ID: 1181726834

View in Genome Browser
Species Human (GRCh38)
Location 22:24817223-24817245
Sequence CTGGGGATGTACTATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1283
Summary {0: 1, 1: 0, 2: 13, 3: 174, 4: 1095}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181726825_1181726834 14 Left 1181726825 22:24817186-24817208 CCTGTGCTCTGTGCCTTCCTACA 0: 1
1: 0
2: 0
3: 15
4: 309
Right 1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG 0: 1
1: 0
2: 13
3: 174
4: 1095
1181726826_1181726834 1 Left 1181726826 22:24817199-24817221 CCTTCCTACAGTCCCGAGTGCTG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG 0: 1
1: 0
2: 13
3: 174
4: 1095
1181726827_1181726834 -3 Left 1181726827 22:24817203-24817225 CCTACAGTCCCGAGTGCTGCCTG 0: 1
1: 0
2: 1
3: 6
4: 147
Right 1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG 0: 1
1: 0
2: 13
3: 174
4: 1095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181726834 Original CRISPR CTGGGGATGTACTATGTGCC AGG Intronic
900009029 1:89128-89150 CTGAGCACCTACTATGTGCCAGG - Intergenic
901106170 1:6758262-6758284 CTGGGGACGTGCTAGGTGCAGGG + Intergenic
901117349 1:6858002-6858024 TTGAGCATTTACTATGTGCCAGG - Intronic
901119369 1:6877937-6877959 CTGAGTATCTACTATGTGCAAGG - Intronic
901158884 1:7159926-7159948 CTGAAAGTGTACTATGTGCCAGG - Intronic
901369660 1:8786035-8786057 CAGGGGATGTGCTGTGGGCCTGG - Intronic
901539826 1:9908848-9908870 GTGAGCATTTACTATGTGCCAGG - Intronic
901600757 1:10421777-10421799 GTAGGTATTTACTATGTGCCAGG - Intergenic
901829169 1:11881611-11881633 GTGGGCAGCTACTATGTGCCAGG + Intergenic
901885581 1:12220631-12220653 CTGAGCACCTACTATGTGCCTGG - Intergenic
902079296 1:13810254-13810276 GTAGGGAAATACTATGTGCCAGG - Intronic
902178746 1:14671334-14671356 CTGAGCACCTACTATGTGCCAGG - Intronic
902230619 1:15025076-15025098 CTGAGCACTTACTATGTGCCAGG + Intronic
902285012 1:15402171-15402193 CTGGGGGCCTACTATGGGCCAGG + Intergenic
902394840 1:16126916-16126938 CTAGGGACCTACTATGTGCCAGG - Intronic
902526670 1:17063274-17063296 CTGAGCATCAACTATGTGCCAGG + Intergenic
902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG + Intronic
902988930 1:20172540-20172562 CTGAGCATGTACTATCTGCCAGG + Intronic
903018140 1:20375193-20375215 CTGGGCGCCTACTATGTGCCAGG - Intergenic
903018870 1:20379724-20379746 TTGGGCATCTCCTATGTGCCAGG + Intergenic
903020747 1:20392156-20392178 TTGAGGACTTACTATGTGCCAGG + Intergenic
903139164 1:21328374-21328396 CTGAGGACCCACTATGTGCCAGG - Intronic
903141078 1:21339573-21339595 ATGAGCATCTACTATGTGCCTGG - Intronic
903144898 1:21365045-21365067 CTGAGCACCTACTATGTGCCAGG - Intergenic
903160979 1:21488994-21489016 CTGGGGAGGAACTAGTTGCCTGG + Intergenic
903183363 1:21616390-21616412 CTGAGTATTTACCATGTGCCAGG + Intronic
903268962 1:22176035-22176057 CTGAGCACCTACTATGTGCCGGG - Intergenic
903284186 1:22266915-22266937 AGGGGTATTTACTATGTGCCTGG + Intergenic
903354579 1:22738732-22738754 CTGAGGACCAACTATGTGCCTGG + Intronic
903432746 1:23320128-23320150 CTGGCATTGTGCTATGTGCCTGG - Intronic
903619746 1:24689330-24689352 CTGAGGATTTATTATGTACCAGG - Intergenic
903780018 1:25815086-25815108 CTGGGCACCTACTGTGTGCCAGG + Intronic
904271329 1:29352216-29352238 CTGGGGACGTACTATGTTCCAGG + Intergenic
904313672 1:29646081-29646103 ATGAGCATCTACTATGTGCCAGG - Intergenic
904321473 1:29700276-29700298 CTGTGTACCTACTATGTGCCCGG - Intergenic
904325533 1:29725306-29725328 CTGAGCACCTACTATGTGCCAGG + Intergenic
904338347 1:29812370-29812392 CTGAGCACCTACTATGTGCCAGG - Intergenic
904342587 1:29846463-29846485 CTGAGCACCTACTATGTGCCAGG + Intergenic
904375740 1:30081226-30081248 TTGAGCATTTACTATGTGCCGGG - Intergenic
904380086 1:30104750-30104772 CTGAGCACCTACTATGTGCCAGG + Intergenic
904407636 1:30303572-30303594 CTGAGCACCTACTATGTGCCAGG + Intergenic
904418834 1:30378631-30378653 ATGGGCATGTGCTGTGTGCCAGG + Intergenic
904456843 1:30652907-30652929 CTGAGCATCTACTATGTGCTAGG + Intergenic
904461470 1:30683075-30683097 CTGAGCACCTACTATGTGCCAGG + Intergenic
904530603 1:31166240-31166262 TTGGGGACATACTATGTGTCAGG + Intergenic
905010028 1:34741021-34741043 CTGGGGATGCCCTATGTGTTGGG - Intronic
905043704 1:34979812-34979834 CTGAACATTTACTATGTGCCAGG + Intergenic
905099060 1:35502377-35502399 CTGAGCATTTACTATATGCCAGG - Intronic
905364210 1:37440035-37440057 CTGAGGACCTACTATGTGCCAGG - Intergenic
905370636 1:37480930-37480952 CTGAGCATCTACCATGTGCCAGG - Intronic
905774436 1:40659538-40659560 CTGTGTACCTACTATGTGCCGGG + Intronic
905842320 1:41192540-41192562 CTGAGTGTTTACTATGTGCCAGG - Intronic
905975640 1:42171760-42171782 CTGGGAACCTAATATGTGCCAGG + Intergenic
906523969 1:46483848-46483870 AGGGGGATGTACCATGTGCCAGG - Intergenic
906674222 1:47681629-47681651 TTGAGCATGTATTATGTGCCAGG - Intergenic
906824467 1:48963915-48963937 CTGGGTATTTACTATGTGCAAGG + Intronic
906825676 1:48977049-48977071 TTGAGCATCTACTATGTGCCAGG - Intronic
906842533 1:49155366-49155388 TTGAGCATTTACTATGTGCCAGG + Intronic
906899001 1:49812784-49812806 CTGCAGAACTACTATGTGCCAGG + Intronic
906933438 1:50191228-50191250 CTGAGGATCTACTATGAGCCAGG - Intronic
907008117 1:50936144-50936166 GTGAGAACGTACTATGTGCCAGG + Intronic
907096512 1:51786161-51786183 CTGGGTTCTTACTATGTGCCAGG - Intronic
907196663 1:52692732-52692754 CTGGGGGCCTACTATGTGACTGG - Exonic
907396302 1:54192557-54192579 CTGAGCATCTACCATGTGCCAGG + Intronic
907457610 1:54585518-54585540 CTGAGTGTGTACTATGTGCCAGG + Intronic
907545981 1:55260423-55260445 CTGAGAACTTACTATGTGCCAGG + Intergenic
907567167 1:55445992-55446014 TTGGGAATCTACTGTGTGCCAGG - Intergenic
907660377 1:56386932-56386954 CTGAGTATTTCCTATGTGCCAGG - Intergenic
907825207 1:58009884-58009906 TTGAGCATTTACTATGTGCCAGG + Intronic
907866345 1:58402937-58402959 CTGGGGAGTTACTGTGAGCCAGG - Intronic
907957601 1:59245489-59245511 CCAAGTATGTACTATGTGCCAGG - Intergenic
908137142 1:61144756-61144778 CTGAGCATGTACCCTGTGCCAGG - Intronic
908190246 1:61695970-61695992 TTGAGCATTTACTATGTGCCAGG - Intronic
908263388 1:62355887-62355909 CTGATGACTTACTATGTGCCTGG + Intergenic
908329979 1:63062006-63062028 TTGAGGATCTACTATGTTCCAGG - Intergenic
908570328 1:65403157-65403179 TTGGGGCCTTACTATGTGCCAGG + Intronic
908631243 1:66110512-66110534 TTTGGTATTTACTATGTGCCAGG - Intronic
908693930 1:66815353-66815375 CTGAGTATTTACTATGTGACGGG - Intronic
908752730 1:67440126-67440148 TTGAGGATTTACTATGTGCTAGG + Intergenic
909470589 1:76023472-76023494 CTGAACATCTACTATGTGCCAGG - Intergenic
909502335 1:76348909-76348931 CTGAGTATGTACTATGAGCCAGG - Intronic
909514218 1:76489338-76489360 TTGAGTATGTACTATGTGACAGG + Intronic
909546637 1:76855527-76855549 CTGAGGGCCTACTATGTGCCAGG + Intergenic
909581246 1:77238075-77238097 CTGGCTAACTACTATGTGCCAGG + Intergenic
909685242 1:78340555-78340577 CTGAGCATGCACAATGTGCCAGG - Intronic
910007368 1:82415154-82415176 CTGTGTATCTACTATGTGCTAGG - Intergenic
910078857 1:83315004-83315026 CTGAGTATTCACTATGTGCCAGG - Intergenic
910127196 1:83855700-83855722 CTGAGCACATACTATGTGCCAGG - Intergenic
910340169 1:86177790-86177812 CTGAGCATGTGCTGTGTGCCAGG - Intergenic
911604289 1:99885374-99885396 ATGAGCATTTACTATGTGCCAGG - Intronic
911715343 1:101126249-101126271 CTGAGCACCTACTATGTGCCAGG - Intergenic
912240366 1:107901145-107901167 CTGGGGAGCTGCTATGTCCCAGG + Intronic
912454105 1:109786438-109786460 CTGAGCATGTGCTGTGTGCCAGG + Intergenic
912498533 1:110106760-110106782 CTGAGCACCTACTATGTGCCAGG + Intergenic
912709792 1:111942136-111942158 TTGGGCATGTACTACGAGCCAGG + Intronic
912975803 1:114329210-114329232 CTGAGCATCTACTATATGCCAGG + Intergenic
913070542 1:115294457-115294479 CTGGGCACCGACTATGTGCCAGG + Intronic
913202253 1:116504421-116504443 CTGAGCATTTACTATGTTCCAGG - Intergenic
913202344 1:116505030-116505052 CTGAGCATTTACTATGTTCCAGG - Intergenic
913432859 1:118814353-118814375 CTGAGTCTCTACTATGTGCCAGG + Intergenic
913716864 1:121544094-121544116 CTGCGGAAGTACTACCTGCCAGG - Intergenic
914333945 1:146698234-146698256 TTGAGGATGTACTCTGTGCTGGG - Intergenic
914886689 1:151590844-151590866 TTGTGCATCTACTATGTGCCAGG - Intergenic
915510473 1:156384363-156384385 TTGAGCATCTACTATGTGCCAGG - Intronic
915737098 1:158091858-158091880 CTGAGCATTTGCTATGTGCCAGG + Intronic
915842132 1:159222504-159222526 CTGAGGATTCACTATGTGCCAGG - Intergenic
916082454 1:161243388-161243410 ATGGGTATCTACTTTGTGCCAGG + Intergenic
916189656 1:162166784-162166806 CTGGGTATATACTATGGGCCAGG - Intronic
916411053 1:164547505-164547527 CTGACCATGTACTATATGCCAGG - Intergenic
916839652 1:168586314-168586336 CTGAGCCTGTACTATGTGCCAGG - Intergenic
916874979 1:168959550-168959572 CTGAGGTCCTACTATGTGCCAGG + Intergenic
916998216 1:170325107-170325129 TTGAGAATTTACTATGTGCCAGG + Intergenic
917080997 1:171257050-171257072 CTGAGCACTTACTATGTGCCAGG + Intronic
917300805 1:173571955-173571977 CTGAGCATTTACTATGTGCCAGG + Intronic
917455554 1:175182830-175182852 CTGAAGATGTGCTCTGTGCCAGG - Intronic
918257641 1:182764128-182764150 CTGGTGAAGGACTATGTGACTGG - Intergenic
918495318 1:185128843-185128865 CTGAGGATCTACTATGTGCCAGG + Intronic
918594230 1:186274301-186274323 TTGAGCATGTACTATATGCCTGG - Intergenic
919898042 1:202021864-202021886 CTGAGTATCTACTAGGTGCCAGG + Intergenic
920394373 1:205633050-205633072 CTGGGTATCTACTATGTGCTAGG - Intergenic
920812438 1:209299477-209299499 GGGGGCATGTACCATGTGCCAGG - Intergenic
921214169 1:212923250-212923272 TTGAGCATCTACTATGTGCCTGG - Intergenic
921349037 1:214216930-214216952 TTGAGCATGCACTATGTGCCAGG + Intergenic
921636969 1:217507101-217507123 ATGAGGGTGTACTAGGTGCCGGG - Intronic
923297066 1:232604430-232604452 CTGTGCACCTACTATGTGCCAGG + Intergenic
923457162 1:234174430-234174452 TTGAGGACCTACTATGTGCCAGG + Intronic
923577473 1:235172933-235172955 CTGTGCATTTATTATGTGCCAGG - Intronic
924022436 1:239798466-239798488 ATGGGGCTGTTCTATGTGCTAGG - Intronic
924128263 1:240878385-240878407 TTGAGCATCTACTATGTGCCAGG - Intronic
1063252946 10:4294270-4294292 CTGGGCATTTACTACGTGCTAGG - Intergenic
1063874939 10:10465216-10465238 CTGAGGATCAACTATGTGACAGG + Intergenic
1064384174 10:14876672-14876694 CTGTGCATCTCCTATGTGCCAGG - Intergenic
1064400267 10:15015137-15015159 CTTGGGATATACTATCTGACAGG - Intergenic
1064904894 10:20335153-20335175 CTGAGCATCTACTATGTGCTGGG - Intergenic
1065141931 10:22726412-22726434 CTGAGCACTTACTATGTGCCAGG - Intergenic
1065688987 10:28314187-28314209 CTGAGCACCTACTATGTGCCAGG + Intronic
1065928028 10:30453587-30453609 CTGGGCATCTGCTATGTGGCAGG + Intronic
1066329562 10:34405190-34405212 TTGGGTAAGTACTATGTGTCAGG - Intronic
1067073840 10:43161103-43161125 CTGAGCATCTACTATGTGCCAGG - Intronic
1067745474 10:48932550-48932572 CTGGAGTTGTACTATGGGTCAGG + Intronic
1067799476 10:49349245-49349267 CTGAGCATCTACTATGTTCCAGG - Intergenic
1068603290 10:58978334-58978356 CTGAGCACTTACTATGTGCCGGG + Intergenic
1069407375 10:68116131-68116153 TTGAGCATCTACTATGTGCCAGG - Intronic
1069587504 10:69618214-69618236 CTGAGCATTTACTATGTGCTAGG - Intergenic
1069622663 10:69847443-69847465 CTGAGGGCCTACTATGTGCCTGG - Intronic
1070005976 10:72424429-72424451 CTGAGTATGTACTATGGGCCAGG + Intronic
1070011467 10:72479031-72479053 CTGAGGAGTTACTATGTGGCAGG + Intronic
1070324052 10:75376235-75376257 CTGGGCTTGTAATCTGTGCCTGG + Intergenic
1070533732 10:77359872-77359894 CTGGGCACCTACTGTGTGCCAGG - Intronic
