTTCTGTGG - Intronic
1176107467 20:63396173-63396195 CTCAGTGGTGTGGACATCTGAGG + Intergenic
1176663755 21:9664440-9664462 CCCTCTGCTGTGGACAGGTGTGG - Intergenic
1176769518 21:13056493-13056515 CCATTTCCTGTGGACTTCTGAGG + Intergenic
1177737130 21:25105253-25105275 CCCTTTGATGAGGTAACCTGGGG + Intergenic
1178472213 21:32903884-32903906 CCCATTGATGTGGCCCTTTGAGG + Intergenic
1179202867 21:39242962-39242984 TCCTTTGATGTGCCCATCAGAGG - Intronic
1180516619 22:16150438-16150460 CCATTTCCTGTGGACGTCTGAGG + Intergenic
1181109101 22:20591062-20591084 ACCTTTGCTGTGGGCATGTGAGG + Intergenic
1181726814 22:24817112-24817134 CCCTTTGATGTGGACATCTGTGG - Intronic
1184323348 22:43761082-43761104 CCCTTTTATAAGGGCATCTGAGG - Intronic
1184875103 22:47269379-47269401 CCCAAGGAGGTGGACATCTGGGG + Intergenic
949583967 3:5419136-5419158 CTCTTTGATCTGGACCTCTAAGG + Intergenic
950820842 3:15756758-15756780 CCCTTTGTTGTTTAAATCTGGGG - Intronic
955031963 3:55230703-55230725 CCCATGGATGTGAACAACTGTGG - Intergenic
956109300 3:65854859-65854881 CCTTTGGTTGTGGACTTCTGTGG - Intronic
961057113 3:123798566-123798588 CCTTTTGATGAGAACATCTGGGG - Intronic
961582576 3:127894712-127894734 CCCTCTCCTGTGGACTTCTGAGG + Intergenic
965256579 3:166421580-166421602 CTTTTTGATGTGGACATTTAGGG + Intergenic
966933768 3:184692192-184692214 CCCTTTGGTGAGCAGATCTGAGG + Intergenic
967488880 3:190065821-190065843 CTTTTTGATGTGGACATTTAAGG + Intronic
968902258 4:3437236-3437258 CCTTGTGATGTGGACATCCTTGG + Intronic
970546403 4:17134505-17134527 CCCATTGATGGGGATATCGGTGG - Intergenic
970665865 4:18335500-18335522 TCCTTTCATGTAGATATCTGAGG + Intergenic
975541478 4:75516777-75516799 CCTTTTGATGTTTTCATCTGTGG - Exonic
975898923 4:79126850-79126872 CTTTTTGATGTGGACATTTAGGG + Intergenic
976914430 4:90353111-90353133 CCCTGAGGTGTGGACATCTGAGG + Intronic
976941878 4:90712261-90712283 CTTTTTGATGTGGACATTTAGGG + Intronic
979705189 4:123712399-123712421 CCTTTTGATGTGGGCATTTAGGG - Intergenic
982707185 4:158723212-158723234 TTCTTTGACGTGGACATCGGAGG - Exonic
984552311 4:181175373-181175395 CACTTTGAAGTGAACAACTGAGG + Intergenic
985174714 4:187188693-187188715 TCCTTTGATGGGAACATATGGGG + Intergenic
985409209 4:189665126-189665148 CCCTCTGCTGTGGACAGGTGTGG - Intergenic
986775530 5:11010642-11010664 CACTCTGATTTGGACATGTGAGG + Intronic
987802854 5:22720840-22720862 GCCCTTGCTGTAGACATCTGCGG + Intronic
990694376 5:58399447-58399469 CCCTTCGAAGTGGAAATCTTTGG + Intergenic
993160637 5:84286338-84286360 CTCTTTCACGTGGACATCTATGG - Intronic
993527334 5:88982093-88982115 TCATTTGATGTGGTCATCTCAGG + Intergenic
995775376 5:115719285-115719307 GCCTTTTATCTGGAGATCTGAGG + Intergenic
995795467 5:115936712-115936734 CCCTTTGAGGTGCAAGTCTGGGG - Intergenic
996243641 5:121232816-121232838 CCCTTGGATGTGGAAAGTTGGGG + Intergenic
997392960 5:133531950-133531972 GCCTAGGATGTGGATATCTGTGG - Intronic
999498499 5:152123913-152123935 CCCTGTGATGTGGACATGGGAGG - Intergenic
