ID: 1181729801

View in Genome Browser
Species Human (GRCh38)
Location 22:24836754-24836776
Sequence CTGAATTCAAAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1880
Summary {0: 1, 1: 2, 2: 55, 3: 322, 4: 1500}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181729801_1181729803 15 Left 1181729801 22:24836754-24836776 CCTTTGTCCATTTTTGAATTCAG 0: 1
1: 2
2: 55
3: 322
4: 1500
Right 1181729803 22:24836792-24836814 TTGCAGTTCTCCATATATTCTGG 0: 1
1: 0
2: 12
3: 154
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181729801 Original CRISPR CTGAATTCAAAAATGGACAA AGG (reversed) Intronic
900687874 1:3960226-3960248 GCCAATTCAAAAATGAACAAAGG + Intergenic
901377619 1:8850762-8850784 CTCAATTCAAAAATGGGCAAAGG + Intergenic
901901228 1:12364823-12364845 CCTAATTCAAAAATTGGCAAAGG - Intronic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902826511 1:18978381-18978403 CCCAATTACAAAATGGACAAAGG - Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903084296 1:20841438-20841460 CTGATTTAAAAAATTGAAAATGG + Intronic
903102143 1:21039827-21039849 CCCAATTAAAAAATGGGCAAAGG + Intronic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
903863947 1:26384151-26384173 CCAAATTTAAAAATGGGCAAAGG + Intergenic
903955938 1:27025779-27025801 CACAATTTAAAAATGGGCAAAGG - Intergenic
904147485 1:28405156-28405178 CCCAATTTAAAAATGGGCAAAGG - Intronic
904204483 1:28844589-28844611 GTTAATTAAAAAATGAACAAGGG - Intronic
904318900 1:29683842-29683864 CAGAAGACAAAAATGCACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904662067 1:32092790-32092812 CTGCACTCTAAAATGGACACAGG - Intronic
905536270 1:38724461-38724483 CTGAATTCCAGAGTGGACAAAGG + Intergenic
905712224 1:40115943-40115965 AGCAATTCAAAAATGGGCAAAGG + Intergenic
905759226 1:40539906-40539928 CACAATTTAAAAATGGGCAAAGG - Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
906752012 1:48272940-48272962 AGCAATTTAAAAATGGACAAAGG - Intergenic
906997645 1:50814659-50814681 CTTATTTAAAAAATGGGCAAAGG + Intronic
907083365 1:51645316-51645338 CCCAATTTAAAAATGGGCAAAGG - Intronic
907166015 1:52411986-52412008 CTGATTTCAAAAATGCCAAATGG - Intronic
907174060 1:52501274-52501296 CCCAATTCAAAAGTGAACAAAGG + Intronic
907209709 1:52809836-52809858 CCCAATTTAAAAATGGGCAAAGG - Intronic
907221287 1:52908630-52908652 CCCAATTCAGAAATGGGCAAAGG + Intronic
907234348 1:53031502-53031524 CAGAATTCAAAGAAGGGCAATGG - Intronic
907279337 1:53335670-53335692 CCCAATTGAAAAATGGGCAAAGG - Intergenic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
907777167 1:57528196-57528218 ATGAATTCTAAAATTGAAAATGG + Intronic
908009388 1:59760125-59760147 CCCAATTCAAAAGTGGGCAAAGG + Intronic
908012265 1:59790795-59790817 CCTAATTCAAAAATGGGCAAGGG - Intergenic
908058112 1:60314310-60314332 CCTGATTCAAACATGGACAAAGG + Intergenic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908819894 1:68074860-68074882 CCTCATTAAAAAATGGACAAAGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909661460 1:78087921-78087943 CTCCATTAAAAAGTGGACAAAGG + Intronic
909684390 1:78330175-78330197 ATAACTTGAAAAATGGACAAAGG + Intronic
909695190 1:78460313-78460335 CCCCATTTAAAAATGGACAAAGG - Intronic
910159909 1:84261546-84261568 CTGATTTAAAAAATGGGCAAAGG + Intergenic
910329479 1:86054464-86054486 CTTTATTAAAAAGTGGACAAAGG + Intronic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
910546191 1:88422038-88422060 CTAGATTCAAAAATGGGCAAAGG + Intergenic
910574600 1:88746424-88746446 CTTATTTAAAAAATGGGCAAAGG + Intronic
910824245 1:91388957-91388979 CCCAATTAAAATATGGACAAAGG + Intronic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911214400 1:95176490-95176512 CCCAATTTAAAAATGGGCAAAGG - Intronic
911578920 1:99612761-99612783 TTTAATTAAAAAATAGACAATGG + Intergenic
911586820 1:99700885-99700907 CAAAATTTAAAAATGGGCAAAGG - Intergenic
911630917 1:100182543-100182565 CTCAATTTAAAAATTGGCAAAGG - Intergenic
911935658 1:103967842-103967864 CACAACTCAAAAATGGACCAAGG - Intergenic
911992981 1:104726230-104726252 CACAATTATAAAATGGACAAAGG + Intergenic
912000647 1:104830584-104830606 CTACATTCAAAATTGGACAAAGG + Intergenic
912024687 1:105154085-105154107 CTCAATTTAAAAATTGTCAAAGG - Intergenic
912279623 1:108299079-108299101 CTTCATTAAAAAGTGGACAAAGG - Intergenic
912288603 1:108395278-108395300 CTTCATTAAAAAGTGGACAAAGG + Intronic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
912473081 1:109919004-109919026 CTGCATTCCAAGATGGATAAGGG + Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
913024114 1:114818456-114818478 CTAAATTTAAAAATGGGTAAAGG - Intergenic
913458078 1:119054212-119054234 CTCGATTGAAAAATGGGCAAAGG + Intronic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
915071024 1:153267273-153267295 CCCAATTAAAAAATGGGCAAAGG - Intergenic
915184177 1:154090508-154090530 CTGATTCAAAAAATGGGCAAAGG + Intronic
915406332 1:155662697-155662719 CTACATTAAAAAATGTACAAAGG + Intronic
915614181 1:157023307-157023329 CTTAAATAAAAAATGGGCAAAGG + Intronic
915640659 1:157222328-157222350 TTCAATTTTAAAATGGACAAAGG - Intergenic
915768344 1:158390675-158390697 CTGGATTCTAAAATTAACAAAGG + Intergenic
915852732 1:159343549-159343571 CTGAATTCCAAAAAGGAAAAAGG - Intergenic
915973444 1:160369940-160369962 CCCAATTTAAAAATGGGCAAAGG - Intronic
916030373 1:160871794-160871816 CCCAATTCAAAAATGGGCAAAGG - Intergenic
916290535 1:163161380-163161402 CTTAATTCAAGAAATGACAAAGG - Intronic
916453430 1:164944293-164944315 CCTGATTGAAAAATGGACAAAGG - Intergenic
916543122 1:165776675-165776697 CCCAATTCAAAAATGGGCAAAGG + Intronic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
916701121 1:167296143-167296165 CTGAATGCAAAAAGGCTCAATGG - Intronic
916778346 1:167993786-167993808 CTGAATTGAATAAAGGACATGGG - Intronic
916937389 1:169643811-169643833 CCTAATTTAAAAATGGGCAAAGG + Intergenic
917002816 1:170378777-170378799 CTCAATTCAAAAATGGGCAAAGG - Intergenic
917408010 1:174729639-174729661 CCCATTTAAAAAATGGACAAAGG + Intronic
917420803 1:174861774-174861796 CCCAATTTAAAAATGGCCAAAGG - Intronic
917426101 1:174915753-174915775 CCCAATTTAAAAATGGGCAAAGG - Intronic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917705304 1:177627018-177627040 CTCAATTTTAAAATGGGCAAAGG + Intergenic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917826618 1:178828588-178828610 CCCAATTAAAAAATGGGCAAAGG + Intronic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918520342 1:185407952-185407974 AGGAGTACAAAAATGGACAAGGG - Intergenic
918563834 1:185902139-185902161 CTCAATTCATAAATGGATATAGG - Intronic
918637429 1:186795093-186795115 CCCAATTTAAAAATAGACAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918692025 1:187492926-187492948 CTGCAATTAAAAATGGGCAAAGG - Intergenic
918742664 1:188154759-188154781 TTGAATTTAAAACTGGAGAAGGG - Intergenic
918806183 1:189048712-189048734 CCAAATTAAAAAATGGGCAAAGG - Intergenic
919017892 1:192064227-192064249 CAAATTTCAAAAATGGGCAAAGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919182103 1:194100089-194100111 CTGTATTAAAAAGTGGGCAAAGG - Intergenic
919192270 1:194237520-194237542 CCCAATTGAAAAATGGGCAAAGG + Intergenic
919364850 1:196645910-196645932 CATAATTTAAAAATGGGCAAAGG + Intergenic
919573297 1:199275520-199275542 CTGAGTTAAAAAATGGGCAGAGG + Intergenic
919716436 1:200782436-200782458 CTGACTGCAAAAAGGCACAAGGG - Intronic
919858647 1:201723254-201723276 CACAATTTAAAAATGGGCAAAGG - Intronic
919965012 1:202514257-202514279 CCCAATTAAAAAATGGGCAAAGG - Intronic
920153622 1:203930200-203930222 CCCAATTAAAAAATGGGCAAGGG + Intergenic
920164464 1:204025954-204025976 GTGAATACAAAAGTGAACAAGGG + Intergenic
920410607 1:205757233-205757255 CCCAAATAAAAAATGGACAAAGG - Intergenic
920595605 1:207266676-207266698 TTCAATTTAAAAATGGGCAAAGG + Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
920754112 1:208711697-208711719 CCCAATTTAAAAATGGGCAAAGG - Intergenic
920861906 1:209715928-209715950 CCTGATTCAAAAATGGGCAAAGG + Intronic
920897150 1:210065095-210065117 CCCAATTCAAAACTGGGCAAAGG - Intronic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921115891 1:212091120-212091142 CCTAATTTTAAAATGGACAAAGG + Intronic