1070708257 10:78657321-78657343 CTGAGCACCTACTATGTGCCGGG - Intergenic
1070730068 10:78820900-78820922 CTGAAGGTGTATTATGTGCCAGG - Intergenic
1070758836 10:79010524-79010546 CTGAGCATTTACCATGTGCCAGG - Intergenic
1071293362 10:84202645-84202667 CTGAGGATCTACTCTGTGCTTGG - Intronic
1071295844 10:84218921-84218943 CTGAGGGTTTACTATGTGCCAGG + Intronic
1071731452 10:88252775-88252797 TTGGGCACCTACTATGTGCCCGG - Intergenic
1071822660 10:89294020-89294042 CTGAGAATCTACTATGTGCCAGG - Intronic
1071850697 10:89566890-89566912 CTGAGTACCTACTATGTGCCAGG + Intergenic
1071858159 10:89646182-89646204 CTGAGCATTTACTGTGTGCCAGG - Intergenic
1072036455 10:91567274-91567296 CTGTGGGCCTACTATGTGCCAGG - Intergenic
1072290771 10:93962270-93962292 CTGGGCATCTCCTGTGTGCCAGG - Intergenic
1072306508 10:94112930-94112952 TTGGGTACCTACTATGTGCCTGG + Intronic
1072459674 10:95607553-95607575 CTGAGCATGTACTATGTACTAGG + Intronic
1072729641 10:97836994-97837016 CTGAGCATTTACTATGTTCCAGG + Intergenic
1072868519 10:99090357-99090379 TTGGGGATGGACTATGTACTAGG - Intronic
1073067690 10:100773241-100773263 CTGAGTATCTACTATGTGCTAGG - Intronic
1073188073 10:101629197-101629219 CTGAGCACTTACTATGTGCCAGG + Intronic
1073278827 10:102336497-102336519 CTGAGCGTATACTATGTGCCAGG - Intronic
1073324763 10:102636040-102636062 TTGGGGATCTACAATGTGCTAGG + Intergenic
1073410128 10:103334763-103334785 TTGAGAAAGTACTATGTGCCAGG + Intronic
1073479642 10:103778382-103778404 CTGGGGGTTTCCTCTGTGCCTGG - Intronic
1073557889 10:104471201-104471223 TTGGGCACTTACTATGTGCCAGG - Intergenic
1073810449 10:107146969-107146991 CTGGGTTTTTACTATGTGCCAGG - Intronic
1074063518 10:109991017-109991039 CTGAGCATGTAATATATGCCAGG + Intergenic
1074446391 10:113524606-113524628 CTGAGCAATTACTATGTGCCAGG + Intergenic
1074528948 10:114283735-114283757 CTGAGCATCTATTATGTGCCAGG - Intronic
1074547242 10:114410435-114410457 CTGAGTACCTACTATGTGCCAGG - Intergenic
1074692552 10:116019419-116019441 CTGGGCACTTACTGTGTGCCAGG - Intergenic
1074703755 10:116113869-116113891 CTTGGCATTTACTTTGTGCCAGG - Intronic
1074876876 10:117620603-117620625 TTCAGGGTGTACTATGTGCCAGG - Intergenic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075822533 10:125327136-125327158 CTGAGTATCTACTCTGTGCCAGG - Intergenic
1076014467 10:127016211-127016233 CTGAGCACCTACTATGTGCCAGG - Intronic
1076124549 10:127963471-127963493 CTGGGCATCTACTATGTGTTGGG - Intronic
1077264009 11:1640117-1640139 CTGTGTGTGCACTATGTGCCTGG - Intergenic
1078180343 11:9005105-9005127 CTGAGCCTTTACTATGTGCCAGG + Intergenic
1078199182 11:9164684-9164706 CTGGGTACCTACTATGTGCCAGG - Intronic
1078261552 11:9714420-9714442 CTGAGTACATACTATGTGCCAGG - Intronic
1078264599 11:9745039-9745061 CTGGGTACTTACTGTGTGCCAGG - Intronic
1078278914 11:9879670-9879692 CTGTGCACGTACTATATGCCAGG + Intronic
1078281426 11:9905475-9905497 TTGAGTATCTACTATGTGCCAGG + Intronic
1078539999 11:12205766-12205788 CTGGGCACTTACTATGTGCTAGG - Intronic
1078598486 11:12710387-12710409 TTGGGCATCTACTGTGTGCCAGG + Intronic
1078728331 11:13953157-13953179 CTGAGCATCTACTATGTGCCAGG + Intergenic
1078839152 11:15061895-15061917 TTGAGGACCTACTATGTGCCAGG - Intronic
1078848923 11:15146109-15146131 CTGAGCATGTGTTATGTGCCAGG - Intronic
1078855456 11:15202979-15203001 CTGGGGGTTTATTTTGTGCCAGG + Intronic
1078903743 11:15665532-15665554 TTGAGCATGTACTATGTGCCAGG + Intergenic
1078955234 11:16186733-16186755 CTGGAGATGTGGAATGTGCCAGG - Intronic
1079574007 11:21980419-21980441 CTGTGTGTCTACTATGTGCCAGG - Intergenic
1079952909 11:26826704-26826726 GTAGGGATTTATTATGTGCCAGG - Intergenic
1080081982 11:28231924-28231946 TTGAGTATGTACTATATGCCAGG - Intronic
1080228435 11:29987477-29987499 CTGAGCACTTACTATGTGCCAGG + Intergenic
1080332491 11:31155315-31155337 TTGAGGACTTACTATGTGCCAGG + Intronic
1080360840 11:31511454-31511476 CTGAGAATCTACTAAGTGCCAGG - Intronic
1080362011 11:31526064-31526086 TTGAGGATGTACTGTGTGCTGGG + Intronic
1080429858 11:32188433-32188455 CTCGGCACCTACTATGTGCCAGG + Intergenic
1080769267 11:35325461-35325483 TTGAGCATCTACTATGTGCCAGG - Intronic
1081258346 11:40925793-40925815 CTGGAATTCTACTATGTGCCAGG + Intronic
1081280566 11:41204751-41204773 TTGAGCATTTACTATGTGCCAGG + Intronic
1081323716 11:41720652-41720674 CTGTGTACCTACTATGTGCCTGG - Intergenic
1081533849 11:43983380-43983402 CTGAGCACCTACTATGTGCCTGG + Intergenic
1081547786 11:44083869-44083891 CTGTGGATGTGCCATTTGCCAGG + Exonic
1081631281 11:44691758-44691780 TTGAGCATGTCCTATGTGCCAGG - Intergenic
1081693915 11:45096236-45096258 TTGAGCATTTACTATGTGCCAGG - Intronic
1081751319 11:45513245-45513267 CTGGGGTCCTACTTTGTGCCAGG - Intergenic
1081759596 11:45568005-45568027 CTGAGCACCTACTATGTGCCAGG - Intergenic
1081768101 11:45626594-45626616 CTGAGGACCTACTATGTGCTAGG + Intergenic
1081829303 11:46093685-46093707 TTGAGCATTTACTATGTGCCTGG - Intronic
1081840038 11:46193515-46193537 CTGGGTATCTATGATGTGCCTGG - Intergenic
1082104790 11:48210019-48210041 TTGGGTACCTACTATGTGCCAGG - Intergenic
1082778683 11:57269129-57269151 TTGAGCATTTACTATGTGCCAGG + Intergenic
1082812605 11:57487541-57487563 CTGAGAACCTACTATGTGCCAGG + Intronic
1083190354 11:61047439-61047461 CTGGGCACCTACTATGTGCCAGG + Intergenic
1083237968 11:61364173-61364195 CTGAGGACCTACTGTGTGCCAGG - Intronic
1084203332 11:67576765-67576787 CTGGGCACCTACTATGTGCCAGG - Intergenic
1084268208 11:68015650-68015672 CTGAGCACCTACTATGTGCCAGG + Intronic
1084551808 11:69848192-69848214 CTGAGCATCTATTATGTGCCAGG + Intergenic
1084561293 11:69906805-69906827 CTGAGCATCTACTATGTGCCAGG + Intergenic
1084730395 11:71069548-71069570 CTGAGCATCTACTATGTTCCAGG + Intronic
1084760827 11:71269615-71269637 CTGAGGATCTATTATGTGGCAGG - Intergenic
1084807361 11:71588211-71588233 CTGGGGATTGACTATCTGACAGG + Intronic
1084900192 11:72303749-72303771 CTGGGTATTTACTATGTGCCTGG + Intronic
1085313184 11:75528094-75528116 CTTGGCACCTACTATGTGCCAGG - Intergenic
1085341674 11:75735459-75735481 CTGAGGACCTACTATGTGCTAGG + Intergenic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1086514629 11:87597621-87597643 ATTGGGAAGCACTATGTGCCAGG - Intergenic
1086866504 11:91986125-91986147 CTGAGGATCTGCTAGGTGCCAGG + Intergenic
1086930616 11:92689042-92689064 TTGGGCATGTAGTATGTGCCAGG + Intronic
1087081449 11:94174672-94174694 CTGGGGACCTGCTATGTGCTAGG - Intronic
1087150798 11:94857822-94857844 CTGAGCATGTACCATGTACCAGG - Intronic
1088085272 11:105970562-105970584 CTGAGCATTTACTATGTACCAGG - Intronic
1088562388 11:111128499-111128521 CTGAGCTTCTACTATGTGCCAGG - Intergenic
1088679116 11:112224045-112224067 TTGGGCATCTACTATGTGGCTGG - Intronic
1089101198 11:115964135-115964157 TTGGGCATTTACTGTGTGCCAGG + Intergenic
1089160244 11:116431869-116431891 CTGAGTATCTCCTATGTGCCAGG + Intergenic
1089177624 11:116559939-116559961 ATGGGTATTTACTTTGTGCCAGG - Intergenic
1089361110 11:117887280-117887302 CTGAGCATTTACTATATGCCTGG + Intergenic
1089388229 11:118081785-118081807 CTGAGCATCTACTATGTGCTAGG + Intronic
1089397754 11:118146745-118146767 CTGAGCATCTACTATGTGCCAGG + Intronic
1089619192 11:119712894-119712916 TTGGGCATCTACTATGTGCCAGG - Intronic
1089683366 11:120131868-120131890 CTGAGCATCTAGTATGTGCCAGG + Intronic
1089746464 11:120620816-120620838 TTGGGCATGCACGATGTGCCGGG + Intronic
1089794587 11:120970043-120970065 CTGAGTAACTACTATGTGCCTGG - Intronic
1089808244 11:121111151-121111173 CTGAGGGTTTACTATGTGTCTGG + Intronic
1089881715 11:121780388-121780410 TTGAGTATCTACTATGTGCCAGG - Intergenic
1089991389 11:122864407-122864429 TTGGGCATTTACTCTGTGCCTGG - Intronic
1090805744 11:130201086-130201108 CTGAGCACCTACTATGTGCCAGG - Intronic
1090811308 11:130246659-130246681 CTGAGTATTTACCATGTGCCAGG + Intronic
1090930292 11:131291712-131291734 CTGAGCACTTACTATGTGCCAGG + Intergenic
1090945148 11:131422974-131422996 CTGAGCATTTATTATGTGCCAGG + Intronic
1091484985 12:877536-877558 CTGGGAATCTACTATGTACTAGG - Intronic
1091650354 12:2304649-2304671 CTGGGAATGTGCTTTGTGGCCGG - Intronic
1091677560 12:2502280-2502302 CTGAGGACCTACTATGTGCGAGG + Intronic
1091744044 12:2979858-2979880 CTGGGCATGTACTATATGACAGG - Intronic
1091864822 12:3823490-3823512 CTGAGTGTGTACTATGTGCCAGG - Intronic
1092046909 12:5437819-5437841 CTGTGGATGTACTTTGTGCATGG + Intronic
1092252798 12:6910241-6910263 TTGAGAATGTGCTATGTGCCAGG + Intronic
1092933803 12:13341387-13341409 TTGAGGATGTACTATGTGCTAGG + Intergenic
1092953583 12:13529666-13529688 CTGAGCATCTACTATATGCCAGG - Intergenic
1093044602 12:14427863-14427885 CTGGGCACTTACTGTGTGCCAGG - Intronic
1093955525 12:25213902-25213924 CTGGGTAGTTACTATGTCCCAGG + Intronic
1094161292 12:27393717-27393739 TTGAGTGTGTACTATGTGCCAGG + Intronic
1094318504 12:29158974-29158996 CTGAGTACCTACTATGTGCCAGG + Intronic
1094484362 12:30912553-30912575 TTGGGTATTTACTATATGCCAGG - Intergenic
1094494630 12:30981755-30981777 CTAGGCAGCTACTATGTGCCTGG - Intronic
1094670750 12:32566483-32566505 CTGGTTATGTACTATGTGAGCGG - Intronic
1095158381 12:38886545-38886567 TTGGGCATGTATTATGTGCCAGG + Intronic
1095702479 12:45204613-45204635 TTGAGTATCTACTATGTGCCAGG + Intergenic
1095816950 12:46433728-46433750 TTGGGGATCTACTCTGTGCTTGG + Intergenic
1095834809 12:46625985-46626007 CTGGGTACTTACTCTGTGCCAGG + Intergenic
1095914123 12:47458776-47458798 TTGAGTATGTACTATGTGCCAGG - Intergenic
1095970149 12:47896192-47896214 CTGAGCAGGTACTACGTGCCAGG - Intronic
1096228238 12:49882791-49882813 CTGGGTACCTACTATGTACCAGG + Intronic
1096274761 12:50196870-50196892 CTGGGTGTTTACTATGTGCCAGG + Intronic
1096394198 12:51253278-51253300 CTGAGTGTGTACTCTGTGCCAGG + Intronic
1096678222 12:53237187-53237209 CTGAGTATCTGCTATGTGCCAGG + Intergenic
1096749134 12:53747720-53747742 CTGGGGACTTACTATGTACAGGG + Intergenic
1097115749 12:56695596-56695618 TTGAGCATCTACTATGTGCCAGG - Intergenic
1097639132 12:62158175-62158197 ATTGAGATCTACTATGTGCCAGG - Intronic
1097927091 12:65140908-65140930 TTGAGGATTTACTATATGCCAGG + Intergenic
1097941047 12:65305957-65305979 CTGAGCATATACTATGTCCCAGG + Intronic
1098299689 12:69041836-69041858 CTCAGGACCTACTATGTGCCAGG + Intergenic
1099168452 12:79336228-79336250 CTGGAGAGGGACTATGTGGCAGG - Intronic
1100182627 12:92101670-92101692 CTGGGTGGCTACTATGTGCCAGG + Intronic
1100549435 12:95633350-95633372 CTGGGCAGCTACTGTGTGCCAGG - Intergenic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1101037873 12:100722718-100722740 CTGGTCACCTACTATGTGCCAGG - Intronic
1101250177 12:102926037-102926059 TTGAAGATGTACTAAGTGCCAGG + Intronic
1101258592 12:103005786-103005808 TTGGACATTTACTATGTGCCAGG + Intergenic
1101609344 12:106276321-106276343 CCGAGCATGTACTATGTGCCAGG + Intronic
1101815038 12:108139716-108139738 CTGAGCATTTACTATGTGCTAGG - Intronic
1101830377 12:108252160-108252182 CTGAGCATCTACCATGTGCCAGG + Intergenic
1101840261 12:108322907-108322929 CTGGGCACCTACTATGTGCCAGG + Intronic
1101927169 12:108981755-108981777 CTGAGGATTTATTATGTGCCAGG - Intronic
1102043966 12:109818143-109818165 CTGGGGATGTCCTGGGTGCCAGG + Intronic
1102046018 12:109830858-109830880 CTGAGCACCTACTATGTGCCAGG + Intronic
1102053260 12:109878758-109878780 CTGAGCATCTGCTATGTGCCAGG + Intronic
1102100037 12:110271190-110271212 CTGAGCATCTGCTATGTGCCTGG + Intergenic
1102139410 12:110602264-110602286 CTGAGCACCTACTATGTGCCCGG - Intergenic
1102205114 12:111084983-111085005 TTGAGCATCTACTATGTGCCAGG + Intronic