1001913269 5:175538796-175538818 CCCCTTGAGGTGAACATCTGTGG + Intergenic
1003597006 6:7482538-7482560 GCCCCTGATGTGGACAACTGGGG + Intergenic
1007075902 6:39065905-39065927 GGCTTTGATGGGGGCATCTGTGG + Intronic
1013191998 6:107811563-107811585 CCTTTTGATGGGGGCATTTGGGG - Intronic
1014411912 6:121135157-121135179 CCCTTTGATATGGAGACATGAGG + Intronic
1015321502 6:131880727-131880749 CCCTTAGATTTGGACAGCTGAGG - Intronic
1017577612 6:155822441-155822463 CACTATGATTTGGACAACTGTGG - Intergenic
1018248806 6:161847468-161847490 CCACTTGATGTAGACAGCTGAGG - Intronic
1019121204 6:169805687-169805709 CGCTGTGATGTGGACAGCTCTGG - Intergenic
1020180470 7:5918632-5918654 CTCTCTGATGAGGACATCCGTGG + Intronic
1020302461 7:6806250-6806272 CTCTCTGATGAGGACATCCGTGG - Intronic
1020511586 7:9063434-9063456 CTCTTTTATAGGGACATCTGTGG + Intergenic
1022470500 7:30679176-30679198 CCCTCTGAGCTGGACTTCTGGGG - Intronic
1034943621 7:155248174-155248196 CCCTGAGCTGAGGACATCTGGGG - Intergenic
1035032528 7:155870682-155870704 CCCTTTGCTGTGGGCAGTTGAGG + Intergenic
1038359769 8:26865152-26865174 CCCCTTCATGTGGCCTTCTGAGG - Exonic
1039589713 8:38736109-38736131 CCTTTTGATGTTGACCTCCGTGG + Intronic
1042511565 8:69617671-69617693 CCATTTAATGTGGAGATCAGTGG - Intronic
1045186477 8:99843501-99843523 CCCTTTGATCTGGAGACCTATGG + Intronic
1045239334 8:100385138-100385160 CCCTTTTATGGTGACATATGTGG - Intronic
1045391206 8:101716655-101716677 GACTTGGATGTGGACATCTTTGG - Intronic
1045504131 8:102766775-102766797 CCCTTTGATGAGAACCTCTGTGG + Intergenic
1046508098 8:115162132-115162154 CCCTTTTATTTGGACATTTATGG + Intergenic
1046869421 8:119188786-119188808 TCCTTTGAGGTGAACATCGGTGG - Intronic
1050026140 9:1336172-1336194 CCCCCTGATTTGGACCTCTGAGG + Intergenic
1050765537 9:9129022-9129044 GTGGTTGATGTGGACATCTGTGG - Intronic
1054797240 9:69313763-69313785 GCCTTTGCTGTAGAAATCTGTGG - Intergenic
1058632044 9:106999161-106999183 CCCTTTGTTGTGGGCCTTTGGGG + Intronic
1058640948 9:107084823-107084845 CCTGTTGATGTGCACATCTGTGG + Intergenic
1059692794 9:116701757-116701779 CCCTTTGATGTGAATATTTTAGG + Intronic
1059754997 9:117284403-117284425 CCCTTTTATGAGGACACCAGAGG - Intronic
1060819911 9:126655285-126655307 CCCTTCGATGAGGGCATCTGAGG + Intronic
1061289766 9:129643948-129643970 CGCTGTGATGTGGACTGCTGGGG - Intergenic
1203662344 Un_KI270753v1:57322-57344 CCCTCTGCTGTGGACAGGTGTGG + Intergenic
1187233278 X:17442894-17442916 CCCCTTCATGTGGACAGCTGTGG + Intronic
1187624697 X:21097628-21097650 CTTTTTGATGTGGACATTTAAGG + Intergenic
1191720235 X:64223071-64223093 CCCTATAATGTGGAGAACTGGGG - Intergenic
1197555370 X:127946580-127946602 CACTTTGATGTTAACAGCTGTGG + Intergenic
1198576631 X:138017136-138017158 CCTTTTGATGTGGAAATTTTGGG + Intergenic
1199342405 X:146696696-146696718 CCCTTTGAAGTGCTCATCTCTGG - Intergenic
1201362451 Y:13167749-13167771 CCCTTTCATGTGGACCCCTTAGG - Intergenic
1201921662 Y:19240376-19240398 CCTTTTGATGTAGACTTTTGAGG + Intergenic