921241662 1:213190475-213190497 CTAATTTAAAACATGGACAAAGG - Intronic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921658842 1:217775256-217775278 CCCAATTCAAAAATGGGCAAAGG - Intronic
921675050 1:217967702-217967724 CTCCATTAAAAAGTGGACAAAGG - Intergenic
921762765 1:218936303-218936325 AAGAATTTAAAAATGAACAAAGG - Intergenic
921884594 1:220292793-220292815 CCTAATTAAAAAATGGGCAATGG - Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
921902435 1:220464723-220464745 CCTATTTAAAAAATGGACAAAGG - Intergenic
921987744 1:221330553-221330575 CTGAATTCAAACATTTACTACGG + Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922631508 1:227118220-227118242 CTCAATCAAAAAATGGGCAAAGG + Intronic
922655265 1:227376773-227376795 CTCAATTTGAAAATGGGCAAAGG - Intergenic
922815779 1:228447776-228447798 CTAACTTTAAAAATAGACAAAGG - Intergenic
922825661 1:228516372-228516394 CTCCATTTAAAAATGGGCAAAGG - Intergenic
923058248 1:230445899-230445921 CCCAATTAAAAAATGGGCAAAGG + Intergenic
923177571 1:231481958-231481980 CTTGATTAAAAAATGGGCAAAGG - Intergenic
923226508 1:231942997-231943019 GTTAATTCTAAAATGGACAAAGG - Intronic
923248580 1:232158259-232158281 CCCAATTAAAAAATGGGCAAAGG + Intergenic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923428857 1:233900518-233900540 CCCAATTAAAAAATGGACAAAGG + Intergenic
923691111 1:236193693-236193715 CCCAGTTTAAAAATGGACAAAGG - Intronic
923716940 1:236433231-236433253 ATGCATACAAAAATGTACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924275079 1:242377693-242377715 CTCAATTTAAAAATGAGCAAAGG + Intronic
924463270 1:244278364-244278386 CTTCATTAAAAAATGGGCAAAGG - Intergenic
924658046 1:245991534-245991556 GTCAACTCAAAGATGGACAAAGG + Intronic
924951017 1:248883421-248883443 CTCCATTTAAAAATGGGCAAAGG - Intergenic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1062822430 10:544755-544777 TCCAATTTAAAAATGGACAAAGG - Intronic
1062997787 10:1883105-1883127 CTGAATTAAAGCATTGACAATGG + Intergenic
1063092840 10:2883016-2883038 ATGAATTTAAATATGGACATGGG - Intergenic
1064157157 10:12912443-12912465 CTGATTTAAAAAATGGGCAAAGG - Intronic
1064163762 10:12969123-12969145 GTCAATTAAAAAATGGGCAAAGG + Intronic
1064319453 10:14289448-14289470 CCCAATTAAAAACTGGACAAAGG - Intronic
1064367669 10:14722644-14722666 ATCAATTTAAAAATGGGCAAAGG - Intronic
1064441730 10:15359898-15359920 CTGAATTCCAAAAAGGAACATGG + Intronic
1064448674 10:15421591-15421613 CCCAATTCAAAAATGTGCAAAGG + Intergenic
1064508774 10:16065792-16065814 CACAATTTAAAAATGGGCAAAGG - Intergenic
1064668176 10:17679387-17679409 CCCAATTCAAAAATGGGCAAAGG - Intronic
1064845659 10:19649555-19649577 CTCCATTAAAAAGTGGACAAAGG - Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1064986998 10:21220818-21220840 CCTAATTTTAAAATGGACAAAGG + Intergenic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065104093 10:22362807-22362829 CCCAATTCAAAAATGGTCACAGG + Intronic
1065131763 10:22628892-22628914 CTGAATTCCAAAAGGGAAAATGG + Intronic
1065245961 10:23757877-23757899 TCTAATTCAAAAATGGGCAAAGG - Intronic
1065401646 10:25309378-25309400 CTGAATTCAAAAGTGGGCAAAGG - Intronic
1065439228 10:25732650-25732672 CCCAATTAAAAAATGGACAAAGG - Intergenic
1065743515 10:28817906-28817928 CTGAAATTAAAAAGGGAGAAGGG - Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1065906425 10:30256973-30256995 CCCTATTAAAAAATGGACAAGGG - Intergenic
1066050440 10:31630375-31630397 TTGATTTAAAAAATGGACTAAGG - Intergenic
1066070287 10:31801635-31801657 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066536079 10:36393685-36393707 CACAATTTAAAAATGGCCAAAGG + Intergenic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066698556 10:38101014-38101036 CCTGATTCAAAGATGGACAAAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1066994094 10:42547205-42547227 CCTGATTCAAAGATGGACAAAGG + Intergenic
1067174385 10:43932666-43932688 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1067259172 10:44672290-44672312 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1067413657 10:46086766-46086788 CCCAATTAAAAAATGGACAGAGG - Intergenic
1067495622 10:46757656-46757678 CTAATTTCAAGAAGGGACAAAGG - Intergenic
1067522697 10:47020247-47020269 CTCATTTCAAAGATGGACATGGG + Intergenic
1067599031 10:47582732-47582754 CTAATTTCAAGAAGGGACAAAGG + Intergenic
1067813357 10:49449296-49449318 ATAACTTTAAAAATGGACAAAGG - Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1067948694 10:50709317-50709339 CTAATTTCAAGAAGGGACAAAGG + Intergenic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068440672 10:57051683-57051705 CATCATTAAAAAATGGACAAAGG - Intergenic
1068563338 10:58542674-58542696 CAAAATTTAAAAATGGGCAAAGG + Intronic
1068685598 10:59867349-59867371 CTGAATTCAAAAAGGGAGGGAGG - Intronic
1069017622 10:63448098-63448120 CTAAATTCAGTAATGCACAAAGG - Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069298195 10:66873539-66873561 CTCCATTAAAAAATGGACAGAGG - Intronic
1069543218 10:69311220-69311242 CTGAATTCCAAAAGGGATGAAGG + Intronic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069719924 10:70543221-70543243 TCCAATTCAAAAATGGACAAAGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070058485 10:72957881-72957903 CCCAATTGAAAAATGGACAAAGG - Intergenic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070357014 10:75649943-75649965 CTCAATTCAAAAATGGGCAAAGG - Intronic
1070443818 10:76474543-76474565 CTCATTTTAAAAATGGTCAAAGG + Intronic
1070501498 10:77076889-77076911 CTGATTTCATAATTGGACAACGG - Intronic
1070501839 10:77079883-77079905 TTGATTTCATAATTGGACAACGG - Intronic
1070736454 10:78866758-78866780 GTGAATTCAAAAGTGGATAATGG + Intergenic
1070884014 10:79874314-79874336 CTAATTTCAAGAAGGGACAAAGG + Intergenic
1070941041 10:80347250-80347272 CCCAATTAAAAAATGGGCAAAGG - Intronic
1071040560 10:81303797-81303819 CTCCATTGAAAAATGGGCAAAGG + Intergenic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071253809 10:83848477-83848499 TTGATTTTAAAAATGGGCAAAGG + Intergenic
1071542157 10:86495811-86495833 CTCAATTCAAAAATGGGCAAAGG + Intronic
1071650568 10:87390614-87390636 CTAATTTCAAGAAGGGACAAAGG + Intergenic
1071833646 10:89396900-89396922 CCCAATTTAAAAATGGGCAAAGG - Intronic
1071959201 10:90793224-90793246 CCCAATTTAAAAATGGGCAAAGG + Intronic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1072177719 10:92945194-92945216 CTGAATTAAAAAGTGGGCAAAGG - Intronic
1072264831 10:93717252-93717274 CCCAATTCAAATATGGGCAAAGG - Intergenic
1072266687 10:93736078-93736100 CTGAATTAAATTATGGCCAATGG + Intergenic
1072270948 10:93775806-93775828 CTGATTTGAAAAATGGCCCAAGG - Intronic
1072310946 10:94154623-94154645 CACAATTCAAAAATGGGCAAAGG + Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1073479584 10:103778026-103778048 CTGAAGTTAAAAAGGGAAAATGG + Intronic
1073505231 10:103981150-103981172 CCCAATTCAAAAATAGGCAAAGG - Intronic
1073978824 10:109131125-109131147 TTCAATTTAAAAATGGACATTGG - Intergenic
1074029567 10:109672606-109672628 ATGAAATCAAAAATGGGCAAAGG + Intergenic
1074174390 10:110981816-110981838 CTGAATTCAACAATATAAAAGGG - Intronic
1074210318 10:111326674-111326696 CTCCATTAAAAACTGGACAAAGG - Intergenic
1074473211 10:113745862-113745884 CTAAATACAAAAATAGACACTGG + Intergenic
1074641608 10:115390019-115390041 CACAATTTTAAAATGGACAAAGG - Intronic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1074806017 10:117053430-117053452 CTCAATTTAAAAATGGGGAAAGG + Intronic
1074824556 10:117205296-117205318 CTGAATGCCAAAATGCATAATGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075215837 10:120533338-120533360 CCGGATTTAAAAATGGGCAAAGG - Intronic
1075278413 10:121116779-121116801 CTCAATTAAAAAGTGGGCAAAGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075905373 10:126076681-126076703 TTCAATTTAAAAATGGGCAAAGG - Intronic
1076299502 10:129414421-129414443 CTGAGTTCAAAAAGGGACGCAGG - Intergenic
1076366441 10:129923949-129923971 AATGATTCAAAAATGGACAAAGG + Intronic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1076592387 10:131593005-131593027 CACAATTAAAAAATAGACAAAGG - Intergenic