1102288055 12:111675483-111675505 CTGAGCATCTAGTATGTGCCAGG + Intronic
1102415133 12:112755064-112755086 CTGAGGACCTACTAAGTGCCAGG - Intronic
1102417334 12:112775362-112775384 CTGTGCATGTACCATGTGCCAGG + Intronic
1102497971 12:113332636-113332658 TTGAGCATCTACTATGTGCCAGG - Intronic
1102570899 12:113826368-113826390 TTGAGCATCTACTATGTGCCAGG - Intronic
1102625292 12:114230517-114230539 ATGAGTATTTACTATGTGCCTGG + Intergenic
1102884387 12:116510564-116510586 CTGAGCACCTACTATGTGCCAGG - Intergenic
1103452816 12:121041315-121041337 CTGGGCACCTACTCTGTGCCAGG + Intergenic
1103605367 12:122082001-122082023 CTGGGGAGGAACTAAGTGCAGGG + Intronic
1103885151 12:124194936-124194958 ATGTGCATCTACTATGTGCCAGG - Intronic
1103906818 12:124332067-124332089 CTGGGCACCTACTATGTGCTGGG + Intronic
1103922774 12:124407783-124407805 CTGAGCATCTACCATGTGCCAGG + Intronic
1103929271 12:124440589-124440611 CTGAGCATCTACTATGTGCCAGG + Intronic
1104066228 12:125309487-125309509 CTGAGCACCTACTATGTGCCAGG + Intronic
1104390844 12:128389568-128389590 CTGAGCACCTACTATGTGCCAGG - Intronic
1104848174 12:131857637-131857659 CTGGGGAGGTGCTGTGTGCTGGG + Intergenic
1104848191 12:131857704-131857726 CTGGGGAGGTGCTGTGTGCTGGG + Intergenic
1105620709 13:22063348-22063370 CTGAGCATTTACTATGTGCTAGG + Intergenic
1106201153 13:27538439-27538461 CTTAGCATCTACTATGTGCCAGG - Intergenic
1106482783 13:30149314-30149336 TTGAGCATCTACTATGTGCCAGG + Intergenic
1107137832 13:36963917-36963939 CTGGGTACCTACTATGTGCTGGG + Intronic
1107438829 13:40405458-40405480 CTGAGCATGTACTATGCACCAGG - Intergenic
1107580746 13:41781796-41781818 CTTGGCAGTTACTATGTGCCAGG + Intronic
1107880906 13:44831219-44831241 CTGAGCACTTACTATGTGCCAGG - Intergenic
1108285526 13:48904372-48904394 CTGGGCACCTACTATGTGCTAGG - Intergenic
1108327757 13:49351048-49351070 CTGAAGATCTACTATGTGCCTGG + Intronic
1108421044 13:50249873-50249895 CTGGGCACCTACTATGTGTCAGG - Intronic
1108495244 13:51018448-51018470 TTGAGCATTTACTATGTGCCAGG - Intergenic
1108890860 13:55257460-55257482 ATGGAAATGTACCATGTGCCAGG + Intergenic
1110170731 13:72497362-72497384 CTGAGCACCTACTATGTGCCAGG + Intergenic
1110180215 13:72607806-72607828 CTGAGAGTGTATTATGTGCCAGG + Intergenic
1110542109 13:76718351-76718373 CTGTGTATCTACTACGTGCCTGG + Intergenic
1110702648 13:78566872-78566894 ATGAGAGTGTACTATGTGCCAGG - Intergenic
1111871438 13:93838119-93838141 CTGAGCACCTACTATGTGCCAGG + Intronic
1112288548 13:98125193-98125215 CTGAGCATGTATTATGTGCCAGG - Intergenic
1112437294 13:99399515-99399537 CTGGGGATGGACTCAGTGCCTGG - Intergenic
1113161856 13:107390981-107391003 CTGAGCATCTACCATGTGCCAGG + Intronic
1114556414 14:23564911-23564933 CTGAGGCTCTACTATGTGCCAGG + Intronic
1115370198 14:32604770-32604792 CTTAGGATTTACTATGTGCTAGG - Intronic
1115424370 14:33239304-33239326 CTGAGGATTTAATATGTGCCAGG + Intronic
1115636452 14:35294644-35294666 CTGAGCATTTACTATGTGGCAGG - Intronic
1115748294 14:36460910-36460932 CTGAGCACTTACTATGTGCCAGG + Intergenic
1117118073 14:52536944-52536966 TTGAGAATGTATTATGTGCCAGG - Intronic
1117524297 14:56581615-56581637 TTGGGCACTTACTATGTGCCAGG + Intronic
1117623386 14:57610794-57610816 CTGAGTATCTCCTATGTGCCAGG + Intronic
1117712265 14:58543421-58543443 CTGTGCACCTACTATGTGCCTGG - Intronic
1118043356 14:61940635-61940657 CATGGCATTTACTATGTGCCAGG - Intergenic
1118297592 14:64584891-64584913 CTAAGTATGGACTATGTGCCGGG - Intronic
1118320859 14:64752624-64752646 CTGAGCATCTACTATGTGCCAGG - Intronic
1118477859 14:66135118-66135140 CTGGGGATCTTCCATCTGCCTGG + Intergenic
1118810339 14:69268584-69268606 CTGAGCATGTACTATGTGCCAGG + Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1118976519 14:70682333-70682355 CTGAGAATCTGCTATGTGCCAGG - Intergenic
1118989059 14:70781627-70781649 CTGAGCATTTACTTTGTGCCAGG + Intronic
1119360501 14:74045145-74045167 TTGAGCATTTACTATGTGCCAGG - Intronic
1119392624 14:74301497-74301519 CTGTGGATTTCCTATGTTCCTGG - Intronic
1119441000 14:74628739-74628761 CTGGGCATCTTCTATGTGCCAGG + Intergenic
1119592486 14:75903024-75903046 CTGAGGATTTGCTATGTGTCAGG + Intronic
1119827090 14:77666173-77666195 CTGAGTAACTACTATGTGCCAGG + Intergenic
1119917112 14:78412497-78412519 TTGGGCATTTGCTATGTGCCAGG + Intronic
1120180413 14:81337344-81337366 TTGAGCATCTACTATGTGCCAGG + Intronic
1120317968 14:82920690-82920712 CTGGGGATTTACTATAATCCTGG - Intergenic
1120653622 14:87163742-87163764 TTGAGCATGTACTATGTGTCAGG + Intergenic
1120715252 14:87834515-87834537 TTGAGCATTTACTATGTGCCAGG + Intergenic
1120761537 14:88289850-88289872 CTGAGTATTTACTATGTGCCAGG - Intronic
1120886573 14:89456420-89456442 TTGGGCACCTACTATGTGCCAGG - Intronic
1120902224 14:89585523-89585545 CTGAGCATCTACTATGGGCCAGG + Intronic
1120969718 14:90197245-90197267 CTGAGCATTTACTATGTGCCAGG - Intergenic
1120999205 14:90439360-90439382 GTGGGGACCTACTTTGTGCCAGG - Intergenic
1121237708 14:92404886-92404908 CTGAGGACCTATTATGTGCCAGG - Intronic
1121270945 14:92638033-92638055 CTGAGCATCTACTATGTGTCAGG - Intronic
1121306308 14:92909849-92909871 CTGAGCATTTACTATGTGCCAGG - Intergenic
1121453212 14:94022562-94022584 CTGGACATCAACTATGTGCCAGG - Intergenic
1121506485 14:94481635-94481657 CTGGGAATCTTCTGTGTGCCAGG - Intergenic
1121553069 14:94816839-94816861 CTGAGCATCTACTATGTGCCAGG + Intergenic
1121742111 14:96261343-96261365 CTGAGAATGTACTATGTGCCAGG - Intronic
1121909452 14:97775953-97775975 CTGAGGATGTGCTATTTTCCAGG + Intergenic
1121951143 14:98172028-98172050 CTGAGGACCTACTGTGTGCCAGG - Intergenic
1122098438 14:99388349-99388371 CTGGGCACCTACTATGTGCAAGG + Intergenic
1122109486 14:99487006-99487028 CTGAGCATTTACTATGAGCCAGG - Intronic
1122156580 14:99753699-99753721 CTGAGCACCTACTATGTGCCAGG - Intronic
1122261102 14:100523553-100523575 CTACAGATTTACTATGTGCCTGG - Intronic
1123434538 15:20245415-20245437 CTGGGGATGTGCTCAGTGGCAGG + Intergenic
1123709875 15:22979925-22979947 CTGGAGCTGTGCCATGTGCCGGG + Intronic
1124241292 15:28030234-28030256 CAGGGACTGTACTAGGTGCCAGG + Intronic
1124660693 15:31548656-31548678 TTGGGGATCTCCTATGTGCTAGG - Intronic
1124841194 15:33243666-33243688 TTGGGCATCTACTATGTGCCAGG + Intergenic
1124996644 15:34729365-34729387 AGGGGCTTGTACTATGTGCCAGG - Intergenic
1125334016 15:38609937-38609959 GTGAAGATTTACTATGTGCCAGG - Intergenic
1125421045 15:39504326-39504348 CTGGGGGTTTACCATGTGCCTGG + Intergenic
1125475120 15:40042396-40042418 TTGGGCATTTACTATGTGCTAGG - Intergenic
1126181735 15:45792160-45792182 CTGGATATCTACTATGTTCCTGG + Intergenic
1126456367 15:48866417-48866439 CTGAGGATCTACTACGTGCCAGG + Intronic
1127387169 15:58475858-58475880 CTGAGCATTTCCTATGTGCCAGG + Intronic
1127578927 15:60319250-60319272 CTGGGCTTTTTCTATGTGCCAGG - Intergenic
1127618347 15:60709248-60709270 CTGAGTTTCTACTATGTGCCTGG + Intronic
1127651637 15:61014314-61014336 CTAAGGACCTACTATGTGCCAGG - Intronic
1128100789 15:64997999-64998021 TTGAGGGTGTACTATATGCCAGG + Intergenic
1128214822 15:65927171-65927193 CTGAGCACTTACTATGTGCCAGG + Intronic
1128367451 15:67014367-67014389 CTGAGCATTTACTATGTACCAGG - Intergenic
1128674960 15:69601898-69601920 CTGAGTACTTACTATGTGCCAGG - Intergenic
1128715695 15:69906076-69906098 CTGAGCATGTATTAAGTGCCAGG + Intergenic
1128728301 15:70004137-70004159 TTGGACATTTACTATGTGCCAGG - Intergenic
1128753491 15:70165425-70165447 CTGTGGCTGTACTAGGTGCTGGG + Intergenic
1128944074 15:71809760-71809782 CTGGGAACGTCCTCTGTGCCAGG + Intronic
1129201119 15:74000842-74000864 CTGAGTATTTAATATGTGCCAGG - Intronic
1129243462 15:74265635-74265657 GTGAGTATCTACTATGTGCCAGG - Intronic
1129484889 15:75861169-75861191 ATGGGGATGTGCTATGCACCAGG - Intronic
1129697949 15:77751302-77751324 CTGAGGACTTACCATGTGCCAGG - Intronic
1129698790 15:77755710-77755732 CTGGGCACCTACTATGTGCTGGG + Intronic
1129807786 15:78478901-78478923 TTGAGCATTTACTATGTGCCTGG - Intronic
1129850104 15:78788857-78788879 CTGAGCATCTACTATGTGCCAGG + Intronic
1129856241 15:78827302-78827324 CTGGGCATTTACTATGTGCCAGG - Intronic
1129893471 15:79087336-79087358 CTGTGCATCTACTATGTGCACGG + Intronic
1130041573 15:80409550-80409572 CTGAGTAACTACTATGTGCCGGG + Intronic
1130252161 15:82306718-82306740 CTGAGCATCTACTATGTGCCGGG - Intergenic
1130363490 15:83211469-83211491 ATGAGAATTTACTATGTGCCAGG - Intergenic
1130381775 15:83378150-83378172 CTGGGGGTCTTTTATGTGCCAGG + Intergenic
1130676700 15:85959155-85959177 CTGAGCATCTACAATGTGCCAGG + Intergenic
1131179877 15:90232533-90232555 CTGAGCATTTACTATGTGCTTGG + Intronic
1133459066 16:5971131-5971153 TTGAGGATCTACTATGTGCTAGG + Intergenic
1133688583 16:8190536-8190558 CTGAGCATCTACTTTGTGCCAGG + Intergenic
1133787230 16:8983019-8983041 CTGAGCACGTACTATGTGCCTGG + Intergenic
1133819597 16:9224790-9224812 TTGAGCATTTACTATGTGCCAGG - Intergenic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133843386 16:9430357-9430379 CTGAGGTTCTACTATGTACCAGG - Intergenic
1134511973 16:14855827-14855849 CTGGGCACCTACTATGTGCCAGG - Intronic
1134639417 16:15817982-15818004 CTGAGCAGCTACTATGTGCCAGG + Intronic
1134699613 16:16254327-16254349 CTGGGCACCTACTATGTGCCAGG - Intronic
1134972215 16:18540344-18540366 CTGGGCACCTACTATGTGCCAGG + Intronic
1135009605 16:18863074-18863096 CTGAGCATGTACTATGACCCAGG - Intronic
1135067866 16:19326019-19326041 GTGGGTACCTACTATGTGCCTGG + Intergenic
1135188097 16:20332261-20332283 CTGAGCATGTCATATGTGCCAGG - Intergenic
1135663406 16:24315983-24316005 TTGAGCATGTACTATGTGCCAGG + Intronic
1135963440 16:27016496-27016518 CTGGGCATCTACTAGGTGCCAGG + Intergenic
1136017794 16:27415841-27415863 TTGGAGATGGACTATGTGCCTGG + Intronic
1136100636 16:27992968-27992990 TTGAGAACGTACTATGTGCCAGG + Intronic
1136144448 16:28307934-28307956 CTGAGCATTTACTATATGCCAGG - Intronic
1136349968 16:29700467-29700489 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1136850083 16:33605688-33605710 CTGGGGATGTGCTCAGTGGCAGG - Intergenic
1137378936 16:47979856-47979878 CTGAGCACTTACTATGTGCCAGG - Intergenic
1137404007 16:48176011-48176033 CTGAGCACCTACTATGTGCCTGG - Intronic
1137498607 16:48993133-48993155 CTGAGTATGTGCTATGTTCCAGG - Intergenic
1137564741 16:49525884-49525906 TTGAGCATGTACTATGTGCCAGG + Intronic
1137627286 16:49917271-49917293 CTGAGGAGCTACTATGAGCCGGG + Intergenic
1137760957 16:50939980-50940002 CTGGGCACTTACTATGTGGCAGG - Intergenic
1137769672 16:51005912-51005934 CTGGGCTTGTGCTCTGTGCCTGG + Intergenic
1138099118 16:54237695-54237717 CTGAGTGTTTACTATGTGCCAGG + Intergenic
1138158729 16:54732123-54732145 CTGAGTAACTACTATGTGCCAGG - Intergenic
1138275259 16:55729713-55729735 CTGAGAACTTACTATGTGCCAGG - Intergenic
1138279525 16:55762187-55762209 GTGGGCACCTACTATGTGCCAGG - Intergenic
1138289001 16:55831491-55831513 GTGGGCACCTACTATGTGCCAGG + Intronic
1138378671 16:56584960-56584982 CTGGGAGTTTACCATGTGCCAGG - Intergenic
1138463668 16:57170613-57170635 CTGAGAATCTACTATATGCCAGG + Intronic
1138531483 16:57636742-57636764 CTGGGGATCTTCTATGGACCAGG + Intronic
1138563224 16:57814471-57814493 TTGAGCACGTACTATGTGCCAGG + Intronic
1139086624 16:63594738-63594760 TTGAGCATCTACTATGTGCCAGG + Intergenic
1139277288 16:65739944-65739966 CTAGGCATCTACTATGAGCCAGG + Intergenic
1139353171 16:66350663-66350685 CTTGGTATGTTCTATGTGCCAGG - Intergenic
1139356963 16:66372296-66372318 TTGAGCATCTACTATGTGCCAGG - Intronic
1139397143 16:66649338-66649360 CTGAGGATCTACTACATGCCAGG + Intronic