1076592704 10:131597705-131597727 CACAATTAAAAAATAGACAAAGG - Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1077204315 11:1334929-1334951 CTCAATTAAAAAATGGCAAAGGG - Intergenic
1077470138 11:2753979-2754001 CCCAATTAAAAAATGGGCAAAGG + Intronic
1077670842 11:4156047-4156069 CCCAATTGAAAAATGGCCAAAGG - Intergenic
1077700986 11:4442362-4442384 TCCAATTCAAAAATGGGCAAAGG + Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078042032 11:7875511-7875533 CACAATTTAAAAATGGGCAAAGG + Intergenic
1078071689 11:8116579-8116601 CCCAATTTAAAAATGGGCAAAGG + Intronic
1078316449 11:10297027-10297049 ATCAATTAAAAAATGGGCAAAGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1080325865 11:31072266-31072288 TTCAATACAAAAATGGGCAAAGG - Intronic
1080340316 11:31255650-31255672 TTCAATTAAAAAATGGGCAAAGG - Intronic
1080378070 11:31737650-31737672 CCCAATTCAAAAATGGGCAAAGG + Intronic
1080830041 11:35884351-35884373 CCAGATTCAAAAATGGGCAAAGG - Intergenic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1080999643 11:37652795-37652817 TTGATTTAAAAAATGGGCAAAGG - Intergenic
1081055352 11:38403566-38403588 CCCTATTTAAAAATGGACAAAGG - Intergenic
1081166848 11:39818360-39818382 CTGAAGTGAAGAAGGGACAAAGG - Intergenic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1081376551 11:42366275-42366297 TTGATTTAAAAAATGGGCAAAGG - Intergenic
1081951500 11:47047827-47047849 CCCAATTTAAAAATGGGCAAAGG + Intronic
1082565344 11:54670895-54670917 CTCAATCAAAAAGTGGACAAAGG + Intergenic
1082682544 11:56194103-56194125 GTCAATTCAAAAATGCACAAAGG + Intergenic
1082886252 11:58086180-58086202 CCCAATTAAAACATGGACAAAGG + Intronic
1082887790 11:58106318-58106340 TACAATTAAAAAATGGACAAAGG - Intronic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1083692344 11:64417598-64417620 ATGAATTAAAGAATGGGCAAAGG + Intergenic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084353543 11:68621562-68621584 CGTGATTCAAAAATGGGCAAAGG + Intergenic
1084576362 11:69990789-69990811 CTCAATTAGAAAATAGACAAAGG - Intergenic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1085343208 11:75747332-75747354 CCTAATTAAAAAATGGACAAAGG + Intergenic
1085377320 11:76076777-76076799 CCTAATTTAAAAATGGTCAAAGG - Intronic
1085557070 11:77433807-77433829 ACCAATTTAAAAATGGACAAAGG + Intronic
1085619611 11:78027957-78027979 CTGAATTCCAAAAGGGGGAAGGG + Intronic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1086020417 11:82222221-82222243 CTGATTTAAAAAATGGCCTAAGG - Intergenic
1086144031 11:83531324-83531346 CCCAATTTAAAAATGGGCAAAGG + Intronic
1086270605 11:85061061-85061083 AAAAATTAAAAAATGGACAAAGG - Intronic
1086427282 11:86697685-86697707 ATTAATTCAAAAATGGATCATGG + Intergenic
1086461497 11:87010264-87010286 TCCAATTAAAAAATGGACAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1087034455 11:93741940-93741962 CTGAAGGCAGAAATAGACAAAGG - Exonic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087231455 11:95670387-95670409 CACAATTTTAAAATGGACAAAGG - Intergenic
1087611600 11:100441059-100441081 CTCAATTTAAAAATGAGCAAAGG + Intergenic
1087910303 11:103744819-103744841 AAGTAATCAAAAATGGACAAAGG - Intergenic
1087913463 11:103780275-103780297 CTGAATTGAAACATGGAAAGAGG + Intergenic
1087954039 11:104261765-104261787 CCTAATTAAAAAATGGGCAAAGG - Intergenic
1088155163 11:106793671-106793693 CCCAATTTAAAAATGAACAAAGG + Intronic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088418471 11:109616515-109616537 CTCATTTTAAAAATGGGCAAAGG + Intergenic
1088444538 11:109911034-109911056 CCTGATTCAAAAATTGACAAAGG + Intergenic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1088520787 11:110697402-110697424 CTCCATTAAAAAATGGGCAAAGG - Intronic
1088599002 11:111459451-111459473 CTGAATTCAGAAAGGAAGAAAGG - Intergenic
1089151790 11:116370022-116370044 CTGAAACCAAAAACAGACAACGG + Intergenic
1089168556 11:116496865-116496887 CTGGATTTAAAAATTGGCAAAGG - Intergenic
1089241214 11:117081955-117081977 TCCAATTCAAAAATGGGCAAAGG + Intronic
1089766183 11:120767369-120767391 CCCAATTTAAAAATGGGCAAAGG - Intronic
1089851684 11:121502710-121502732 CCCAATTTAAAAACGGACAAAGG - Intronic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090112147 11:123924347-123924369 CTGATTTCAAAAATGAGCAAAGG - Intergenic
1090160858 11:124493216-124493238 TGCAATTCAAAAGTGGACAATGG - Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1090866827 11:130708579-130708601 CCCAATTAAAAAACGGACAAAGG + Intronic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1091304234 11:134527179-134527201 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091432016 12:444306-444328 CCCAATTCAAAAATGGGCCAGGG + Intergenic
1091559227 12:1598314-1598336 CCCAATTTAAAAATGGGCAAAGG + Intronic
1092439734 12:8489301-8489323 TTGATTTAAAAAATGGAGAAAGG + Intergenic
1092516015 12:9213654-9213676 TTGAATTAAAAGATGGGCAAAGG - Intergenic
1092632682 12:10399929-10399951 CCCTATTTAAAAATGGACAAAGG + Intronic
1092751214 12:11720888-11720910 CTCCATTAAAAAATGGGCAAAGG + Intronic
1092827151 12:12411412-12411434 CCCAATTCATAAATGGGCAAAGG - Intronic
1093015856 12:14153864-14153886 CCCAATTAAAAAATGGATAAAGG + Intergenic
1093044190 12:14423202-14423224 CCCAATTTAAAAATGGTCAAAGG - Intronic
1093259666 12:16919486-16919508 CCCAATTGAAAAATGAACAAAGG + Intergenic
1093405776 12:18802185-18802207 CTGAATTCAAGAATTCATAAGGG - Intergenic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093531322 12:20167970-20167992 TTGAAGTACAAAATGGACAATGG - Intergenic
1093541476 12:20291764-20291786 CCTAATTAAAAAATGGGCAAAGG - Intergenic
1093623747 12:21322710-21322732 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1093655818 12:21693341-21693363 CCCCATTAAAAAATGGACAAAGG + Intronic
1093855517 12:24097203-24097225 TCCAATTTAAAAATGGACAAAGG - Intergenic
1093956595 12:25227498-25227520 TTCAATTTAAAAATGGGCAAAGG + Intronic
1094101260 12:26766444-26766466 CCCAATTGAAAAATGGACAGAGG - Intronic
1094272377 12:28631042-28631064 TTGAATTCAAAAATTACCAAGGG + Intergenic
1094632987 12:32195961-32195983 CCCAATTTAAAAACGGACAAAGG + Intronic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1094784852 12:33836009-33836031 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095517125 12:43018592-43018614 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1095574341 12:43718196-43718218 CTTGATTAAAATATGGACAAAGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1096236938 12:49935339-49935361 CTCAATTTAAAAAGGGGCAAAGG - Intergenic
1096345861 12:50845959-50845981 CCCAGTTCAAAAATGGACAAAGG - Intronic
1096356709 12:50947437-50947459 CTGACTTTAAAAATGGAGGAAGG - Intergenic
1096762915 12:53858367-53858389 CCCAATTTAAAAATGGACTAAGG + Intergenic
1096937514 12:55298804-55298826 CTCAATTAGAAAATGGGCAAAGG - Intergenic
1097258966 12:57702909-57702931 CTCAATTCAAAAATGGGCAGAGG - Intronic
1097296775 12:57973828-57973850 CCTGATTCAAAAATGGGCAAAGG + Intergenic
1097311515 12:58124037-58124059 ATGACTTTAAAAATGGGCAATGG + Intergenic
1097370352 12:58771238-58771260 CTCCATTAAAAAGTGGACAAAGG + Intronic
1097509785 12:60523837-60523859 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1097660993 12:62431168-62431190 CACAATTTAAAAATGGGCAAAGG + Intergenic
1097856162 12:64464761-64464783 CCCAATTTAAAAATGGGCAAAGG + Intronic
1097903236 12:64893781-64893803 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098186962 12:67906899-67906921 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1098325333 12:69296431-69296453 CTTAAGTTAAAAATGGGCAAAGG + Intergenic
1098385375 12:69913131-69913153 CCCAAGTCAAAAATGGGCAAAGG - Intronic
1098400286 12:70067518-70067540 CTGAATGCAAACATAAACAATGG - Intergenic
1098556968 12:71830091-71830113 CAACATTCAAAAATGGGCAAAGG - Intergenic
1098649469 12:72946280-72946302 TCCAATTAAAAAATGGACAAAGG + Intergenic
1098660759 12:73090558-73090580 CTCAATTCAAAAGTAGGCAAAGG + Intergenic
1098753798 12:74331332-74331354 ATGAAAGCAAAAATAGACAAGGG + Intergenic
1098999439 12:77160843-77160865 ATGAGTTGAAAAATTGACAAAGG - Intergenic
1099032454 12:77544257-77544279 CCCCATTAAAAAATGGACAAAGG + Intergenic
1099045805 12:77717898-77717920 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1099092903 12:78336399-78336421 ATCAAAGCAAAAATGGACAAAGG + Intergenic
1099246277 12:80196918-80196940 CTGAATTATAAAATGGAGGAGGG - Intergenic
1099258874 12:80350726-80350748 CCCAATTTAAAAATGGTCAAAGG - Intronic
1099259665 12:80361800-80361822 CTGATTTTTAAAATGGGCAAAGG - Intronic
1099289662 12:80761262-80761284 CTGAATTAAAAACTTTACAAAGG - Intergenic
1099394951 12:82126377-82126399 CTGCATTAAAAAGTGGGCAATGG + Intergenic
1099679072 12:85801438-85801460 CTCAATTCAAAAAGGGAGCAGGG + Exonic
1099688344 12:85918618-85918640 CCCAATTCAAAAATGGACAAAGG - Intergenic
1100176146 12:92033144-92033166 CAGAATTGAAAAAGGGAGAAGGG + Intronic
1100179718 12:92072302-92072324 CTGAATTCAAACTTGAATAATGG - Intronic
1100279363 12:93103690-93103712 CTGATTTCAAGCATGGACGATGG - Intergenic
1100423906 12:94464149-94464171 TCCAATTTAAAAATGGACAAAGG + Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1100483877 12:95005842-95005864 CCCGATTCAAAAATGGGCAAAGG - Intergenic
1100514679 12:95315551-95315573 CTGAATTCAAAAACAAGCAAAGG - Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1100732851 12:97492034-97492056 CTTAATTCAAAAATGTGCACAGG + Intergenic
1101215903 12:102582343-102582365 CCTCATTCAAAAGTGGACAAAGG - Intergenic
1101293100 12:103391584-103391606 CCCAATTAAAAAATGGGCAAAGG - Intronic
1101482488 12:105112726-105112748 CCCAATTTAAAAATGGGCAAAGG - Intronic
1101488198 12:105186909-105186931 CCCAATTAAAAAATGGACCAAGG - Intronic
1101647279 12:106643103-106643125 CTGTATTCAGTGATGGACAATGG - Intronic
1101658612 12:106746629-106746651 TTAAATTAAAAAATAGACAAAGG + Intronic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1101936678 12:109063852-109063874 CCCAATTCAAAAATGGGCAAAGG - Intronic
1102412828 12:112735215-112735237 CTGACAGCAAAAATGGCCAATGG + Intronic
1102544570 12:113645482-113645504 CTGAATTCAAGAAGGGAGGAAGG + Intergenic
1103598614 12:122039869-122039891 CTGTATTCAAAAATAGAGACAGG + Intronic
1103608007 12:122102257-122102279 CCCAATTTAAAAATGGACAGAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105380086 13:19878812-19878834 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1105494125 13:20915599-20915621 CCTGATTAAAAAATGGACAAAGG + Intergenic
1105562929 13:21512270-21512292 CCCAATTAAAAACTGGACAAAGG - Intronic
1105772300 13:23623800-23623822 CCTAATTTAAAAATGGGCAAGGG - Intronic
1105823615 13:24102302-24102324 CCCAATTTAAAAATGGATAAAGG - Intronic
1105906321 13:24813455-24813477 CCAATTACAAAAATGGACAAAGG - Intronic
1105952177 13:25239493-25239515 CCCAATTAAAAAATGAACAAAGG + Intergenic
1106030909 13:26001693-26001715 CTTGATTAAAAAATGGGCAAAGG - Intronic
1106063562 13:26320692-26320714 CTTGATTCAAAAATTGGCAAAGG + Intronic
1106074281 13:26444156-26444178 CTTAATTCAAAAGTGTAGAAGGG - Intergenic
1106105047 13:26725510-26725532 CTCAGTTTAAAAATGGGCAAAGG - Intergenic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106238841 13:27890812-27890834 CTCCTTTCAAAAATGGGCAAAGG - Intergenic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106738544 13:32613561-32613583 CCCAATTTAAAAATGGGCAAAGG - Intronic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106935802 13:34717968-34717990 CTCTATTCAAAAACGGGCAAAGG + Intergenic
1107085983 13:36428699-36428721 CTGAATTGTAATTTGGACAAGGG + Intergenic
1107365769 13:39673054-39673076 CTAAATTAAAAAATGGGTAAAGG - Intronic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107593140 13:41930049-41930071 CCCAATTTAAAAATGGGCAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108239675 13:48449942-48449964 CTCCATTCAAAAGTGGGCAAAGG - Intronic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108390969 13:49947335-49947357 CTGAATTCCAAAAAGGAGAAGGG - Intergenic
1108680391 13:52775124-52775146 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1108976768 13:56454243-56454265 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
1109004169 13:56848160-56848182 CTGAATTGAAAGATAGACATAGG - Intergenic
1109015530 13:57007712-57007734 CTGATTTTTAAAATGGGCAAAGG + Intergenic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109127594 13:58537072-58537094 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1109280844 13:60353294-60353316 CCCAATTTAAAAATGAACAAAGG - Intergenic
1109392975 13:61717457-61717479 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109644335 13:65233841-65233863 TTCAATTTAAAAGTGGACAATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1109889455 13:68589330-68589352 ATCTAATCAAAAATGGACAAAGG + Intergenic
1110031313 13:70618248-70618270 CTTCATTAAAAAATGGGCAAAGG + Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1110861837 13:80352981-80353003 CTCAATTAAAACATGGAAAAAGG - Intergenic
1111415080 13:87929678-87929700 CCCAATTCAAAAATGAGCAAAGG + Intergenic
1112049060 13:95627453-95627475 CCCAATTAAAAAATGGGCAAAGG + Intronic
1112067609 13:95810923-95810945 CACAATTCAAAAATGGGCAAAGG + Intronic
1112084258 13:96012555-96012577 CTCAATTCAAAAATAGGCAAAGG + Intronic
1112161206 13:96869951-96869973 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112472701 13:99703251-99703273 TTAAATTTAAAAAGGGACAATGG - Intronic
1112750166 13:102575093-102575115 CTGGATTAAAAAGTGGGCAAAGG - Intergenic
1112823203 13:103359725-103359747 CCTAATTTAAAAATGAACAATGG + Intergenic
1113189506 13:107727848-107727870 CTGTATCCAAAAGTGGGCAAAGG + Intronic
1113282358 13:108802894-108802916 CCCAATTTAAAAATGGCCAAAGG - Intronic
1113370587 13:109721688-109721710 CTGGATTAAAAAATAGACTATGG - Intergenic
1113509363 13:110840025-110840047 CAGAATTAAAAATTGGGCAAAGG - Intergenic
1113571979 13:111364522-111364544 CCAAATTTAAAAATTGACAAAGG + Intergenic
1113712079 13:112472672-112472694 CTACATTAAAAAATGGGCAAAGG + Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114144689 14:19961016-19961038 CTGACTTCAAAATTTGAAAAGGG + Intergenic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1114316824 14:21517106-21517128 TGTAATTCAAAAATGGAGAAGGG - Intergenic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114375961 14:22147388-22147410 GTGAATTTAAAAATGTAAAATGG - Intergenic
1114441617 14:22752795-22752817 CTGAATTCCAAAAGGGAAGAGGG + Intergenic
1114695710 14:24625332-24625354 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1114932384 14:27489817-27489839 CTAAATTAAATAATGGGCAAAGG + Intergenic
1114940671 14:27606603-27606625 CTGAACTCCAAAAGGGAGAAGGG - Intergenic
1115003520 14:28451381-28451403 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115582434 14:34774844-34774866 CCCAATTTAAAAATGGGCAAAGG + Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1115904331 14:38190042-38190064 CAGAATTCCAAAAGGGAGAAAGG - Intergenic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116104332 14:40480872-40480894 CTGAATTTAAGAATGGCCAAAGG + Intergenic
1116163020 14:41293792-41293814 CCCCATTGAAAAATGGACAAAGG + Intergenic
1116231724 14:42227084-42227106 CTCACTTAAAAAATGGGCAAAGG - Intergenic
1116491927 14:45514765-45514787 TTCAATTAAAAAATGGACAGAGG + Intergenic
1116504313 14:45660102-45660124 CCCCATTGAAAAATGGACAAAGG - Intergenic
1116516170 14:45808889-45808911 CTGAATTAATTAATGGACAGTGG + Intergenic
1116723164 14:48527109-48527131 CTCCATTAAAAAATAGACAAAGG - Intergenic
1117128501 14:52659212-52659234 ATGAATTTAAAAATTCACAAAGG + Intronic
1117131357 14:52690438-52690460 CCCAATTAAAAAATGGGCAAGGG + Intronic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117934344 14:60885579-60885601 CTCAACTTAAAAATGGGCAAAGG - Intronic
1118120335 14:62832939-62832961 CCAAATTTAAAAATGGGCAAAGG - Intronic
1118204066 14:63705300-63705322 CACAATTGAAAAATGGGCAAAGG + Intronic
1118312059 14:64701362-64701384 CCCAGTTTAAAAATGGACAAAGG - Intergenic
1118897897 14:69962075-69962097 CTGAATTAAGAAATGGGAAAAGG - Intronic
1118946863 14:70396813-70396835 CCCAATTCAAAAATGAGCAAAGG - Intronic