1139507762 16:67407766-67407788 CTGAGGATCTACTATGTACAAGG - Exonic
1139999673 16:71013015-71013037 TTGAGGATGTACTCTGTGCTGGG + Intronic
1140729602 16:77843967-77843989 CTGAGCATGTACTATGAGCCAGG + Intronic
1140822643 16:78677728-78677750 CTGGACATATCCTATGTGCCAGG - Intronic
1140894767 16:79315122-79315144 TTGAGCATCTACTATGTGCCAGG + Intergenic
1141618632 16:85224566-85224588 TTGAGCATCTACTATGTGCCGGG + Intergenic
1141643329 16:85354401-85354423 CTGAGCACCTACTATGTGCCAGG - Intergenic
1141644320 16:85359157-85359179 CTGGGGATGTCCTGAGTGACAGG - Intronic
1142124723 16:88404538-88404560 GTGGGGATGTCGTCTGTGCCTGG + Intergenic
1142141927 16:88476351-88476373 CTGGGTACCTACTGTGTGCCGGG + Intronic
1142261573 16:89044920-89044942 CTGGGGAAGCTCTATGTGCCAGG - Intergenic
1203111696 16_KI270728v1_random:1454141-1454163 CTGGGGATGTGCTCAGTGGCAGG - Intergenic
1142489555 17:269468-269490 CTGAGGATTTGCTATGTGCCGGG - Intronic
1142526989 17:550067-550089 ATGAGCATTTACTATGTGCCTGG + Intronic
1142950284 17:3472554-3472576 CTGGGCATTTACTGTGTGCCAGG - Intronic
1143029950 17:3962407-3962429 CTGAGCACTTACTATGTGCCAGG - Intronic
1143101594 17:4507442-4507464 TTGAGGACCTACTATGTGCCAGG + Intronic
1143423912 17:6817841-6817863 CTGAGCATGTACTATGTGCCAGG - Intronic
1143749653 17:9019466-9019488 ATATGCATGTACTATGTGCCTGG + Intergenic
1143808080 17:9446246-9446268 GTGAGGATCTACTATGTGCCAGG - Intronic
1144037924 17:11383980-11384002 CTGAGCATTTACTATGTACCAGG + Intronic
1144039276 17:11394162-11394184 CTGGGCATCAAATATGTGCCAGG - Intronic
1144181174 17:12753883-12753905 CTGAGCACCTACTATGTGCCAGG + Intronic
1144273956 17:13646915-13646937 CTGAGCATTTACTGTGTGCCAGG + Intergenic
1144327509 17:14196185-14196207 CTGGGGACCTACTGTTTGCCAGG + Intronic
1144709967 17:17394951-17394973 TTGGGCACCTACTATGTGCCAGG - Intergenic
1145266093 17:21380200-21380222 CTGGGCACCTACTCTGTGCCAGG - Intronic
1145789971 17:27620443-27620465 CTGGGACTGTACTAGGAGCCAGG - Intronic
1145813555 17:27779909-27779931 CTGAGCACCTACTATGTGCCAGG + Intronic
1146152146 17:30483360-30483382 ATGAGCATCTACTATGTGCCAGG + Intronic
1146475560 17:33159899-33159921 CTGAGCATTTTCTATGTGCCAGG - Intronic
1146481530 17:33208783-33208805 CTGAGCATCTGCTATGTGCCAGG - Intronic
1146578397 17:34014132-34014154 TTGGGTACTTACTATGTGCCAGG + Intronic
1146627945 17:34448186-34448208 CTGGGCACATACTATGTGCCAGG + Intergenic
1146787816 17:35733909-35733931 CTGGGCACCTGCTATGTGCCAGG + Intronic
1146799519 17:35807515-35807537 CTGGAGGTTTACTATGTGACAGG - Intronic
1146921886 17:36718811-36718833 CTGTGGATCTACTATGTGTCAGG - Intergenic
1147308328 17:39578755-39578777 CTGGGCATCTACTGTGTGCCAGG + Intergenic
1147361835 17:39935698-39935720 CTGAGCATGTACTGTGTACCAGG - Intergenic
1147628161 17:41913317-41913339 CTGAGCATCTACCATGTGCCAGG + Intronic
1147891054 17:43717180-43717202 CTGTGGACTTACTATGTGCAGGG - Intergenic
1148136125 17:45293047-45293069 CTGGGGAGGCACTGTGTGCAGGG - Intronic
1148160459 17:45447082-45447104 CTGGGGATGTGCCACCTGCCAGG - Intronic
1148522326 17:48290717-48290739 CTGGGCACCTACTATGTGCCAGG - Intronic
1148546275 17:48521590-48521612 CTGAGCATCTACTATGTTCCAGG + Intergenic
1148740961 17:49892187-49892209 TTGAGCATCTACTATGTGCCAGG + Intergenic
1148812159 17:50300290-50300312 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1148871538 17:50661308-50661330 CTGTGCATATACTATGTGCCGGG + Intronic
1148955331 17:51349134-51349156 CTGGGGACCTAGCATGTGCCTGG - Intergenic
1148984524 17:51610151-51610173 TTGGGCATCTACTATGTGCCAGG + Intergenic
1148984872 17:51612581-51612603 TTGGGCATCTCCTATGTGCCAGG - Intergenic
1149018495 17:51936177-51936199 CTGAGGACCTACTATGTGTCAGG + Intronic
1149605723 17:57923789-57923811 CTGGACACCTACTATGTGCCAGG + Intronic
1149954189 17:61027830-61027852 CTGCACATTTACTATGTGCCAGG - Intronic
1150194315 17:63279293-63279315 CTGAGCATTTACTATGTACCAGG + Intronic
1150391748 17:64793962-64793984 CTGGGGATGTGCCACCTGCCAGG - Intergenic
1150559640 17:66283422-66283444 TTGAGCATCTACTATGTGCCAGG + Intergenic
1150840558 17:68601729-68601751 CTGAGCACCTACTATGTGCCAGG - Intergenic
1151305233 17:73258815-73258837 CTGAGCACTTACTATGTGCCAGG - Intronic
1151388695 17:73771105-73771127 GAGGGGATGTACTGTGTGCATGG + Intergenic
1151424607 17:74022789-74022811 TTGAGTATGTACTACGTGCCAGG - Intergenic
1151520371 17:74624471-74624493 CTGGGCAGTTACTATGTTCCAGG - Intergenic
1151712806 17:75816605-75816627 CTGTGCATTTACTGTGTGCCAGG - Intronic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1152282800 17:79395385-79395407 CTGGGGACCTGCTATGTGTCTGG + Intronic
1152332297 17:79680261-79680283 CTGAGCATCTACTATGTGACAGG - Intergenic
1152572068 17:81125235-81125257 CTGGGGAGGGACTGTGTGCGTGG + Intronic
1152979593 18:263756-263778 TTGAGCATCTACTATGTGCCTGG - Intronic
1153422617 18:4925112-4925134 CTGGGCATCTAGTATGTGCCTGG + Intergenic
1153445712 18:5170522-5170544 ATGAGGATGTACAATGTGCCAGG - Intronic
1153528431 18:6019569-6019591 CTGAGCATCTACTAGGTGCCAGG + Intronic
1154208691 18:12360450-12360472 CTGGGCATGTACTAAGTACCAGG + Intronic
1154333092 18:13446034-13446056 CTGAGCATGTACTGTGGGCCAGG - Intronic
1155150331 18:23117883-23117905 CTGAGTACCTACTATGTGCCAGG + Intergenic
1155222584 18:23698756-23698778 ATTGGCATCTACTATGTGCCAGG + Intronic
1155236390 18:23823652-23823674 ATGGGGGCCTACTATGTGCCAGG - Intronic
1155565760 18:27132527-27132549 CTGAGCATCTACTATGTGCCAGG + Intronic
1156231631 18:35158810-35158832 TTGGGCATCTACTATGTGCTGGG - Intergenic
1156385538 18:36601504-36601526 CTGAGCATGTACTATATGCCAGG + Intronic
1156672246 18:39484939-39484961 CTGATGGTTTACTATGTGCCAGG + Intergenic
1156676524 18:39532992-39533014 TTGAGCATTTACTATGTGCCAGG + Intergenic
1156970380 18:43147062-43147084 CTGAGGATCTACTATGTTACAGG + Intergenic
1157134662 18:45042014-45042036 CTGAGCATGTACTATGTGTCAGG - Intronic
1157511702 18:48280002-48280024 TTGAGCATCTACTATGTGCCAGG + Intronic
1157599140 18:48882971-48882993 TTGAGCATGTACTCTGTGCCAGG + Intergenic
1157743204 18:50111910-50111932 CTGAGTACCTACTATGTGCCAGG + Intronic
1158409969 18:57197094-57197116 CTGGGTATCTACTCTGAGCCAGG - Intergenic
1161090705 19:2358628-2358650 CTGAGTATGTGCTGTGTGCCCGG - Intergenic
1161261915 19:3342544-3342566 TTGTGCATGTACCATGTGCCAGG - Intergenic
1161751141 19:6097536-6097558 ATGGGTACATACTATGTGCCTGG - Intronic
1161864754 19:6825693-6825715 TTGAGCATCTACTATGTGCCAGG - Intronic
1162312498 19:9915151-9915173 CTGAGCATCTACTATGTCCCAGG + Intronic
1162571295 19:11475158-11475180 CTGAGCATCTACTGTGTGCCAGG + Intronic
1162700486 19:12511431-12511453 TGGGGTATCTACTATGTGCCAGG + Intronic
1162850595 19:13428419-13428441 CTGAGGTTCTACTATGTGCTAGG - Intronic
1163172076 19:15538423-15538445 CTGAGCATCAACTATGTGCCAGG - Intronic
1163201613 19:15773843-15773865 CTGAGTATCTACTATGTGCTAGG + Intergenic
1163342745 19:16720176-16720198 CTGAGCACCTACTATGTGCCAGG + Exonic
1163681088 19:18683169-18683191 CTGAGCACCTACTATGTGCCAGG - Intergenic
1164400821 19:27901046-27901068 CTGAGCATCTACTATGTGCCAGG + Intergenic
1164690537 19:30207704-30207726 CTGAGCATGTACTATGTGCCAGG - Intergenic
1164708279 19:30336318-30336340 CTGAGCACCTACTATGTGCCAGG - Intronic
1164725918 19:30465546-30465568 CTGAGTCTGTATTATGTGCCAGG - Intronic
1164820846 19:31250053-31250075 CCGGGCATGTGCTGTGTGCCTGG - Intergenic
1164822457 19:31260637-31260659 TTGAGCATCTACTATGTGCCAGG + Intergenic
1165030763 19:32996538-32996560 CTGGGGATGTGCTCAGTGGCAGG + Intronic
1165315474 19:35052788-35052810 CTGAGAACCTACTATGTGCCAGG - Intronic
1165393221 19:35550059-35550081 TTGAGGACCTACTATGTGCCAGG + Exonic
1165441070 19:35828117-35828139 CTGGGGATGTATTTTGTTCTAGG + Intronic
1165898590 19:39157503-39157525 CTGCGCATGTACTCTGAGCCAGG + Intronic
1165956705 19:39505633-39505655 CTGAGAATTTACTGTGTGCCAGG + Intronic
1165993874 19:39831440-39831462 TTGGGTATTTACTATGTGCCAGG + Intronic
1166842382 19:45705902-45705924 TTGAGCATCTACTATGTGCCAGG + Intergenic
1166999454 19:46737362-46737384 CTGGGCATCTACGCTGTGCCTGG + Intronic
1167078854 19:47265640-47265662 CTGGGCACTTACTATGTGCCAGG + Intronic
1167254051 19:48416602-48416624 CTGAGCATCTACTATGTGCCAGG + Intronic
1167489444 19:49783063-49783085 CTGAGCACATACTATGTGCCAGG + Intronic
1168095285 19:54110919-54110941 TCGAGGATGTACTACGTGCCAGG - Intronic
1168140834 19:54385759-54385781 CTGAGCATCTATTATGTGCCAGG - Intergenic
1168157508 19:54484299-54484321 CTGAGCATCTATTATGTGCCAGG + Intergenic
1168331054 19:55568988-55569010 CTGAGCCTCTACTATGTGCCAGG - Intergenic
1168421544 19:56207377-56207399 TTGGGGATGTACCATGTCCATGG - Intronic
925216040 2:2096739-2096761 CTGAGGATGGACTGTGTGCCAGG + Intronic
925317089 2:2934706-2934728 CTGGGCACCTACTATGTGCAGGG - Intergenic
925417009 2:3677485-3677507 CTGGGCACTTACTATGTGCCAGG + Intronic
925427845 2:3765651-3765673 CTGAGCATCTGCTATGTGCCAGG + Intronic
925680247 2:6412999-6413021 CTGGTATTGTACTATGTTCCAGG - Intergenic
926271818 2:11372376-11372398 CTGAGGGTCTTCTATGTGCCAGG - Intergenic
926680945 2:15663628-15663650 ATGAGGATGTACTGTGTCCCAGG - Intergenic
926735654 2:16071408-16071430 CTGAGAATTTTCTATGTGCCAGG + Intergenic
926785039 2:16510124-16510146 CTGATGACATACTATGTGCCAGG + Intergenic
926790845 2:16569879-16569901 TTGAGCATCTACTATGTGCCAGG - Intronic
927033631 2:19149764-19149786 CTGGCTATGTAAGATGTGCCTGG - Intergenic
927450820 2:23207805-23207827 CTGAGCACCTACTATGTGCCAGG - Intergenic
927483100 2:23469741-23469763 CTGAGCATCTACTACGTGCCAGG + Intronic
927655500 2:24942069-24942091 CTGAGCATCTACCATGTGCCAGG - Intergenic
927714716 2:25343897-25343919 CTGAGTGTCTACTATGTGCCAGG + Intergenic
927806022 2:26147463-26147485 TTGGGCACCTACTATGTGCCAGG - Intergenic
927934395 2:27067840-27067862 CTGAACATTTACTATGTGCCAGG + Intronic
928352306 2:30570419-30570441 CTGAGCATTTACTATGTACCTGG + Intronic
928401647 2:30983199-30983221 GTGGGGAGGTACTAGGGGCCTGG + Intronic
928871103 2:35981007-35981029 CTGAGTATCTACTATGTGTCAGG - Intergenic
928923925 2:36556743-36556765 CATAGCATGTACTATGTGCCAGG - Intronic
928954028 2:36842924-36842946 CTGGGAATATTTTATGTGCCAGG + Intergenic
929059161 2:37905555-37905577 CTGAGCACTTACTATGTGCCTGG - Intergenic
929308697 2:40397159-40397181 TTGGATATCTACTATGTGCCAGG - Intronic
929450140 2:42031276-42031298 CTGAGCATGTTCTATGTGCCAGG + Intergenic
929800180 2:45093075-45093097 CTGAGCATCTACTATGTGTCAGG - Intergenic
931873058 2:66482188-66482210 CTGAAAATCTACTATGTGCCAGG + Intronic
932115379 2:69041999-69042021 CTGAGCATGTACTATGTGTCTGG - Intronic
932124786 2:69133974-69133996 TTGGGCATCTACTGTGTGCCAGG - Intronic
932257238 2:70298441-70298463 TTGAGCATCTACTATGTGCCAGG + Intronic
932455742 2:71848869-71848891 CTGAGCATGTACTATGTGCCAGG + Intergenic
932681216 2:73827475-73827497 CTGAGTGTCTACTATGTGCCAGG - Intergenic
932694075 2:73939474-73939496 ATGAGCATGTACTATGTGCCAGG + Intronic
932950465 2:76287228-76287250 CTGAGCATTTACCATGTGCCAGG - Intergenic
933272629 2:80249487-80249509 TTGAGCATGTACTTTGTGCCTGG + Intronic
933676591 2:85062993-85063015 TTGGGCATCTACTAAGTGCCTGG + Intergenic
934526673 2:95056376-95056398 CTGGGGCTATCCTAAGTGCCTGG - Intergenic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
935697931 2:105786287-105786309 CTGAGCATGTGCTATGTGCCAGG + Intronic
936343464 2:111657625-111657647 CTGAGCATTGACTATGTGCCAGG - Intergenic
936593615 2:113826956-113826978 ATAGGTATATACTATGTGCCAGG + Intergenic