1118986773 14:70762570-70762592 CTTACTTTAAAAATGGGCAAAGG - Intronic
1119523803 14:75306063-75306085 CCCAGTTCAAAAATGGCCAAAGG - Intergenic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120123871 14:80717043-80717065 CCCAATTAAAAAATGGATAAAGG - Intronic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120277896 14:82400484-82400506 CTCCATTTAAAAGTGGACAAAGG - Intergenic
1120324097 14:83003685-83003707 GTAAATCCAAAAATGGACAATGG - Intergenic
1120374588 14:83686446-83686468 CCAGATTTAAAAATGGACAAAGG + Intergenic
1120576091 14:86182769-86182791 CCCCATTCAAAAATGGTCAAAGG - Intergenic
1120891790 14:89498079-89498101 CCTAACTCAAAAATGGGCAAAGG - Intronic
1120931860 14:89856756-89856778 CCCAATTTAAAAATGGGCAAAGG - Intronic
1121316903 14:92967248-92967270 CTCTATTTAAAAATGGGCAAAGG + Intronic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121657624 14:95609223-95609245 CTCAATTTAAAAATGGGCTAAGG - Intergenic
1121975516 14:98400213-98400235 CTAATTTTAAAAATGGGCAAAGG + Intergenic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1122528246 14:102405349-102405371 CCCAATTCAAAAATGGGCAAAGG + Intronic
1122617176 14:103026999-103027021 CCCAATTTAAAAATGGGCAAAGG + Intronic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1123799324 15:23804106-23804128 CTGACTTCAAGAATGGAGCAGGG - Intergenic
1124056758 15:26247457-26247479 CTCAATTTAAAAATTAACAAAGG - Intergenic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1124406415 15:29396434-29396456 CACAATTCAAAAATGGGCAAAGG - Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124452165 15:29804700-29804722 CTCATTTCAAACATGCACAAGGG + Intronic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125243963 15:37612438-37612460 CCCAATTCGAAAGTGGACAAAGG - Intergenic
1125401331 15:39306836-39306858 CTTGATTCACAAGTGGACAAAGG - Intergenic
1125583756 15:40806031-40806053 CTGAAATCAGAAATGGCCATGGG - Intronic
1125963566 15:43853565-43853587 CCCAATTAAAAAATGGGCAAAGG + Intronic
1126297869 15:47161449-47161471 CTCAATTCAATGATGGAAAAAGG + Intergenic
1126378368 15:48019640-48019662 CCAAATTTTAAAATGGACAAAGG + Intergenic
1126496555 15:49297252-49297274 CTCCATTAAAAAATGGGCAAAGG - Intronic
1127048904 15:55059139-55059161 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1127192959 15:56551659-56551681 GGCAATTAAAAAATGGACAAGGG + Intergenic
1127309001 15:57735329-57735351 CTGAAGTATAATATGGACAAAGG - Intronic
1127712826 15:61618240-61618262 CTTGATTAAAAAATGGGCAAAGG + Intergenic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128436030 15:67649211-67649233 CTCATTTAAAAAATAGACAAAGG - Intronic
1128521059 15:68375255-68375277 CTGATTTCAGAAAAGGAAAATGG - Intronic
1128658470 15:69479966-69479988 CCCAATTTAAAAATGGGCAATGG + Intergenic
1128696389 15:69766719-69766741 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1128807667 15:70544208-70544230 CTCAATTAAAAATTGGGCAAAGG + Intergenic
1129493019 15:75947980-75948002 CCTAATTCAAAAACGGGCAAAGG - Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129578015 15:76774234-76774256 CTAAATTGAATTATGGACAAAGG + Intronic
1129583462 15:76837207-76837229 CCCAATTAAAAAATGGGCAAAGG + Intronic
1129910853 15:79225236-79225258 CTGATTTAAAAAATGGGCAGAGG - Intergenic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130121652 15:81054231-81054253 CTTAATTAAAAAGTGGGCAAAGG + Intronic
1130219454 15:82006886-82006908 CTGGATTCAAACATGGAAGAAGG + Intergenic
1130238106 15:82157787-82157809 CTGAATTAAAATCTGGACACAGG + Exonic
1130571576 15:85050148-85050170 CCCAATTCAAAAATGGGCAAAGG - Intronic
1130584022 15:85165537-85165559 CTTGATTCAAAAATGGGCAAAGG + Intergenic
1130718286 15:86358844-86358866 CTTAATTTAAAAATGGGCTAAGG - Intronic
1130773641 15:86952508-86952530 CTCATTTAAAAAATGGGCAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131010601 15:89014993-89015015 CCGAATTTTAAAATGGGCAAAGG + Intergenic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1132159911 15:99531048-99531070 CCCAATTAAAAAATTGACAAGGG + Intergenic
1132168640 15:99623716-99623738 CCCAATTTAAAAATGGGCAAAGG - Intronic
1132199329 15:99938267-99938289 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1132259706 15:100411931-100411953 CTGGGTTCAAAATTGGGCAAAGG - Intronic
1132990968 16:2793579-2793601 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133559524 16:6937867-6937889 CTGAATTCCAAAAGGGAGATGGG + Intronic
1133824128 16:9261883-9261905 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1133920066 16:10144484-10144506 GACAATTAAAAAATGGACAAAGG - Intronic
1133945917 16:10348421-10348443 CTGCACTCCAAACTGGACAATGG - Intronic
1134160074 16:11880733-11880755 CCCAATTCAAAAATGGGCAAAGG - Intronic
1134420359 16:14081872-14081894 TCCAATTAAAAAATGGACAAAGG - Intronic
1134424772 16:14130152-14130174 CCCAATTTAAAAATGGGCAAAGG - Intronic
1134787088 16:16954107-16954129 CACAGTTCAAAAATGAACAAAGG - Intergenic
1134873506 16:17674730-17674752 CTCAATTCAAGAATGGAGAAAGG - Intergenic
1135008133 16:18846542-18846564 CCCAATTAAAAAATGGGCAAAGG + Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135839815 16:25865483-25865505 CTGATTTTTAAAATGGGCAAAGG - Intronic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1137248384 16:46724126-46724148 CCCAATTTAAAAATGGTCAAAGG - Intronic
1137258159 16:46795440-46795462 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1137302975 16:47171388-47171410 CTAAAATCAGAAATGAACAATGG - Intronic
1137517033 16:49154804-49154826 ATTAATTTAAAAATGGACAGAGG + Intergenic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1138291483 16:55851310-55851332 CTCAATTCAAAAATGGGCAAGGG + Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138600472 16:58051246-58051268 CTGAATTCCAAAAGGGAAAAGGG + Intergenic
1138636589 16:58344032-58344054 CCAGATTTAAAAATGGACAAAGG - Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138900970 16:61269592-61269614 CTCAACTAAAAAATGAACAATGG - Intergenic
1139019393 16:62728630-62728652 CTAAAATAAGAAATGGACAAGGG - Intergenic
1139190954 16:64862256-64862278 CTGAACTCATAAATGGATTATGG - Intergenic
1139408820 16:66741954-66741976 CTGGATTCCAAAATGAACTAAGG + Intronic
1139656963 16:68394240-68394262 CTGATTTGGAAAATGGAAAATGG - Intronic
1140097532 16:71887829-71887851 CTCAATTTAAAAATAGGCAAAGG - Intronic
1140561458 16:75986927-75986949 CCCAATTACAAAATGGACAATGG + Intergenic
1140578871 16:76205100-76205122 CCCAATTAAAAAATAGACAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140659842 16:77178115-77178137 CTGATTTGAAAAGTGGTCAAAGG - Intergenic
1140716519 16:77730910-77730932 AAAAATTTAAAAATGGACAAAGG - Intronic
1141175375 16:81715069-81715091 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1141445137 16:84052843-84052865 CCCAATTAAAATATGGACAAAGG + Intergenic
1142293510 16:89203940-89203962 CCCAATTCAAAAATGGGCAAAGG - Intergenic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1142892729 17:2955448-2955470 CTCAATTTAAAAACGGGCAAAGG - Intronic
1142946203 17:3430601-3430623 CTAAGTTAAAAAATGGGCAAAGG + Intergenic
1143428236 17:6857668-6857690 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1144520986 17:15952044-15952066 CTGAATTCTGAAAAGGACAGTGG + Intronic
1144748324 17:17630943-17630965 CCCAATTCAAAAAGGGTCAAAGG - Intergenic
1144821849 17:18080627-18080649 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1144938837 17:18922575-18922597 CCTAGTTCAAAAATGGGCAAAGG - Intronic
1144962674 17:19054738-19054760 CACAATTTAAAAATGGGCAAAGG + Intergenic
1144972487 17:19119783-19119805 CACAATTTAAAAATGGGCAAAGG - Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1145720461 17:27066411-27066433 GTTAATTCAAAATTGAACAAAGG - Intergenic
1145750562 17:27352729-27352751 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1146099085 17:29961283-29961305 CCTAATTCAAAAATGGGCAAAGG - Intronic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1146866691 17:36342267-36342289 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1147069559 17:37942876-37942898 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147081089 17:38022414-38022436 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147097031 17:38146371-38146393 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1148220383 17:45857521-45857543 CCTGATTCAAAAAAGGACAAAGG - Intergenic
1148766491 17:50042097-50042119 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1149179100 17:53912729-53912751 CTTGGTTCACAAATGGACAATGG + Intergenic
1149502956 17:57168980-57169002 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1149663423 17:58348903-58348925 CTGAAGTCAAAAATGAGCAAAGG + Intronic
1149889850 17:60378115-60378137 CTCAATTCAAAAATGGGCAAAGG + Intronic
1149999178 17:61422129-61422151 CTCAATTACAAAATGGGCAAAGG + Intergenic
1150012712 17:61520728-61520750 CTCAATTTAAAAATGGGAAAAGG - Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150037948 17:61824912-61824934 TCCAATTCCAAAATGGACAAAGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1150894089 17:69189351-69189373 CCCCATTAAAAAATGGACAAAGG - Intronic
1150949147 17:69782829-69782851 ATGAAAACAAAAATAGACAATGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1152226913 17:79097006-79097028 CTGACCTCAAGAGTGGACAACGG + Intronic
1152384584 17:79963901-79963923 CCCAATTCAAAAATGGTCAAAGG - Intronic
1152449343 17:80366556-80366578 CCCAATTCAAAAATGGGCAAAGG - Intronic
1152493360 17:80653055-80653077 CCCAACTAAAAAATGGACAAAGG - Intronic
1152582915 17:81176101-81176123 TTCAATTCAAAAATGGGCAAAGG + Intergenic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1153206581 18:2709738-2709760 CAAAATTTAAAAATGGCCAAAGG - Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153605190 18:6826299-6826321 CTCCATTAAAAAATGGGCAAAGG - Intronic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153785831 18:8534401-8534423 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1153815332 18:8785812-8785834 AAGAAAACAAAAATGGACAAGGG - Intronic
1153853397 18:9119110-9119132 CAGAATTTAAAAATTTACAAAGG - Intronic
1153883327 18:9439487-9439509 CCCAATTTAAAAATGGTCAAAGG + Intergenic
1153887883 18:9483338-9483360 TACAATTCAAAAATGGACAAAGG - Intronic
1154137557 18:11793621-11793643 AATAATTTAAAAATGGACAAAGG + Intronic
1154282757 18:13020896-13020918 CTCAATTAAAAAGTGGGCAAAGG - Intronic
1154393771 18:13968491-13968513 CCTAATTAAAAAATGGGCAAGGG + Intergenic
1154401906 18:14046895-14046917 CCCCATTCAAAAATGGGCAAAGG - Intergenic
1154462023 18:14600616-14600638 CTGACTTCAAAATTTGAAAAGGG + Intergenic
1154968001 18:21378843-21378865 ATTAATTTAAAAATGGGCAATGG - Intronic
1155260305 18:24035599-24035621 CCCAATTAAAAAATGGGCAAAGG - Intronic
1155265766 18:24091785-24091807 GCCAATTTAAAAATGGACAATGG + Intronic
1155351272 18:24909654-24909676 CTCTATTCACAACTGGACAATGG + Intergenic
1155413827 18:25574587-25574609 CCCAATTCAAAAATGGGCAAAGG - Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155721005 18:29012135-29012157 CTTATTTCAAAAATGGAAATTGG - Intergenic
1155859418 18:30878183-30878205 CTGAATTAAGATAAGGACAAAGG + Intergenic
1156560012 18:38114071-38114093 CTTAAATACAAAATGGACAAAGG + Intergenic
1156746687 18:40400737-40400759 CCCAATTCAAAAATGAGCAAAGG + Intergenic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157320949 18:46633788-46633810 CTTAATTTAAAAATGGATGAAGG + Intronic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1157917724 18:51684305-51684327 TTCAATTAAAAAGTGGACAAAGG + Intergenic
1158038854 18:53068828-53068850 CTGATTGCAAAAATGGGAAATGG + Intronic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158203989 18:54970676-54970698 ATCATTTCAAAAATGGAGAAAGG + Intergenic
1158290721 18:55938932-55938954 CAGGAATGAAAAATGGACAAGGG + Intergenic
1158298289 18:56023657-56023679 TCCAATTAAAAAATGGACAAAGG - Intergenic
1158438357 18:57450957-57450979 GTAAAGTCAAAAAGGGACAAGGG - Intronic
1158438693 18:57454093-57454115 ATGAATTCAAAAATGTTCAAAGG - Intronic
1158738043 18:60106290-60106312 CCCCATTAAAAAATGGACAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158895268 18:61906951-61906973 AACAATTCAAAAATGGGCAAAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159123975 18:64201628-64201650 GTGAATTAAAAAGTGAACAATGG + Intergenic
1159179819 18:64888179-64888201 CTTAATTCAAGAATGCACTAAGG - Intergenic
1159401555 18:67943169-67943191 CTGAAGTCAAAAACTGGCAAAGG - Intergenic
1159416672 18:68158679-68158701 CTGATGCCAAAAATAGACAAGGG - Intergenic
1159573112 18:70143181-70143203 CTCCATTAAAAAGTGGACAAAGG - Intronic
1159578941 18:70213101-70213123 CTCAATTTTAAAATGGGCAAAGG + Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159753254 18:72328986-72329008 ATGAATTCATAAAAGGAAAATGG + Intergenic
1160077099 18:75688280-75688302 CTTAATACAAAAATTGACAGTGG + Intergenic
1160114917 18:76069126-76069148 TTGATTTCAAAGATGGGCAAAGG - Intergenic
1160197511 18:76768421-76768443 CTCAACTAAAAAATGGGCAAAGG - Intergenic
1160611744 18:80093804-80093826 CCCAATTTAAAAATGGGCAAAGG + Intronic
1160628763 18:80230979-80231001 CTGAATTCAAAAAGGGAATTTGG + Intronic
1160913264 19:1484515-1484537 CTGAATTCAAAAAGTACCAAGGG + Intronic
1161775165 19:6257497-6257519 CCTAATTCAAAAATGGACAACGG + Intronic
1163098828 19:15081184-15081206 CTGCATTCCAACCTGGACAACGG - Intergenic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1163537742 19:17887106-17887128 CCCAATTTAAAAATGGGCAAAGG - Intronic
1163732469 19:18957466-18957488 CTGAACTCAAGAATGTACACTGG - Intergenic
1164150894 19:22550097-22550119 CCCAATTCAAAAATGAGCAAAGG + Intergenic
1164765938 19:30769745-30769767 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1164954515 19:32370554-32370576 CTCGATTAAAAAATGGGCAAAGG - Intronic
1164956907 19:32394128-32394150 CCCAATTCAAAAACGGGCAAAGG + Intergenic
1165083104 19:33322448-33322470 CCCAATTAAAAAGTGGACAAAGG + Intergenic
1165173205 19:33907430-33907452 CAGACTTAAAAAATGGACCAAGG - Intergenic
1165249774 19:34520581-34520603 CTGAATTCCAAAAGGGAGATGGG + Intergenic
1165477803 19:36041617-36041639 CCTGATTCAAAAATGGGCAAAGG + Intronic
1166023254 19:40053233-40053255 CCCAATTAAAAAATGGGCAAAGG + Intronic
1166265473 19:41681087-41681109 CCCAATTTAAAAATGGGCAAAGG + Intronic
1166272459 19:41723485-41723507 CCCAATTAATAAATGGACAAAGG - Intronic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1166419313 19:42623849-42623871 CCCGATTAAAAAATGGACAAAGG + Intronic
1166430938 19:42727427-42727449 CCCAATTAAAAAATGAACAAAGG + Intronic
1166443951 19:42842763-42842785 CCCAATTAAAAAATGAACAAAGG + Intronic
1166456699 19:42947534-42947556 CCCAATTAAAAAATGGACAAAGG + Intronic
1166463633 19:43013427-43013449 CCCAATTAAAAAATGAACAAAGG + Intronic
1166466656 19:43038400-43038422 CCCAATTAAAAAATGGACAAAGG + Intronic
1166480916 19:43173521-43173543 CCCAATTAAAAAATGAACAAAGG + Intronic
1166490490 19:43256507-43256529 CCCAATTAAAAAATGAACAAAGG + Intronic
1166493563 19:43281457-43281479 CCCAATTAAAAAATGGACAAAGG + Intergenic
1167042516 19:47030940-47030962 GACAATTCAAAAATGGGCAAAGG - Intronic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1167400604 19:49265820-49265842 CCTAATTAAAAAGTGGACAAAGG + Intergenic
1167704764 19:51074689-51074711 CCCAATTAAAAAATGGACAAAGG + Intergenic
1168479727 19:56709561-56709583 CCCAATGAAAAAATGGACAAAGG - Intergenic
925788845 2:7461674-7461696 CTCCATTAAAAAGTGGACAAAGG + Intergenic
925915576 2:8602680-8602702 TCCAATTCAAAAATGGGCAAAGG + Intergenic
926528788 2:14015528-14015550 CCCAATTTAAAAATGGGCAAAGG - Intergenic
926569361 2:14512465-14512487 GTGAATTCATAAATGTAAAATGG - Intergenic
926805138 2:16702069-16702091 GTGCATTTAAAAATGCACAATGG + Intergenic
926956045 2:18301499-18301521 GTGAAGTCAAACATGGACACCGG - Intronic
927070267 2:19521500-19521522 CCCCATTAAAAAATGGACAAAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927228903 2:20800414-20800436 CACAATTGAAAAATGGGCAAGGG + Intronic
927359185 2:22211944-22211966 CTGATTTTAAAAATAGGCAAAGG - Intergenic
927473964 2:23397778-23397800 CTCCATTAAAAAATGGGCAAAGG + Intronic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
927906970 2:26865611-26865633 ATGCATTTAAAAATGGACACAGG - Intronic