937236940 2:120436836-120436858 CTGGGCACCTATTATGTGCCAGG - Intergenic
937296322 2:120811894-120811916 CTGGGGCCCTACTATGCGCCGGG + Intronic
937703462 2:124890926-124890948 CTGTGTATTTACCATGTGCCAGG + Intronic
938249283 2:129801423-129801445 CTGAGTGTGTACAATGTGCCAGG - Intergenic
938736495 2:134191122-134191144 CTGGGTGCGTACTATGTGCCAGG - Intronic
938971856 2:136439943-136439965 CTGGGCATGAACTGTGTGCTGGG + Intergenic
939124162 2:138155675-138155697 CAGGTCATGTAATATGTGCCTGG + Intergenic
939308834 2:140445641-140445663 CTGAGGATCTACTATGTATCAGG + Intronic
940534657 2:154924868-154924890 CTGGGCACTTACTATGTGCTAGG + Intergenic
940847224 2:158655126-158655148 CTGTGGCTTTACTCTGTGCCAGG - Intronic
941557209 2:166996159-166996181 CTGTGTATCTACTATGTACCAGG - Intronic
942166160 2:173243044-173243066 CTGAGGACCTACTTTGTGCCTGG + Intronic
943176828 2:184486697-184486719 ATTAGGATGTACTGTGTGCCAGG - Intergenic
943619778 2:190136126-190136148 ATGGGTGTCTACTATGTGCCAGG + Intronic
943767281 2:191677035-191677057 CTGAGTATGTACTATTTGCTAGG + Intergenic
943889594 2:193270152-193270174 CTGGATATATACTATTTGCCAGG - Intergenic
944321855 2:198354966-198354988 TTGAGTATTTACTATGTGCCTGG + Intronic
944679805 2:202066616-202066638 TTGAGCATGTACTATGTGCCTGG + Intergenic
944796927 2:203196668-203196690 TTGGGTATGTACTATGTATCAGG - Intronic
945007052 2:205419757-205419779 CTGAGAGTCTACTATGTGCCTGG - Intronic
945062839 2:205923983-205924005 CTGAGCATGTACTGTGTGCCAGG + Intergenic
945075705 2:206037063-206037085 CTGAGAATGCACTAGGTGCCAGG - Intronic
945947071 2:216004583-216004605 TTGAGCATTTACTATGTGCCAGG - Intronic
946033501 2:216723767-216723789 CTGAGTACCTACTATGTGCCAGG + Intergenic
946132544 2:217618064-217618086 CTGAGTACCTACTATGTGCCAGG + Intronic
946342708 2:219081528-219081550 CTGAGAGTCTACTATGTGCCAGG + Intronic
946485110 2:220094097-220094119 TTGAGAATATACTATGTGCCAGG + Intergenic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
947216902 2:227758132-227758154 CAGGGGACGTACTCTGTGCATGG + Intergenic
947336470 2:229090812-229090834 TTGAACATGTACTATGTGCCAGG + Intronic
947375624 2:229492148-229492170 CTGAATGTGTACTATGTGCCAGG - Intronic
948119189 2:235516213-235516235 CTGGGGATATACTATTCGCCAGG - Intronic
948278486 2:236728342-236728364 CTGAGCATCTACTATGTGCAAGG + Intergenic
948417836 2:237828000-237828022 CTGAGCACCTACTATGTGCCAGG - Intronic
948836432 2:240628268-240628290 CTGGGGATGTCCTCGGAGCCTGG + Intronic
1168868275 20:1107732-1107754 TTGAGGATTTACTATGTGTCTGG - Intergenic
1168887222 20:1267966-1267988 CTGAGAACCTACTATGTGCCAGG - Intronic
1169049680 20:2565200-2565222 CTGGGCATGCCCTTTGTGCCAGG + Intronic
1169493877 20:6094613-6094635 CTGAGCATGTACTATGAACCAGG + Intronic
1169510267 20:6256257-6256279 CTGAGCACCTACTATGTGCCAGG - Intergenic
1169735565 20:8834090-8834112 TTGAGCATGTACTATGTGCCAGG + Intronic
1169815945 20:9656230-9656252 CTGCTCATCTACTATGTGCCAGG - Intronic
1169817406 20:9672327-9672349 CTGAGTATCTAGTATGTGCCAGG - Intronic
1170114651 20:12844234-12844256 TTGAGCATTTACTATGTGCCAGG - Intergenic
1170216600 20:13898259-13898281 CAGGGGATGGGCTATCTGCCTGG - Intronic
1170587281 20:17744402-17744424 CTGAGCACCTACTATGTGCCTGG + Intergenic
1170786126 20:19469185-19469207 CTGGGGATGAAGGATGTGCATGG + Intronic
1171056193 20:21909223-21909245 CTGGGGATCTACCATGTGTCAGG - Intergenic
1171119691 20:22557799-22557821 CTTGGGAGGCACCATGTGCCTGG - Intergenic
1171314647 20:24178640-24178662 CTGAGCACTTACTATGTGCCAGG - Intergenic
1171408404 20:24929240-24929262 CTTGGGATTTACTATCTGACAGG + Intergenic
1171934313 20:31259072-31259094 TTGAGCATCTACTATGTGCCAGG - Intronic
1172012591 20:31854560-31854582 CTGGGGGTGTCCTGTGTGCCAGG - Intronic
1172020481 20:31910309-31910331 CTGAGCATGTACCATGTGCCAGG + Intronic
1172120587 20:32596458-32596480 CCGGGGGCCTACTATGTGCCGGG - Intronic
1172135422 20:32683437-32683459 CTGAGGATCTACTTTGTACCAGG - Intergenic
1172532697 20:35644138-35644160 CTGGGTACTTACTCTGTGCCGGG - Intronic
1172663846 20:36585834-36585856 TTGGGGATATACCACGTGCCAGG + Intronic
1172757282 20:37294837-37294859 TTGTGAATCTACTATGTGCCAGG - Intronic
1172801297 20:37578119-37578141 CTGAGCACCTACTATGTGCCAGG + Intergenic
1172803224 20:37592887-37592909 CTGAGAATTTACTCTGTGCCAGG + Intergenic
1172821438 20:37738346-37738368 ATGGGCACCTACTATGTGCCAGG - Intronic
1172833260 20:37854949-37854971 CTGGGGACTTACTATGTGTCAGG - Intronic
1172836617 20:37877408-37877430 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1172844473 20:37921492-37921514 CTGAGCATCTACTATGTGCATGG + Intronic
1172903265 20:38350280-38350302 TTGGGCACCTACTATGTGCCCGG + Intronic
1172908101 20:38384564-38384586 CTGTGCACCTACTATGTGCCAGG - Intergenic
1173059446 20:39647625-39647647 CTGAGTATTTACTATGTGCTGGG - Intergenic
1173061831 20:39669834-39669856 TTGGGCTTTTACTATGTGCCAGG - Intergenic
1173202926 20:40967221-40967243 CTGAGCATCTACTGTGTGCCAGG - Intergenic
1173298065 20:41776930-41776952 TTGGGCATTTACTCTGTGCCAGG + Intergenic
1173498714 20:43536927-43536949 CTGAGCATCTACTATGGGCCAGG + Intronic
1173502016 20:43560816-43560838 CTGGGCATCTACTATATTCCAGG + Intronic
1173531045 20:43769811-43769833 CTGAGCATTTACTATGTACCAGG - Intergenic
1173538512 20:43833700-43833722 CTGAGGACCTGCTATGTGCCAGG + Intergenic
1173553734 20:43950875-43950897 CTGTGCATCTACTTTGTGCCAGG - Intronic
1173560437 20:44001382-44001404 CTGAGTACCTACTATGTGCCAGG - Intronic
1173697802 20:45035890-45035912 TTGAAAATGTACTATGTGCCAGG + Intronic
1173862443 20:46293040-46293062 CTGAGCATCTACTCTGTGCCAGG - Intronic
1173958313 20:47051907-47051929 CTGGGCATCTGCTCTGTGCCGGG - Intronic
1173973264 20:47168595-47168617 CTGAGCACTTACTATGTGCCAGG - Intronic
1174074613 20:47924481-47924503 CTGAGCATGTACTATATGCCAGG - Intergenic
1174105939 20:48162100-48162122 CTGAGAATTTACTATGGGCCGGG - Intergenic
1174266772 20:49337722-49337744 CTGGGAACCTACTATGTGCCAGG - Intergenic
1174420931 20:50398848-50398870 CTGTGGACCTACTATGTACCAGG - Intergenic
1174518318 20:51110419-51110441 TTGAGCATGTACTATGTGCTGGG - Intergenic
1174558119 20:51411036-51411058 CTGGGTATTTACTCTGTGCCAGG + Intronic
1174572565 20:51512475-51512497 CTGGGGACCTGCCATGTGCCAGG - Intronic
1174606576 20:51766486-51766508 CGGAGGATGTACGATGTACCAGG + Intronic
1174620933 20:51874098-51874120 TTGAGGAATTACTATGTGCCAGG + Intergenic
1174622495 20:51886665-51886687 TTGAGCATCTACTATGTGCCTGG - Intergenic
1174622901 20:51890223-51890245 CTGAGCATGTACTGTGTGCCAGG - Intergenic
1174737829 20:52982554-52982576 CTGTGCATCTATTATGTGCCAGG + Intronic
1174743025 20:53034403-53034425 CTGGGCATCTACTTTGTGCCAGG + Intronic
1174763712 20:53231625-53231647 CTGAGCATTTACTACGTGCCTGG + Intronic
1174775676 20:53341113-53341135 TTGAGCATCTACTATGTGCCAGG - Intronic
1174830614 20:53808814-53808836 CTGAGCACCTACTATGTGCCAGG - Intergenic
1174866408 20:54140550-54140572 TTGAGCATCTACTATGTGCCGGG + Intergenic
1174870854 20:54180648-54180670 TTGAGCATCTACTATGTGCCAGG + Intergenic
1175102267 20:56587819-56587841 CTGAGCACCTACTATGTGCCAGG + Intergenic
1175192503 20:57221057-57221079 CTGAGCACCTACTATGTGCCAGG + Intronic
1175364452 20:58442646-58442668 CTGAGGGTCTAATATGTGCCCGG + Intronic
1175373476 20:58508701-58508723 CTGAGTACCTACTATGTGCCAGG + Intronic
1175740020 20:61413661-61413683 CTGAGCATCTACTATGTGCAAGG - Intronic
1178137583 21:29645097-29645119 CTGATAATTTACTATGTGCCAGG + Intronic
1178335059 21:31735131-31735153 TTGAGCATGTACTTTGTGCCAGG + Intergenic
1178679864 21:34665040-34665062 ATGGAGCTCTACTATGTGCCTGG + Intergenic
1178952565 21:36997191-36997213 TTGAGCATGTACTGTGTGCCAGG - Intergenic
1178967041 21:37130520-37130542 CTGAAGATTTACTATGTTCCAGG - Intronic
1179722376 21:43323020-43323042 ATGAGCATGTACTATGTGCCAGG - Intergenic
1179824405 21:43956097-43956119 CTGGGGCTCTGCTGTGTGCCAGG + Intronic
1180197949 21:46208617-46208639 CTGCGGGTGTGCTCTGTGCCAGG + Intronic
1181053652 22:20249250-20249272 CTGGGGACGCACTCTGAGCCAGG + Intronic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1181768042 22:25106000-25106022 CTGAGCACTTACTATGTGCCAGG - Intronic
1181776112 22:25161167-25161189 CTGAGCACTTACTATGTGCCAGG + Intronic
1181841627 22:25667912-25667934 CTGACCATGTACGATGTGCCAGG + Intronic
1181899224 22:26139010-26139032 CTGGGCATCTAAGATGTGCCGGG - Intergenic
1181920116 22:26313996-26314018 CTAAGCATCTACTATGTGCCGGG + Intronic
1181947329 22:26528381-26528403 CTGTACATCTACTATGTGCCAGG + Intronic
1181960159 22:26616980-26617002 TTGGGCATCTCCTATGTGCCAGG - Intronic
1181968806 22:26674836-26674858 CTAAGGATCTACTATGTGCCAGG + Intergenic
1181986523 22:26803725-26803747 TTGAGTATGTGCTATGTGCCAGG + Intergenic
1182060577 22:27394285-27394307 CTGAACATTTACTATGTGCCTGG - Intergenic
1182104568 22:27680276-27680298 TTGAGCATCTACTATGTGCCAGG - Intergenic
1182125782 22:27815030-27815052 CTGAGCACTTACTATGTGCCAGG + Intergenic
1182125963 22:27816027-27816049 CTGAGCACCTACTATGTGCCAGG + Intergenic
1182188144 22:28429091-28429113 CTGGGGGCTTACTATGTGCCAGG - Intronic
1182352427 22:29706352-29706374 CTGGGCACCTACTACGTGCCAGG - Intergenic
1182360738 22:29745036-29745058 CTGAGCATGTCCTGTGTGCCAGG + Intronic
1182443262 22:30376324-30376346 CTGGGGATGTGCTCTTGGCCTGG - Exonic
1182671265 22:31997868-31997890 ATGAGCATCTACTATGTGCCAGG + Intergenic
1182770463 22:32792067-32792089 GTGAGAATTTACTATGTGCCAGG + Intronic
1182776635 22:32836252-32836274 CTGAGCACTTACTATGTGCCAGG - Intronic
1182830275 22:33299422-33299444 GTGAGCATGTACTATGTGTCAGG - Intronic
1182833579 22:33323310-33323332 CTGGGTACCTACTATGTGACTGG + Intronic
1182889628 22:33806409-33806431 CTGGGGCTGGAAAATGTGCCAGG - Intronic
1183099404 22:35574707-35574729 CTGAGTACCTACTATGTGCCAGG - Intergenic
1183242113 22:36665426-36665448 CTGAGCATTTACTATGTGCCAGG - Intronic
1183247768 22:36707067-36707089 ATGGGCATTTGCTATGTGCCAGG + Intergenic
1183253222 22:36744633-36744655 CTGGGGGCTTACTATGTGCCTGG + Intergenic
1183329824 22:37213380-37213402 CTGAGCACCTACTATGTGCCAGG + Intergenic
1183391294 22:37546828-37546850 CTGAGCACCTACTATGTGCCAGG - Intergenic
1183516742 22:38271274-38271296 CTGAGCATCTACTATGTGCCAGG - Intronic
1183675442 22:39296732-39296754 CTGAGCATCTACTATATGCCAGG - Intergenic
1183742031 22:39674155-39674177 CTGGGGATGCATTTTGAGCCAGG + Intronic
1184180474 22:42820500-42820522 CTGAGCACCTACTATGTGCCAGG + Intronic
1184341794 22:43890180-43890202 CTGAGCACCTACTATGTGCCAGG - Intronic
1184381878 22:44149811-44149833 CTGAGCAGCTACTATGTGCCAGG - Intronic
1184390029 22:44198415-44198437 CTGAGCATGTACTATATACCAGG + Intronic
1184402893 22:44284259-44284281 CTGAGGACCTACTATGTGCCAGG + Intronic
1184406396 22:44303170-44303192 CTGAGCATCTACTATGTGCCCGG + Intronic
1184557001 22:45238997-45239019 CTGAGCACTTACTATGTGCCGGG - Intronic
1184610532 22:45600360-45600382 CTGGAGATGAACTATGTGGTCGG + Exonic
1184620030 22:45670318-45670340 ATTGCGGTGTACTATGTGCCAGG - Intergenic
949293331 3:2491169-2491191 CTGAGTACGTACTATGTGCTGGG - Intronic
949373842 3:3365094-3365116 TTGAGCATTTACTATGTGCCAGG - Intergenic
949425957 3:3916207-3916229 ATGGGTATCTACTATGTGCCAGG + Intronic
949590705 3:5491365-5491387 TTAGGCATTTACTATGTGCCCGG - Intergenic
949725192 3:7035915-7035937 TTGAGCATATACTATGTGCCAGG + Intronic
949824991 3:8156030-8156052 GTGAGCATGTACTATGTGCAGGG - Intergenic
949884394 3:8681956-8681978 CTTGGGATTTACTATCTGACAGG + Intronic