927920403 2:26967919-26967941 TCCGATTCAAAAATGGACAAAGG + Intergenic
928454749 2:31409569-31409591 CCCAATTCAAAAATGGGCAAAGG + Intronic
928627252 2:33152765-33152787 ACCAATTCAAAATTGGACAAAGG - Intronic
928870055 2:35965217-35965239 CTGAATTAAAAAGAGGAGAAAGG + Intergenic
928913286 2:36444557-36444579 CAGCATTCAAAAATGAAGAATGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929181202 2:39041380-39041402 CCCAATTTAAAAATGGGCAAAGG - Intronic
929186799 2:39103976-39103998 CCAAATTAAAAAATGGGCAATGG + Intronic
929211562 2:39363364-39363386 CTGGATTCAAAAACGAGCAAAGG + Intronic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929389257 2:41449834-41449856 CTTTATTAAAAAGTGGACAAAGG + Intergenic
929496843 2:42452066-42452088 CCCAACTAAAAAATGGACAAAGG + Intronic
929998432 2:46844831-46844853 CCTAATTCAAAAATGGGCAAAGG - Intronic
930138756 2:47930240-47930262 CTCAATTTAAAAATAGGCAAAGG + Intergenic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
930588251 2:53296065-53296087 ACGAAAGCAAAAATGGACAAAGG + Intergenic
930589430 2:53309722-53309744 CCCAATTAAAAAATGGACAAAGG + Intergenic
930993775 2:57691416-57691438 CTCCATTCAAAAGTGGGCAAAGG + Intergenic
931136502 2:59408163-59408185 AAGATTTTAAAAATGGACAAGGG + Intergenic
931519105 2:63075581-63075603 CTGACTTTTAAAATGGACACAGG - Intergenic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
932035023 2:68236009-68236031 CTCAATTTAAAAGTGGGCAAAGG - Intronic
932085978 2:68761554-68761576 CTCAGTTCAAAAATGGGCAAAGG + Intronic
932179721 2:69635116-69635138 CCCAATTCAAAAATGGGCAAAGG + Intronic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932671466 2:73741112-73741134 CTGCACTCCAACATGGACAATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933525137 2:83427898-83427920 CTGATTTTAAAAATGAGCAAAGG + Intergenic
933537933 2:83600770-83600792 CTGATATCAAAGCTGGACAAGGG + Intergenic
933807103 2:86007261-86007283 CCCAATTAAAAAATGGGCAAAGG + Intergenic
933819995 2:86102446-86102468 TTCAATTTTAAAATGGACAAAGG - Intronic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
934522474 2:95027895-95027917 CCCAATTAGAAAATGGACAATGG + Intronic
934664498 2:96160207-96160229 CCCATTTAAAAAATGGACAAAGG + Intergenic
935009870 2:99124290-99124312 TCTAATTCAAAAATGGGCAAAGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935258805 2:101336757-101336779 GTGAATTTTAAAATGTACAAGGG - Intergenic
935800807 2:106693677-106693699 CTCTATTTAAAAATGGTCAAAGG - Intergenic
936273940 2:111075434-111075456 CTGAAATCAAAAATGAAAGAAGG - Intronic
936386719 2:112036798-112036820 CTCAATTTAAAAATAGGCAAAGG + Intergenic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
936485601 2:112922900-112922922 CAGAATTCAAAAATTTACAAGGG + Intergenic
936705553 2:115068395-115068417 CCTAATTAAAAAATGGGCAAAGG - Intronic
936901620 2:117487528-117487550 CCTAATTAAAAAATGGGCAAAGG - Intergenic
937184436 2:120026876-120026898 CCCAATTTAAAAATGGGCAAAGG + Intronic
937614012 2:123898107-123898129 TTCAATTAAAAAATGGGCAAAGG - Intergenic
937752727 2:125497340-125497362 TCCAATTCAAAAATGGAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937899629 2:127008839-127008861 CCCAGTTCAAAAATGGGCAAAGG - Intergenic
937932242 2:127215878-127215900 CCCAATTAAAAACTGGACAAAGG + Intronic
938148139 2:128855329-128855351 CCCAATTTAAAAATGGGCAAAGG - Intergenic
938166375 2:129030694-129030716 CCCAATTTAAAAATGGGCAAAGG + Intergenic
938259745 2:129887073-129887095 CTGAATTCCAAAATGGATGAGGG + Intergenic
938844313 2:135193194-135193216 TTCAATTCAAAAATGGGCATAGG + Intronic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
938955814 2:136297135-136297157 CTGATTTTTAAAATGGGCAAAGG - Intergenic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938985772 2:136574364-136574386 AACAATTCAAAAATGGGCAAAGG - Intergenic
939093793 2:137809191-137809213 CTCCATTAAAAAATGGGCAAAGG - Intergenic
939149088 2:138451920-138451942 CTCTATTTAAAAATGGGCAAAGG - Intergenic
939212040 2:139188086-139188108 TCCAATTTAAAAATGGACAAAGG - Intergenic
939297158 2:140282105-140282127 CTCAGTTCAAAGATGGCCAAAGG - Intronic
939395672 2:141626625-141626647 CCTGATTCAAAAATGGGCAAAGG + Intronic
939747831 2:145999495-145999517 CTCCATTAAAAAGTGGACAAAGG + Intergenic
939809723 2:146815928-146815950 CCCAATTTAAAAATGAACAAAGG - Intergenic
939983001 2:148803263-148803285 CCCAATTGAAAAATGGGCAAAGG - Intergenic
940103287 2:150067747-150067769 CCCAATTTAAAAATGAACAAAGG - Intergenic
940137233 2:150451771-150451793 ACCAATTCAAAAATGGGCAAAGG - Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940304463 2:152211038-152211060 TCCAATTTAAAAATGGACAAAGG - Intergenic
940665481 2:156603400-156603422 CCCAATTTAAAAATGGGCAAAGG - Intronic
940803919 2:158163769-158163791 TCCAATTCAAAAATGGGCAAAGG + Intergenic
940977613 2:159963557-159963579 TCCAATTTAAAAATGGACAAAGG + Intronic
940981516 2:160008867-160008889 CCCAATTAAAAAATGGACAAAGG + Intronic
941059431 2:160828365-160828387 CTAAAGTCAGAAGTGGACAAGGG - Intergenic
941118290 2:161497555-161497577 CTCAATTACAAAATGGGCAAAGG - Intronic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941390020 2:164900623-164900645 CTTGATTAAAAAATGGGCAAAGG - Intronic
941743171 2:169058121-169058143 CTCCATTAAAAAGTGGACAAAGG + Intergenic
941779508 2:169428733-169428755 CCAAATTTAAAAATGGGCAAAGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942055360 2:172177276-172177298 CCTAATTTAAAAATGGGCAAAGG - Intergenic
942190898 2:173469307-173469329 CTCAATTAAAAAATGGGTAAAGG - Intergenic
942217332 2:173734273-173734295 CCTAACTAAAAAATGGACAAAGG - Intergenic
942402505 2:175618059-175618081 CCAATTTTAAAAATGGACAAAGG - Intergenic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
942618790 2:177825129-177825151 TTGAAGGCAAAAATGGTCAAGGG + Intronic
942643023 2:178079969-178079991 CCCCATTAAAAAATGGACAAAGG - Intronic
942674178 2:178410271-178410293 CTTTATTTAAAAATGGGCAAAGG + Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943006070 2:182389420-182389442 CCCAATTAAAAAATGGACAAAGG + Intronic
943087767 2:183333764-183333786 CTCAATTAAAAGATGGGCAAAGG - Intergenic
943230111 2:185239533-185239555 CTAAATTCAAGAATAGACAAAGG + Intergenic
943653949 2:190487570-190487592 CCCAATTAAAAAATGGGCAAAGG + Intronic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943715675 2:191150209-191150231 CTGAATTCAAAGCTGAAAAAAGG + Intronic
943956864 2:194202813-194202835 ATCCATTAAAAAATGGACAATGG - Intergenic
944158188 2:196631308-196631330 CCCAATTTAAAAATGGGCAAAGG + Intergenic
944335105 2:198523615-198523637 CTGAATTGAAAAATGAAATATGG - Intronic
944390505 2:199213830-199213852 CCCAATTTAAAAATGGGCAAAGG + Intergenic
944588826 2:201198175-201198197 CCGAATTAGAAAATGAACAAAGG - Intronic
944727157 2:202483179-202483201 CCCAATTAAAAAATGGGCAAAGG - Intronic
944748773 2:202686088-202686110 ATCAGTTAAAAAATGGACAATGG + Intronic
944888657 2:204092646-204092668 TTCAATTAAAAAATGGGCAATGG - Intergenic
945215251 2:207426879-207426901 CCCAATTTAAAAATGGGCAAAGG + Intergenic
945324508 2:208466687-208466709 CCCAATTTAAAAATGGGCAAAGG - Intronic
945379786 2:209126753-209126775 CTGATTTTAAAAATGGGTAAAGG - Intergenic
945404671 2:209430606-209430628 TTGATTTCAATAATGAACAATGG - Intronic
945462655 2:210127929-210127951 CCCAATTCAAAAATGGGCAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
945744752 2:213706615-213706637 CTGAAATCAAAATTGGATCACGG + Intronic
945819342 2:214644606-214644628 CTCAATTGAAAAATGGGCAAAGG - Intergenic
946135053 2:217639087-217639109 CTTGATTAAAAAATGGGCAAAGG + Intronic
946390571 2:219413920-219413942 CCCAATTCAAAAATGGGCAAAGG + Intergenic
946490127 2:220140669-220140691 CTCAGTTAAAAAATGGGCAAAGG - Intergenic
946512043 2:220368481-220368503 CTGATTTTTAAAATGGGCAAAGG + Intergenic
946574497 2:221059529-221059551 CTCAATTAAAAACTGGGCAAAGG - Intergenic
946636918 2:221739558-221739580 ATAATTTTAAAAATGGACAAAGG + Intergenic
946924212 2:224610463-224610485 GCCAATTCAAAAATGGGCAAAGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947311133 2:228803747-228803769 CTCAAGTTAAAAATGGGCAAAGG - Intergenic