949904075 3:8843821-8843843 CTGAGCATCTACTAAGTGCCAGG - Intronic
949948186 3:9206958-9206980 CTGAGCATCTACTATGTGCCAGG - Intronic
950013209 3:9738367-9738389 CTGAGGATTTCCTATGAGCCAGG - Intronic
950122208 3:10489354-10489376 CTGGGGGCCTACTGTGTGCCAGG - Intronic
950139682 3:10606830-10606852 CTGTGCACCTACTATGTGCCAGG - Intronic
950368574 3:12507605-12507627 TTGGGTACCTACTATGTGCCAGG + Intronic
950468997 3:13173235-13173257 CTGGGAATGTTTAATGTGCCAGG + Intergenic
950549638 3:13658478-13658500 CTGGGCATTGACTAAGTGCCAGG - Intergenic
950580632 3:13859689-13859711 CTGGGTACCTACTCTGTGCCAGG - Intronic
950580890 3:13861389-13861411 TTGAGCATCTACTATGTGCCAGG + Intronic
950585201 3:13887327-13887349 CTGAGGACCTAGTATGTGCCAGG + Intergenic
950668824 3:14513171-14513193 CTGAGCACCTACTATGTGCCAGG + Intronic
950680648 3:14582927-14582949 CTGAGCAGCTACTATGTGCCAGG - Intergenic
950915336 3:16638864-16638886 CTGAGGACTTACTATGTGTCAGG + Intronic
951056979 3:18158715-18158737 CTGGGAATGTACCAGCTGCCTGG + Intronic
951215454 3:20020492-20020514 TTGAGGATGTACTATTTGCCAGG + Intergenic
951409211 3:22341863-22341885 CTGAGCACCTACTATGTGCCTGG - Intronic
951586296 3:24218609-24218631 GTGAGTATCTACTATGTGCCAGG + Intronic
951662733 3:25087622-25087644 CTGAGCTTTTACTATGTGCCAGG - Intergenic
951707224 3:25555503-25555525 CTGGGGATCCACTATGTTCCAGG - Intronic
951812942 3:26721063-26721085 TTAAGGATTTACTATGTGCCAGG + Intergenic
952036030 3:29202859-29202881 TTGAGGACCTACTATGTGCCAGG + Intergenic
953717169 3:45325764-45325786 CTGGGCATCTCCCATGTGCCAGG - Intergenic
954025398 3:47779106-47779128 CTGAGCATTTACCATGTGCCGGG - Intronic
954235509 3:49254171-49254193 ATGAGCATATACTATGTGCCAGG - Intronic
954299465 3:49691769-49691791 CTGGGTATGGAGTAGGTGCCAGG - Intronic
954734901 3:52698808-52698830 CCTGGTATTTACTATGTGCCAGG + Intronic
954902415 3:54031227-54031249 CTGAGTATGTGCTATATGCCAGG - Intergenic
954928699 3:54261064-54261086 CTGAGCATCTACTATGCGCCAGG - Intronic
955004063 3:54953138-54953160 CTGAATATTTACTATGTGCCTGG + Intronic
955088943 3:55730491-55730513 CTGAGCACCTACTATGTGCCTGG + Intronic
955104411 3:55883089-55883111 CTGATGATCTACTATGTGCTAGG - Intronic
955134335 3:56200965-56200987 ATGGGCAATTACTATGTGCCAGG + Intronic
955204713 3:56885358-56885380 CTGTGCACCTACTATGTGCCAGG - Intronic
955204956 3:56887497-56887519 CTGTGCACTTACTATGTGCCAGG - Intronic
955205294 3:56890271-56890293 CTGAGCATTTACTATGTGCCAGG + Intronic
955229866 3:57089234-57089256 CTGAGCATGGACTATGAGCCAGG + Intergenic
955413388 3:58670406-58670428 CTGAGCATCTACTATGGGCCAGG - Intergenic
955434510 3:58888267-58888289 TTGAGGCTCTACTATGTGCCAGG + Intronic
955475191 3:59329157-59329179 CTGAGCATTTACTATATGCCAGG + Intergenic
955597139 3:60603882-60603904 CTGAGCATTTGCTATGTGCCCGG + Intronic
955690494 3:61585910-61585932 TTGGGGACCTACTGTGTGCCAGG + Intronic
955697946 3:61655436-61655458 CTGAACATCTACTATGTGCCAGG - Intronic
955950223 3:64236286-64236308 TTGAGGACCTACTATGTGCCAGG - Intronic
955998444 3:64702489-64702511 CTGAGCAGGTACTATATGCCAGG - Intergenic
956008306 3:64804057-64804079 TTGGGGAGGTACTATGAGCCTGG + Intergenic
956082425 3:65572146-65572168 CTGAGCATTTATTATGTGCCAGG + Intronic
956087557 3:65628558-65628580 CTGGAGATTTATTTTGTGCCAGG - Intronic
956137392 3:66112613-66112635 CTGAGCATGTATTATGTGCCAGG - Intergenic
956190585 3:66604043-66604065 CTGAGCACCTACTATGTGCCAGG - Intergenic
956341175 3:68225582-68225604 CTGAGCACTTACTATGTGCCAGG + Intronic
956389944 3:68760896-68760918 CTGAGGCCTTACTATGTGCCAGG + Intronic
956724765 3:72147913-72147935 CTGAGTACCTACTATGTGCCAGG - Intergenic
957760901 3:84554957-84554979 TTGTGTATTTACTATGTGCCAGG - Intergenic
959040072 3:101411204-101411226 TTGTGTATTTACTATGTGCCAGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960313911 3:116152244-116152266 CTGAGGGCATACTATGTGCCGGG + Intronic
960363299 3:116740607-116740629 CAGAGGATTTACTATGTGCCAGG + Intronic
960671814 3:120161705-120161727 CTGGGCATTGACCATGTGCCAGG + Intergenic
961065081 3:123868448-123868470 CTGAGCACTTACTATGTGCCAGG + Intronic
961112867 3:124299709-124299731 CTGATGACTTACTATGTGCCAGG - Intronic
961272103 3:125697041-125697063 CTTGGGATTTACTATCTGACAGG + Intergenic
961361516 3:126371014-126371036 CTGAGTACCTACTATGTGCCTGG + Intergenic
961455944 3:127023977-127023999 CTGGGCACTTACTAGGTGCCAGG - Intronic
961516402 3:127440150-127440172 CTGAGGACCTACTATGTGCCAGG - Intergenic
961538321 3:127583587-127583609 CTTAGGATCTACTATGTGTCAGG - Intronic
961676086 3:128567652-128567674 CTGAGCATGTGCCATGTGCCAGG - Intergenic
961749473 3:129086914-129086936 CTGAGCATCTACTGTGTGCCTGG + Intergenic
961772459 3:129260086-129260108 CTGGGCATCTGCTGTGTGCCAGG - Intronic
961786541 3:129350457-129350479 TTGAGTATCTACTATGTGCCAGG - Intergenic
962019378 3:131481384-131481406 CTGAGCATTTATTATGTGCCAGG + Intronic
962284399 3:134074367-134074389 CTGAGGACTTACTATGTGCCTGG - Intronic
962341946 3:134593301-134593323 CTGAGTACTTACTATGTGCCCGG + Intergenic
962713197 3:138104367-138104389 CTGAGGACCTGCTATGTGCCAGG - Intronic
962721697 3:138181622-138181644 CTAGGTACCTACTATGTGCCAGG - Intergenic
962859174 3:139382035-139382057 TTGAGCATTTACTATGTGCCAGG + Intronic
962932364 3:140050116-140050138 CTGAGAATATACTGTGTGCCAGG - Intronic
963452161 3:145495395-145495417 TTGGGTGTTTACTATGTGCCAGG - Intergenic
963720608 3:148857970-148857992 CTGAGCACTTACTATGTGCCAGG + Intronic
963925004 3:150942542-150942564 CTGAGCACCTACTATGTGCCAGG + Intronic
964025031 3:152062680-152062702 CTGAGCATCTACTATGAGCCAGG + Intergenic
964558149 3:157963781-157963803 TTGAGGTTTTACTATGTGCCAGG - Intergenic
964830187 3:160875608-160875630 TTGAGGATTTACTATGTGCAAGG + Intronic
964849204 3:161076982-161077004 GTGAGCATCTACTATGTGCCAGG + Exonic
965453849 3:168873196-168873218 CTGAGTATCTACTATGTGTCAGG - Intergenic
965607882 3:170514843-170514865 CTGAGCATTTACTATGTGCATGG + Intronic
965676196 3:171199485-171199507 CTGAGAATTTACCATGTGCCAGG + Intronic
965847043 3:172975397-172975419 CTGGGGACCTAGTATATGCCAGG + Intronic
966253270 3:177890715-177890737 TTGAGTATCTACTATGTGCCAGG - Intergenic
966261884 3:177988171-177988193 TTGAGCATGTACTATGTGTCAGG - Intergenic
966322040 3:178711759-178711781 CTGAGAATTTTCTATGTGCCAGG + Intronic
966421663 3:179740073-179740095 CTGGGTGTTTACTATGTGCCAGG - Intronic
966830096 3:184000475-184000497 CTGAGGGCCTACTATGTGCCAGG + Intronic
967048312 3:185757815-185757837 CTGAGCATTTGCTATGTGCCTGG - Intronic
967051763 3:185791518-185791540 CTGGGCGTGTCCTCTGTGCCAGG + Intronic
967332701 3:188307653-188307675 CTGAGCATCTATTATGTGCCAGG - Intronic
967437012 3:189458831-189458853 CTGGGAACGTACTGAGTGCCAGG - Intergenic
967661777 3:192120126-192120148 ATTGGCATGTACTATGGGCCAGG + Intergenic
967834517 3:193949810-193949832 GTTAGCATGTACTATGTGCCAGG + Intergenic
967983555 3:195079481-195079503 GTGAGGACTTACTATGTGCCAGG + Intronic
968007148 3:195250868-195250890 CTGGGCATCTACTATGTGCCAGG - Intronic
968691186 4:1991172-1991194 CTGAGCATGTACTCTGGGCCAGG + Intronic
968752923 4:2399553-2399575 CTGGGTATGTATGATGTGCCAGG - Intronic
968850998 4:3078248-3078270 CTAAACATGTACTATGTGCCTGG + Intronic
968940942 4:3637351-3637373 CTGGGCACTCACTATGTGCCAGG + Intergenic
969091814 4:4699795-4699817 CTGAGCATCTAGTATGTGCCAGG + Intergenic
969253464 4:5986891-5986913 CTGCCTATCTACTATGTGCCAGG - Intronic
969255304 4:5997276-5997298 CTGAGCATCTACTATGTGGCAGG + Intergenic
969465430 4:7353524-7353546 CTGAGCATCTACTAAGTGCCAGG - Intronic
969826549 4:9762633-9762655 CTTGGGATTTACTATCTGACAGG + Intergenic
969836614 4:9847569-9847591 CTGGGAACGGACTACGTGCCAGG + Intronic
969911075 4:10447111-10447133 TTGGGAATCTACTATGTGCTGGG + Intronic
969919522 4:10524498-10524520 CTGGGAATGTACTATGTTTGTGG - Intronic
970504287 4:16711294-16711316 GTGGAGATCTACTTTGTGCCAGG + Intronic
970607538 4:17694681-17694703 CTTGAGATCTACTATGTGCCAGG + Intronic
971686075 4:29770288-29770310 CTGAGGAGATACTGTGTGCCAGG - Intergenic
972333178 4:38082040-38082062 CTGGGCACTTACTATGTGCTGGG - Intronic
972404734 4:38734885-38734907 CTGGGGATTTACCATCTGCTGGG + Intergenic
972585339 4:40432553-40432575 CTGAGAATTTACTGTGTGCCTGG - Intronic
973008112 4:45038878-45038900 CTGGGTATCTACTATGTGGCAGG + Intergenic
973530041 4:51827629-51827651 CTTGGGAGGGTCTATGTGCCAGG + Intergenic
973532840 4:51850586-51850608 TTGGGTATCTACTATGTACCAGG + Intronic
973632628 4:52833710-52833732 CTGAGCATCTACTATGTACCAGG - Intergenic
973652971 4:53015321-53015343 CTGGGGACCTGCTATTTGCCAGG + Intronic
973662056 4:53118252-53118274 CTGAGCACCTACTATGTGCCAGG - Intronic
973931465 4:55796818-55796840 CTGAGCATTTACTAAGTGCCTGG - Intergenic
975441887 4:74420558-74420580 CTTGGCACCTACTATGTGCCAGG - Intergenic
975682274 4:76888605-76888627 GTGAGGATCTACTATGTGCCAGG + Intergenic
976191751 4:82493950-82493972 CTGGGTTGCTACTATGTGCCAGG + Intronic
976226795 4:82800514-82800536 TTGGGCATCTGCTATGTGCCAGG + Intergenic
976247565 4:83018952-83018974 CTGGGTATCTATTATGTGCCAGG + Intergenic
976314550 4:83645464-83645486 CTGGGGGTCTACTGTGTACCAGG + Intergenic
976618318 4:87100668-87100690 CTGAGCACTTACTATGTGCCAGG - Intronic
976836045 4:89375094-89375116 CTGAGCACTTACTATGTGCCAGG - Intergenic
977864263 4:102004202-102004224 TTGGGCACCTACTATGTGCCAGG - Intronic
978349290 4:107804401-107804423 TTGGGTATCTACTATGTGTCAGG + Intergenic
978368481 4:108007015-108007037 CTGAGCATCTACTATGTGCCGGG - Intronic
978611355 4:110544532-110544554 TTGGCGACTTACTATGTGCCAGG + Intronic
979286391 4:118930131-118930153 CTGAGCATTTATTATGTGCCAGG + Intronic
979660311 4:123245888-123245910 CTGAGTATCTACTATGTGTCAGG - Intronic
980077072 4:128305223-128305245 CTGAGCACTTACTATGTGCCAGG + Intergenic
981173165 4:141648217-141648239 CTGGGGATGTACTTTGGGCCAGG + Intronic
981279130 4:142936818-142936840 CTAAGAATGTACTATGTTCCAGG + Intergenic
981660711 4:147163418-147163440 CTGAGTATCTACTGTGTGCCAGG + Intergenic
981848282 4:149195438-149195460 TTGAGCATCTACTATGTGCCAGG + Intergenic
982136831 4:152280211-152280233 CTGGGCATCTGCTACGTGCCTGG + Intergenic
982369439 4:154618625-154618647 TTGGGCATATACTATTTGCCAGG + Intergenic
982711405 4:158761803-158761825 CTGAGGAGATACCATGTGCCAGG + Intergenic
982809789 4:159810893-159810915 TGGGGGATGTCCTGTGTGCCAGG - Intergenic
983056942 4:163108797-163108819 CTGTGGGCCTACTATGTGCCAGG + Intergenic
986454218 5:7899446-7899468 TTGAGGACTTACTATGTGCCAGG - Intronic
986900845 5:12431887-12431909 CTGAGAATGTACTATCTTCCAGG - Intergenic
987244697 5:16037097-16037119 CTGGGCACCTACTATGAGCCAGG - Intergenic
987270577 5:16304348-16304370 TTGAGCATTTACTATGTGCCAGG + Intergenic
988502833 5:31798034-31798056 CTGGGGACTTAATATGTACCAGG + Intronic
988514444 5:31892501-31892523 TTGGGCATCTACTGTGTGCCAGG + Intronic
988642640 5:33058243-33058265 CTGAGGGCCTACTATGTGCCAGG + Intergenic
988732427 5:33986455-33986477 TTGAGGATCTACTAGGTGCCAGG - Intronic
988829472 5:34973454-34973476 CTGAGCATCTACTGTGTGCCAGG + Intergenic
989069229 5:37493175-37493197 CTGGGGGTGTCCTAAGTCCCTGG - Intronic
989114338 5:37937884-37937906 TTGTGCATCTACTATGTGCCAGG - Intergenic
989786309 5:45335715-45335737 CTGTGTACTTACTATGTGCCAGG + Intronic
989961696 5:50423670-50423692 CTGTGGAAGTACTACCTGCCAGG + Intronic
990133963 5:52622143-52622165 TTGTGGATTTACTAGGTGCCGGG + Intergenic
990504318 5:56429728-56429750 CTGAGCACCTACTATGTGCCAGG + Intergenic
990737617 5:58881091-58881113 CTAGGTATCTACTATGTGCCAGG + Intergenic
990737658 5:58881424-58881446 CTGAGGACCTACCATGTGCCTGG - Intergenic
990749268 5:58995574-58995596 TTGAGCATCTACTATGTGCCAGG - Intronic
991086744 5:62654675-62654697 CTGGCTAACTACTATGTGCCAGG - Intergenic
991572831 5:68073748-68073770 CTGAGCATGTGCTATGTGCTGGG - Intergenic
991722025 5:69502488-69502510 CTGGACGTCTACTATGTGCCAGG + Intronic
992226605 5:74624980-74625002 CTGAGGACCTACTATGTGCCAGG + Intergenic
992845771 5:80745346-80745368 CTGGGCTTCTACTAAGTGCCAGG - Intronic
993418765 5:87672965-87672987 CTGAGTATATACTATATGCCAGG + Intergenic
993560755 5:89404167-89404189 TTGAGGAACTACTATGTGCCAGG - Intergenic
993619968 5:90156572-90156594 CTGAGAATTTACTATATGCCGGG - Intergenic
994102126 5:95904923-95904945 TTGAGCATATACTATGTGCCAGG - Intronic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
994263953 5:97692502-97692524 TTGAGCATCTACTATGTGCCAGG + Intergenic
994332635 5:98525191-98525213 TTGGAGATGTACTATATTCCGGG + Intergenic
994865946 5:105270105-105270127 CTGTGCATCTACTATGTGACAGG + Intergenic
995190085 5:109310496-109310518 CTGAGTATTTACAATGTGCCAGG + Intergenic
995314354 5:110751141-110751163 CTGAGTACTTACTATGTGCCAGG + Intronic
995331480 5:110951909-110951931 CTGGGCATTTACCATGTGTCAGG + Intergenic
995831839 5:116362366-116362388 TTGAGGACCTACTATGTGCCAGG - Intronic
996154152 5:120077397-120077419 GTGGGCATTTATTATGTGCCAGG + Intergenic
996300495 5:121978142-121978164 CTGAGCATTTACTATGTGCCAGG + Intronic
996672160 5:126130907-126130929 TTGAGTATCTACTATGTGCCAGG + Intergenic
996940571 5:129000364-129000386 TTGAGGATCTACTATGTGTCAGG - Intronic
997616733 5:135251677-135251699 CTGAGGATTTACCATGTGCTTGG + Intronic
997723041 5:136095954-136095976 CTGAGTGTCTACTATGTGCCAGG + Intergenic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
998006858 5:138662799-138662821 CTGAGCATCTACTATGTGCCAGG - Intronic
998026205 5:138818903-138818925 CTTGGGATGTATTGAGTGCCTGG + Intronic
998054963 5:139066631-139066653 CTGACCATCTACTATGTGCCAGG + Intronic
998146611 5:139732791-139732813 CAGAGCATTTACTATGTGCCAGG - Intergenic
998412445 5:141921954-141921976 CTGGGCTTTTACTATGTGCCAGG + Intergenic
998457534 5:142284789-142284811 CTTGGCATGTACTATGTGCGAGG + Intergenic
998480285 5:142457609-142457631 TTGAGCATTTACTATGTGCCAGG + Intergenic
998669187 5:144334556-144334578 CTGAGTGTGTGCTATGTGCCAGG + Intronic
998792907 5:145785114-145785136 TTGAGGTTTTACTATGTGCCAGG + Intronic
998804989 5:145909676-145909698 TTGAGCATCTACTATGTGCCAGG - Intergenic
998879064 5:146628720-146628742 CTGGGAACCTACTATGTGTCAGG + Intronic
998894970 5:146789566-146789588 CTGAGCATTTACTATGGGCCTGG + Intronic
998923701 5:147099371-147099393 CTGGGAATTTACTATGTAGCAGG - Intergenic
999193495 5:149765959-149765981 CTGGGCAATTACTATGTGCCAGG - Intronic
999270665 5:150294775-150294797 CTGGGTCTGGACTCTGTGCCAGG - Intergenic
999432227 5:151534422-151534444 CTGTGGCTGTAGTATTTGCCCGG - Exonic
999938217 5:156511794-156511816 CTGATCATGTACTATGTGCTAGG - Intronic
1000280169 5:159775131-159775153 CTGAGTATTTACTGTGTGCCAGG + Intergenic
1000338907 5:160261899-160261921 TTGGGTACCTACTATGTGCCAGG - Intronic
1000506267 5:162123638-162123660 TTGGGTATTTACTATGTGTCAGG + Intronic
1001080118 5:168661342-168661364 TTGAGCATCTACTATGTGCCAGG - Intergenic
1001143601 5:169165084-169165106 CTGAGCACCTACTATGTGCCAGG - Intronic
1001240597 5:170067093-170067115 CTTAGGACCTACTATGTGCCAGG + Intronic
1001263464 5:170253957-170253979 CAGGGTATTTTCTATGTGCCAGG + Intronic
1001314217 5:170631323-170631345 CTGAGCACCTACTATGTGCCAGG - Intronic
1001321975 5:170690100-170690122 CTGAGGACCTACTATGTGCTGGG - Intronic
1001405481 5:171474017-171474039 CTAAGGACCTACTATGTGCCAGG - Intergenic
1001662094 5:173401751-173401773 CTGAGCACCTACTATGTGCCAGG + Intergenic
1001811326 5:174630461-174630483 CTGAGGACCTATTATGTGCCTGG + Intergenic
1002191496 5:177480268-177480290 CTGGGCATCCACTATATGCCAGG + Intergenic
1002554357 5:180023483-180023505 CTGGTGCTGTAAGATGTGCCAGG - Intronic
1002797352 6:484973-484995 CTGGGGACTTACCATGTGCGAGG - Intergenic
1002961493 6:1919109-1919131 CTGGGCATCTGTTATGTGCCAGG + Intronic
1003657541 6:8027330-8027352 CTGAGCATGTGCTTTGTGCCAGG + Intronic
1004619250 6:17319076-17319098 GTGGGGGGGTCCTATGTGCCAGG + Intergenic
1004637985 6:17487101-17487123 CTGAGCACGTACTATGTGCCAGG + Intronic
1004737299 6:18420377-18420399 CTGAGTGTCTACTATGTGCCAGG + Intronic
1005396716 6:25389890-25389912 CTGGTGTTGAACTATGTGCTAGG + Intronic
1005432128 6:25769287-25769309 CTGAACATGTACTATGTGCCAGG + Intronic
1005472792 6:26178412-26178434 ATGTGAATGTACTATGTGGCAGG + Intergenic
1005511985 6:26519581-26519603 TTGGGTACCTACTATGTGCCAGG - Intergenic
1006131836 6:31874258-31874280 TTGGGGACCTACTATGTGCCAGG - Intronic
1006188709 6:32195018-32195040 TTGGGCACCTACTATGTGCCAGG - Exonic
1007077357 6:39076289-39076311 CTGGGCATCTTCTATGTGGCAGG + Intronic
1007088347 6:39166526-39166548 GTGGGGATGCTCTAAGTGCCTGG - Intergenic
1007228789 6:40333748-40333770 TTGGGTATCTACTATGTGCTAGG - Intergenic
1007329283 6:41091858-41091880 CTGAGCACCTACTATGTGCCAGG + Intronic
1007370400 6:41423109-41423131 CTGAGCAGTTACTATGTGCCAGG + Intergenic
1007709411 6:43812254-43812276 GTGGGGATGTAGGAGGTGCCAGG + Intergenic
1007732069 6:43953462-43953484 CTGGGCACCTACTATGTGCCTGG + Intergenic
1007817388 6:44534297-44534319 CGGAGCATCTACTATGTGCCAGG + Intergenic
1008096910 6:47348473-47348495 CTGGGCGTTTACTCTGTGCCAGG - Intergenic
1008151109 6:47952431-47952453 CTGAGTATATACTTTGTGCCAGG - Intronic
1008405095 6:51110117-51110139 CTGGTTATGTACCATGTGCTAGG - Intergenic
1008662555 6:53683057-53683079 CTGAGTATCTACCATGTGCCAGG + Intergenic
1008690670 6:53975172-53975194 CTGAGTAACTACTATGTGCCAGG + Intronic
1008701119 6:54101367-54101389 TTGGGTACCTACTATGTGCCAGG + Intronic
1008715399 6:54283446-54283468 TTGGGCATCTACTCTGTGCCAGG + Intergenic
1009334083 6:62463342-62463364 CTGGGTGTGTATTTTGTGCCAGG - Intergenic
1009788103 6:68364261-68364283 CTTGGGATGTTCTCTGTGCATGG + Intergenic
1010500390 6:76593045-76593067 CTGGACACCTACTATGTGCCAGG - Intergenic
1011480091 6:87785210-87785232 CTGGGGATCTTCAATGTCCCAGG + Intergenic
1011587601 6:88943505-88943527 GTGGGTATGTACTATGTACCAGG + Intronic
1011674207 6:89715483-89715505 CTGAGGCTTTACTATTTGCCAGG - Intronic
1012341615 6:98132294-98132316 CTGAGTATCTATTATGTGCCAGG + Intergenic
1013144486 6:107374449-107374471 CTAAGGACCTACTATGTGCCAGG + Intronic
1013165848 6:107591288-107591310 CTGAGCACTTACTATGTGCCTGG - Intronic
1013249779 6:108322518-108322540 CAGGAGATGTAATATGTGTCTGG + Intronic
1013795320 6:113881422-113881444 CTGAGTGTTTACTATGTGCCAGG - Intergenic
1013942731 6:115684376-115684398 TTGGGCATGTTCTCTGTGCCGGG - Intergenic
1014136405 6:117894902-117894924 CTGTGAAACTACTATGTGCCAGG + Intergenic
1014149852 6:118042177-118042199 CTGAGAATGCACTATGTTCCAGG + Intronic
1014361380 6:120480012-120480034 CTGGGAATATTCTATGTGGCTGG - Intergenic
1015452709 6:133389487-133389509 CTGGGGACCTGCTATGTGCTAGG - Intronic
1015756029 6:136607754-136607776 CTGAGGACCTACTATGGGCCAGG + Intronic
1016851747 6:148626581-148626603 TTGAGGCTCTACTATGTGCCAGG - Intergenic
1016966964 6:149727925-149727947 CTGAGTACCTACTATGTGCCAGG + Intronic
1017082063 6:150679653-150679675 TTGAGTATGTACTCTGTGCCAGG + Intronic
1017260773 6:152384039-152384061 TTGGGTGTGTTCTATGTGCCAGG + Intronic
1017538404 6:155373276-155373298 CTGAGTATCTATTATGTGCCAGG + Intergenic
1017573774 6:155778779-155778801 TTGGGTATCTACTTTGTGCCAGG + Intergenic
1018325849 6:162667908-162667930 TTGAGTATTTACTATGTGCCAGG - Intronic
1018492145 6:164304910-164304932 TTGGGCATGTACTTTATGCCAGG - Intergenic
1018886710 6:167944335-167944357 CTGAGCACCTACTATGTGCCGGG - Intronic
1019102413 6:169641898-169641920 CTGAGAATCTACTCTGTGCCAGG + Intronic
1019851401 7:3561585-3561607 CTGAGCATTTACCATGTGCCAGG - Intronic
1021409361 7:20312426-20312448 CTAGGCACCTACTATGTGCCAGG + Intergenic
1021618118 7:22523473-22523495 CTGAGCATCTACTATGTTCCAGG + Intronic
1021638744 7:22717646-22717668 CTGGGACTCTACCATGTGCCAGG + Intergenic
1021819594 7:24483369-24483391 CTGAGCATGTACTATAGGCCAGG - Intergenic
1021914356 7:25416582-25416604 CTGAGCATCTACTCTGTGCCAGG - Intergenic
1022120953 7:27307526-27307548 CTGAGCACGTATTATGTGCCAGG + Intergenic
1022132610 7:27418117-27418139 CTGAGGATCTGCTATGCGCCAGG + Intergenic
1022243917 7:28539221-28539243 CTGAGTATTTACTATGTGCCAGG - Intronic
1022476032 7:30710390-30710412 CTGAGGGTGTACGATGGGCCAGG - Intronic
1022583134 7:31577272-31577294 CTGGCCATTTACTATGTGCCTGG + Intronic
1023047526 7:36223556-36223578 CTACGCATCTACTATGTGCCTGG - Intronic
1023072969 7:36455933-36455955 GTGAGCATTTACTATGTGCCAGG + Intergenic
1023128981 7:36983685-36983707 CTGAGCATTTACTGTGTGCCAGG - Intronic
1023491786 7:40750884-40750906 CTGAGTATATACTATGTGCCAGG + Intronic
1023585086 7:41720918-41720940 TTGAGCATGTACTATGTGTCAGG + Intergenic
1024154523 7:46606608-46606630 CTGAGAATTTGCTATGTGCCAGG - Intergenic
1024348129 7:48334254-48334276 CTGAGTATTTGCTATGTGCCAGG + Intronic
1025109602 7:56203036-56203058 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025244072 7:57302993-57303015 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025249899 7:57344612-57344634 CTGGGGACCTACTATGTGCCAGG + Intergenic
1025994800 7:66521197-66521219 TTGAGCATTTACTATGTGCCAGG + Intergenic
1026308304 7:69161582-69161604 CTGAGCACCTACTATGTGCCAGG - Intergenic
1026762230 7:73135456-73135478 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1027038566 7:74944262-74944284 CTGAGCATCTACTGTGTGCCAGG + Intergenic
1027084994 7:75257233-75257255 CTGAGCATCTACTGTGTGCCAGG - Intergenic
1027296636 7:76780279-76780301 CTGAGTATTCACTATGTGCCCGG - Intergenic
1027910845 7:84248378-84248400 CTGTGCATGTGCTATATGCCCGG + Intronic
1028889803 7:95974311-95974333 CTGAGCACTTACTATGTGCCAGG - Intronic
1029190194 7:98766472-98766494 CTGAGCACCTACTATGTGCCAGG - Intergenic
1029672859 7:102045979-102046001 CCTGGGATGTAGTAGGTGCCTGG + Intronic
1029880367 7:103801830-103801852 CTGAGAACTTACTATGTGCCAGG - Intronic
1029884910 7:103858340-103858362 CTGGGCACTTACTATGTGCCAGG - Intronic
1030088828 7:105839755-105839777 CTGAGCACCTACTATGTGCCAGG + Intronic
1030624180 7:111825940-111825962 CGGGTGCTTTACTATGTGCCAGG + Intronic
1030745328 7:113159275-113159297 CTGAGCATCTACTATATGCCAGG + Intergenic
1030831103 7:114222516-114222538 TTGGGCATTTACTACGTGCCTGG + Intronic
1031058286 7:117018783-117018805 CTGAGTGTTTACTATGTGCCAGG - Intronic
1031845712 7:126803906-126803928 GTGACGATTTACTATGTGCCAGG - Intronic
1032238491 7:130143464-130143486 CTGAGCATCTACTATGTGCTAGG - Intergenic
1032681000 7:134183286-134183308 CTGAGCAATTACTATGTGCCAGG - Intronic
1032894747 7:136237860-136237882 CTGAGCACGTTCTATGTGCCAGG + Intergenic
1033307544 7:140236051-140236073 TTGGGCATCTACCATGTGCCTGG - Intergenic
1033414888 7:141152867-141152889 CTAGACATTTACTATGTGCCAGG + Intronic
1033613040 7:142984352-142984374 GTGGGGAGTTGCTATGTGCCTGG + Intergenic
1034064318 7:148121895-148121917 CTGAGTATCTACTATGTCCCAGG + Intronic
1034100041 7:148443222-148443244 CTGGAAATGTATTGTGTGCCAGG - Intergenic
1034102953 7:148466651-148466673 CTGAGCACTTACTATGTGCCAGG - Intergenic
1034712678 7:153207897-153207919 CTGGGCATCTACTATGTGTCAGG + Intergenic
1035116319 7:156527319-156527341 CTGGGCATCTACTATGTGCCAGG + Intergenic
1035396706 7:158539718-158539740 CTGGGGACATACTGTGAGCCTGG + Intronic
1035396719 7:158539795-158539817 CTGGGGACATACTGTGAGCCTGG + Intronic
1035396735 7:158539907-158539929 CTGGGGACATACTGTGAGCCTGG + Intronic
1035396749 7:158539984-158540006 CTGGGGACATACTGTGAGCCTGG + Intronic
1035622673 8:1045778-1045800 CTGAGCACTTACTATGTGCCAGG - Intergenic
1036452396 8:8880345-8880367 CTGGGAATGTACTAAATGACAGG + Intronic
1036673645 8:10811081-10811103 CTGGGCATTTACCATGTGCTGGG + Intronic
1036816770 8:11908288-11908310 CTGGGGATTTACTATCTGACAGG - Intergenic
1036833493 8:12039820-12039842 CTTGGGATTTACTATCTGACAGG - Intergenic
1036855339 8:12286385-12286407 CTTGGGATTTACTATCTGACAGG - Intergenic
1036903654 8:12690237-12690259 CTTGGGATTTACTATCTGACAGG - Intergenic
1036910061 8:12750920-12750942 CTGGGCATTTACTCTGTGTCAGG + Intronic
1036923488 8:12880959-12880981 CTGAGGATGTCATGTGTGCCAGG + Intergenic
1037738395 8:21584998-21585020 CTGGGGACCTACTATGTCCTTGG + Intergenic
1037756670 8:21714645-21714667 CTGAGGACCTACTATGTGTCAGG + Intronic
1037763115 8:21755483-21755505 ATGAGGACCTACTATGTGCCAGG + Intronic
1037938191 8:22929141-22929163 TTGAGCATTTACTATGTGCCAGG - Intronic
1038177694 8:25195876-25195898 CTGAGGACTTACTATGAGCCAGG - Intronic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1039036181 8:33361675-33361697 TTGAGCATTTACTATGTGCCAGG - Intergenic
1039440150 8:37589396-37589418 CTGAGCATCTACTACGTGCCAGG - Intergenic
1039866424 8:41507964-41507986 GAGGGCACGTACTATGTGCCTGG + Intronic
1040298988 8:46178247-46178269 CTGGGGCTTTACTACCTGCCTGG - Intergenic
1041555897 8:59155189-59155211 TTGAGCATGTATTATGTGCCAGG - Intergenic
1041559363 8:59197214-59197236 TTGAGCATGTACTCTGTGCCAGG - Intergenic
1041572337 8:59351709-59351731 TTGGGCATGTGCTTTGTGCCAGG - Intergenic
1042048059 8:64676590-64676612 TTGAGGGTCTACTATGTGCCAGG - Intronic
1042240585 8:66660229-66660251 CTTGGTACCTACTATGTGCCAGG + Intronic
1042602884 8:70516169-70516191 CTGAGGACCTACTATGTGCCAGG + Intergenic
1042648972 8:71018627-71018649 CTGAGTACGTACTATGTGCCAGG - Intergenic
1042951641 8:74206163-74206185 CTGTGGGTCTACTATGTGCTGGG + Intergenic
1043139731 8:76573253-76573275 CTGAGTGTCTACTATGTGCCGGG + Intergenic
1043482918 8:80670894-80670916 CTGAGCACTTACTATGTGCCAGG + Intronic
1043512709 8:80965459-80965481 CTGAGTATTTACTATGTGCCAGG - Intergenic
1043793937 8:84511373-84511395 TTGAAAATGTACTATGTGCCAGG - Intronic
1044791660 8:95853617-95853639 TTGGAAATTTACTATGTGCCAGG - Intergenic
1044868067 8:96591828-96591850 CTGAGCATCTACTATATGCCAGG + Intronic
1045307595 8:100971827-100971849 TTGGACATTTACTATGTGCCAGG + Intergenic
1045899876 8:107264754-107264776 TTGGGGATTTCCTCTGTGCCAGG + Intronic
1045968823 8:108056683-108056705 TTGAGCATTTACTATGTGCCAGG - Intronic
1046089137 8:109478272-109478294 CTGAGTATCCACTATGTGCCAGG + Intronic
1046112745 8:109745887-109745909 CTGAGCACCTACTATGTGCCTGG - Intergenic
1046527985 8:115405741-115405763 CTGAGTATTTACTATGTGCTGGG - Intergenic
1046551670 8:115725449-115725471 CTGAGGATTTACTATGTTCTAGG + Intronic
1046931139 8:119842995-119843017 CTGGGAAGCTACTATGTGCCAGG + Intronic
1047007359 8:120634308-120634330 CTGAGAATCTACTATGTGCCAGG + Intronic
1047495670 8:125406978-125407000 CTGTGCACCTACTATGTGCCAGG - Intergenic
1047633649 8:126735527-126735549 CTGAGTTTTTACTATGTGCCAGG + Intergenic
1047660643 8:127031931-127031953 CTGAGTACTTACTATGTGCCAGG - Intergenic
1047745417 8:127841158-127841180 CTGAACAGGTACTATGTGCCAGG - Intergenic
1047964746 8:130038364-130038386 CTGTGTATATACTATGTGCCAGG - Intergenic
1047985055 8:130224118-130224140 CTGAGCATTCACTATGTGCCAGG - Intronic
1048063035 8:130940067-130940089 TTGAGCATGTACTATGTGCCAGG + Intronic
1048142021 8:131804042-131804064 CTGAGGACTTACTATGAGCCTGG - Intergenic
1048205262 8:132410563-132410585 CTGGGCACTTACTGTGTGCCAGG - Intronic
1048602376 8:135931675-135931697 CTGAGCATCTACTATGTGCCAGG - Intergenic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1049095027 8:140543676-140543698 CTGAGCATCTACTATGTGCCAGG + Intronic
1049555574 8:143279705-143279727 GTGGGGATTTGCTATGTACCTGG - Intergenic
1050272474 9:3960570-3960592 CTGTGGACCCACTATGTGCCAGG - Intronic
1050766150 9:9136911-9136933 TAGGGGATTTACTCTGTGCCTGG + Intronic
1051667974 9:19483402-19483424 CTGAGCATTTACTATGTGCTAGG + Intergenic
1051695065 9:19759680-19759702 CTGGGTATCTATTATTTGCCAGG + Intronic
1052016545 9:23475038-23475060 TGGAGTATGTACTATGTGCCAGG - Intergenic
1052279493 9:26716682-26716704 CTGCGTGTCTACTATGTGCCAGG - Intergenic
1053047574 9:34932529-34932551 CTGAGGATCTATTTTGTGCCAGG - Intergenic
1053201966 9:36158520-36158542 TTGAGCATCTACTATGTGCCAGG + Intronic
1054716405 9:68561329-68561351 CTGAGCACTTACTATGTGCCAGG + Intergenic
1054762242 9:69013716-69013738 CTGGTGATGGAGTACGTGCCGGG - Exonic
1054784333 9:69196377-69196399 TTGAGCATGTACTATGTGCCAGG + Intronic
1054874472 9:70080930-70080952 CTGTGGAAGTATTATGTTCCAGG - Intronic
1055472113 9:76622174-76622196 CTGAGCATCTACTATGTACCAGG + Intronic
1055660726 9:78501497-78501519 CTGAGTATGTACCATGTGCTAGG + Intergenic
1056536145 9:87529515-87529537 CTGAGCATCTACTATGTGTCAGG - Intronic
1057822002 9:98339710-98339732 TTGAGTATGTACTATGTGCCAGG + Intronic
1057871542 9:98721884-98721906 CTGAGGACCTACTATGTGCCAGG - Intergenic
1057877550 9:98769223-98769245 TAGAGGATTTACTATGTGCCAGG + Intronic
1057910880 9:99019785-99019807 TTGAGCATGTACTATGTGCTGGG - Intronic
1058160668 9:101567152-101567174 CTGAGCATTTACTAGGTGCCAGG - Intergenic
1058441882 9:105017128-105017150 CTGAGGCTGTTCTATGTCCCTGG + Intergenic
1058537212 9:105974679-105974701 CTGCGCCTATACTATGTGCCAGG + Intergenic
1058657597 9:107237817-107237839 TTGGGTTTGTACTCTGTGCCAGG - Intergenic
1058760553 9:108127221-108127243 CTGGGCTTCTACTCTGTGCCAGG + Intergenic
1058871853 9:109208891-109208913 TTGGACATCTACTATGTGCCGGG - Intronic
1058908307 9:109498540-109498562 CTGGGCACCTACTGTGTGCCAGG + Intergenic
1059158947 9:112015573-112015595 ATGAGCATTTACTATGTGCCAGG + Intergenic
1059395931 9:114034105-114034127 CTGAGTATGTAATCTGTGCCAGG - Intronic
1059452537 9:114379347-114379369 CTGTGCCTTTACTATGTGCCAGG - Intronic
1060120864 9:120988198-120988220 CTGAGCATCTACTATGTGCCAGG + Intronic
1060133155 9:121124984-121125006 CTGGATACGCACTATGTGCCAGG - Intronic
1060259227 9:122059304-122059326 CTGAGCATTTACTATGTGCCAGG + Intronic
1060403159 9:123360207-123360229 CTGAGTGTGTACTATGTGCTTGG - Intronic
1060476064 9:123987685-123987707 CTGAGCATCTGCTATGTGCCAGG - Intergenic
1060485548 9:124044282-124044304 CTGGGCACCTACTTTGTGCCAGG - Intergenic
1060515122 9:124260714-124260736 CTGAGGATATACTGTGTGCTAGG + Intronic
1060516566 9:124269743-124269765 CTGAGCACCTACTATGTGCCAGG - Intronic
1060518992 9:124283230-124283252 CTGAGCACCTACTATGTGCCAGG - Intronic
1060725394 9:126002718-126002740 CTGAGCACCTACTATGTGCCAGG - Intergenic
1061073056 9:128323534-128323556 TTGAGCATTTACTATGTGCCAGG - Intronic
1061203277 9:129149225-129149247 CCCGGGATATGCTATGTGCCAGG - Intergenic
1061341939 9:129989491-129989513 CTGGGCACCTACTATGTGCCAGG + Intronic
1061471780 9:130832627-130832649 ATGTGCATGTAATATGTGCCAGG - Intronic
1061502487 9:131011907-131011929 CTGTGCATCTACTGTGTGCCAGG + Intronic
1186562710 X:10630096-10630118 TTGGGTGTCTACTATGTGCCAGG + Intronic
1186637952 X:11426888-11426910 CTGGGGACCTACTGTGTGCCAGG - Intronic
1187092640 X:16113342-16113364 CTGAGTATTCACTATGTGCCAGG - Intergenic
1187187077 X:16997307-16997329 CTGAGGGTAGACTATGTGCCAGG - Intronic
1187212368 X:17244149-17244171 CTAAGCATCTACTATGTGCCAGG - Intergenic
1187276775 X:17823250-17823272 CTGAGTATTTACCATGTGCCAGG - Intronic
1187369425 X:18692408-18692430 CTGGGTGTCTACCATGTGCCAGG - Intronic
1187408707 X:19027708-19027730 CTGAGCACCTACTATGTGCCAGG - Intronic
1189142462 X:38620918-38620940 CTGGGCTTCTGCTATGTGCCAGG - Intronic
1189217138 X:39335963-39335985 CTTAGGATGTGCTATGTGACAGG - Intergenic
1189767547 X:44387228-44387250 TTGAGGATTTACTATGTTCCAGG - Intergenic
1189901759 X:45713674-45713696 TTGGATATTTACTATGTGCCAGG - Intergenic
1190060440 X:47207872-47207894 CTTGGCATTTACTGTGTGCCTGG + Intronic
1190476686 X:50835051-50835073 CTGAGAACCTACTATGTGCCAGG - Intergenic
1190741762 X:53293365-53293387 CTGAGCATGTACCATGTGCCAGG - Intronic
1190935036 X:54992186-54992208 CTGAGCATCTACTATGAGCCAGG + Intronic
1191976788 X:66881558-66881580 CTGAGCATGTACTATATGTCAGG + Intergenic
1192285200 X:69727903-69727925 TTTTTGATGTACTATGTGCCAGG + Intronic
1192433909 X:71130557-71130579 CTGAGCATGTGCTTTGTGCCAGG + Intronic
1192587223 X:72328601-72328623 CTGGGGCTGTTCTAATTGCCTGG - Intergenic
1193020662 X:76789100-76789122 CTGAGGATGAGCTGTGTGCCAGG - Intergenic
1193489582 X:82133129-82133151 CTGGCCATGTAAGATGTGCCTGG - Intergenic
1193734447 X:85140305-85140327 CTGAGCACTTACTATGTGCCAGG + Intergenic
1193909397 X:87283057-87283079 TTGGGAATCTATTATGTGCCTGG - Intergenic
1194423982 X:93714010-93714032 TTGAGCATTTACTATGTGCCAGG - Intergenic
1194434407 X:93852118-93852140 TTGAGTATTTACTATGTGCCTGG + Intergenic
1194980624 X:100436617-100436639 CTGAGGATCTACTATATACCAGG + Intergenic
1195053484 X:101120809-101120831 CTGCCAATGTACTATGTGCCAGG + Intronic
1195574233 X:106431778-106431800 CTGTGCTCGTACTATGTGCCAGG - Intergenic
1195614002 X:106898458-106898480 GAGGGTTTGTACTATGTGCCAGG + Intronic
1195713289 X:107792830-107792852 TTGGGGATCTACTTTGTGACAGG - Intronic
1195885578 X:109634110-109634132 CTGAGCATGTACTATGTGCTAGG + Intronic
1195964757 X:110419865-110419887 TTGGGTATTTACTATGTGCCAGG + Intronic
1195994872 X:110721783-110721805 CTGAGCACCTACTATGTGCCAGG + Intronic
1196397619 X:115282392-115282414 CTGAGGACCTACTATGTGCTAGG + Intergenic
1196834077 X:119798793-119798815 CTGCGCATCTACTATGTGTCAGG - Intergenic
1196910888 X:120483244-120483266 CTGAGTATCTACTATGTACCAGG - Intergenic
1197080469 X:122407604-122407626 TTTGGTATTTACTATGTGCCTGG - Intergenic
1197282993 X:124559740-124559762 TTCAGGATTTACTATGTGCCAGG - Intronic
1197292884 X:124681830-124681852 TTGGGCATTTAGTATGTGCCAGG - Intronic
1197773326 X:130104551-130104573 CTGGGTGGGTACTATATGCCAGG + Intronic
1198089551 X:133314061-133314083 CTGAGCACCTACTATGTGCCAGG + Intronic
1198223737 X:134626371-134626393 CTGAGCATCTACTATGTGCCAGG - Intronic
1198243252 X:134805318-134805340 TTGGGCACTTACTATGTGCCAGG - Intronic
1198491190 X:137143335-137143357 TTTGGGATTTACTATTTGCCAGG - Intergenic
1198624955 X:138560716-138560738 TTAAGGATGTACTTTGTGCCAGG - Intergenic
1198977818 X:142356931-142356953 CTGAGAATCTACTCTGTGCCAGG + Intergenic
1199151485 X:144491939-144491961 CTGAGCATTTATTATGTGCCTGG + Intergenic
1199431517 X:147766153-147766175 CTGAATATCTACTATGTGCCTGG + Intergenic
1199462913 X:148103315-148103337 ATGGGGGCTTACTATGTGCCAGG - Intergenic
1199616095 X:149657374-149657396 CTGAGCATGTACTGTTTGCCAGG - Intergenic
1199621729 X:149707235-149707257 CTGAGCATGTATTGTGTGCCAGG + Intronic
1199626545 X:149745874-149745896 CTGAGCATGTACTGTTTGCCAGG + Intergenic
1199720955 X:150542464-150542486 TTGGGCACCTACTATGTGCCAGG - Intergenic
1200051294 X:153433245-153433267 CTGCACATGTGCTATGTGCCAGG + Intergenic
1200128778 X:153830277-153830299 CATGGGATGTAATATGTGCGTGG - Exonic
1200948080 Y:8865747-8865769 CTTGGGATTTACTATCTGACAGG + Intergenic