947468397 2:230375720-230375742 CCTAATTTAAAAATGGGCAAAGG - Intronic
947491583 2:230600325-230600347 CCCAATTGAAAAATGGGCAAAGG + Intergenic
947607541 2:231498209-231498231 CCCAATTAAAAAATGGGCAAAGG - Intergenic
948225668 2:236307543-236307565 ATTAAATCAAAAATGGGCAATGG - Intergenic
948416014 2:237804609-237804631 CTTTATTAAAAAATGGGCAAAGG - Intronic
948769387 2:240241205-240241227 CCCAATTTAAAAATGGGCAAAGG - Intergenic
948934916 2:241157570-241157592 CTGAATTCAGATATTGGCAAAGG - Intronic
1168867490 20:1100353-1100375 CCCAATTTAAAAATGGACCAAGG - Intergenic
1169334541 20:4744916-4744938 CTGATTTTAAAAATTGGCAAAGG + Intergenic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1169857747 20:10122360-10122382 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
1170190094 20:13637066-13637088 TTCAATTTAAAAATGGGCAAAGG + Intronic
1170262059 20:14420542-14420564 CTCAATTCAAAAATGGGGAAAGG - Intronic
1170504219 20:17008200-17008222 CCCAATTAAAAAATGGTCAAAGG - Intergenic
1170619564 20:17983767-17983789 CTTGATTAAAAAATGGGCAAAGG - Intronic
1170631426 20:18069839-18069861 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171378346 20:24711477-24711499 CTCATTTTAAAAATGGGCAAAGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171723602 20:28593420-28593442 CACAATTCAAAACTGGGCAAAGG + Intergenic
1171754450 20:29089643-29089665 CACAATTCAAAACTGGGCAAAGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171788212 20:29492953-29492975 CACAATTCAAAACTGGGCAAAGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172423651 20:34838938-34838960 CTCAATTAAAATATGGGCAAAGG - Intergenic
1172866028 20:38098129-38098151 CTCAATTCAAAAATGGGCAGAGG - Intronic
1172916806 20:38449372-38449394 CTGCATTCAAAAATGATCACGGG + Intergenic
1172974765 20:38897923-38897945 CCCAGTTCAAACATGGACAAAGG - Intronic
1173015062 20:39217684-39217706 ATAAATTTAAAAATGGATAAAGG - Intergenic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173778685 20:45735587-45735609 CCCATTTAAAAAATGGACAAGGG + Intergenic
1174345338 20:49925026-49925048 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1174400040 20:50271047-50271069 CTGAATACAAAAAAGATCAAGGG + Intergenic
1174510654 20:51049567-51049589 CTGGTTTAAATAATGGACAAAGG + Intergenic
1174811835 20:53652304-53652326 CTTAATTCAACAAGGGACATGGG - Intergenic
1175430730 20:58901210-58901232 CTGAATTCAAAAGTGAACATTGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175751766 20:61503351-61503373 ATGCTTTCAAAAAAGGACAAGGG + Intronic
1176153355 20:63604947-63604969 CTGAATTCAGAAATGGCAGAGGG + Intronic
1176363025 21:6014444-6014466 CCCAACTCAAAAATGGGCAAAGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1176725907 21:10432315-10432337 CTCAATTTCAAAATGGGCAAAGG - Intergenic
1176740900 21:10600996-10601018 CTGAATTTAAAAAATAACAACGG - Intronic
1176812535 21:13558017-13558039 CTGACTTCAAAACTTGAAAAGGG - Intergenic
1176898365 21:14410514-14410536 CTCCATTGAAAAATGGGCAAAGG - Intergenic
1176931083 21:14811006-14811028 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1177291285 21:19116200-19116222 CAAAATTCAGAAATGGGCAAAGG - Intergenic
1177300219 21:19234454-19234476 CACAATTAAAAAATGGGCAAAGG - Intergenic
1177338639 21:19767511-19767533 ATAAAATAAAAAATGGACAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177680113 21:24356745-24356767 CTTCATTAAAAAATGGGCAAAGG - Intergenic
1177841774 21:26242455-26242477 CCTGATTTAAAAATGGACAAAGG - Intergenic
1178004339 21:28199672-28199694 CCCCATTAAAAAATGGACAAAGG + Intergenic
1178018731 21:28384073-28384095 CTGAATACAAAAGAGGAGAAGGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178227479 21:30739766-30739788 CTCAATGGAAAAATGGGCAAAGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178971185 21:37178620-37178642 CTCAATTCAAAAATGAATAAAGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179066927 21:38033738-38033760 CTAATTTTAAAAATGGGCAAAGG - Intronic
1179085165 21:38209899-38209921 CAAAATTTAAATATGGACAATGG + Intronic
1179120181 21:38537494-38537516 CCCAATTTAAAAATGGGCAAAGG + Intronic
1179130217 21:38629462-38629484 CCCAACTCAAAAATGGGCAAAGG + Intronic
1179519954 21:41936268-41936290 CCCAATTAAAAAATGGGCAAAGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179676179 21:42984027-42984049 CCCAATTCAAAAAGGGGCAAAGG - Intronic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1179760493 21:43524101-43524123 CCCAACTCAAAAATGGGCAAAGG + Intergenic
1179900149 21:44387712-44387734 CACAATTCAAAAATGGGCAAAGG + Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180297165 22:10952103-10952125 CACAATTCAAAACTGGGCAAAGG + Intergenic
1180910400 22:19446150-19446172 CAGAATGGAAAAATGGCCAAAGG - Intronic
1180939986 22:19654401-19654423 CACAATTTAAAAATGTACAAAGG + Intergenic
1181101114 22:20539894-20539916 CCCAATTTAAAAATGGACAGAGG - Intronic
1181292087 22:21803430-21803452 CTAGTTTAAAAAATGGACAAAGG - Intronic
1181329946 22:22082499-22082521 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1181424672 22:22826486-22826508 CTGAATTCCAAAAAGGAAAAGGG - Intronic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182537567 22:31016606-31016628 CTGAATTAAAGAATGGGGAAAGG - Intergenic
1182937375 22:34238034-34238056 CCCCATTAAAAAATGGACAAAGG + Intergenic
1183155069 22:36068539-36068561 ATCAATTTAAAAATGGGCAAAGG + Intergenic
1183402505 22:37612942-37612964 CTGAATCCAGAAATGGATAGTGG - Intronic
1183480707 22:38063433-38063455 CCTAATTCAAAAATAGACCAAGG - Intronic
1183611472 22:38909829-38909851 CCTAATTTAAAAATGGGCAAAGG - Intergenic
1183790363 22:40062783-40062805 CCCAATTTAAAAATGGGCAAAGG - Intronic
1184026376 22:41860266-41860288 CTGATAGCAAAAATGGACGAAGG + Intronic
1184318727 22:43722062-43722084 CCCCATTAAAAAATGGACAAAGG + Intronic
1184623141 22:45698435-45698457 CCCAATTGAAAACTGGACAAAGG - Intronic
1184704937 22:46204683-46204705 CTCAATTAAAAAATGAGCAAAGG - Intronic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
1185363836 22:50425848-50425870 CTCAATTCAAAAATGGTCAAAGG - Intronic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949150135 3:757113-757135 GTAAATTCAAAAATAGAAAAAGG - Intergenic
949345863 3:3075980-3076002 CTGAATGCTAAAATGGGTAAGGG + Intronic
949461784 3:4302550-4302572 CTGAATTCCAAAAGGAAGAAGGG + Intronic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949898261 3:8787007-8787029 CCCAATTAAAAAATGGGCAAAGG - Intronic
949921343 3:9005109-9005131 CCAAATTTAAAAATGGGCAAAGG + Intronic
950059391 3:10057155-10057177 CCTAATTTAAAAATGGGCAAAGG - Intronic
950145161 3:10644093-10644115 CCCAATTTAAAAATGGGCAAAGG + Intronic
950326406 3:12114271-12114293 CAGAATTAAAAATTGGGCAAAGG - Intronic
950519578 3:13489080-13489102 CCAATTTTAAAAATGGACAAAGG - Intronic
951069903 3:18315380-18315402 ATCAATCAAAAAATGGACAAAGG - Intronic
951703220 3:25517311-25517333 CTCAATTTTAAAATGGGCAATGG + Intronic
951936339 3:28026884-28026906 CTCAATTTAAAAATGGGTAAAGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
951988920 3:28653715-28653737 CCCAATTTAAAAATGGGCAAAGG - Intergenic
952037186 3:29216842-29216864 CTAGATTCAAAGATGGCCAAAGG - Intergenic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952240384 3:31526416-31526438 TTGATTTCAAAAAGGGCCAAAGG - Intergenic
952310450 3:32184368-32184390 CTCAATTAAAAAACTGACAAAGG + Intergenic
952363066 3:32650375-32650397 CCCAATTTAAAAATTGACAAAGG - Intergenic
953037133 3:39222501-39222523 CCCAATTAAAAAATGGGCAAAGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953204240 3:40807673-40807695 CCCAATTTAAAAAGGGACAAAGG - Intergenic
953324488 3:42001424-42001446 CTGCATTGAAAAATGGACTGAGG + Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
953423888 3:42776860-42776882 CCCAATTCAAAAATGGGCAAAGG + Intronic
953502654 3:43453005-43453027 CCCAATTAAAAAATGGGCAAAGG - Intronic
953602625 3:44382903-44382925 CCCATTTCAAAAATGGGCAAAGG + Intronic
953833122 3:46319397-46319419 CTGGATTAAAAAATGAGCAAAGG - Intergenic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
954311099 3:49767887-49767909 CCCAATTCATAAATGGGCAAAGG + Intronic
954376881 3:50199409-50199431 CTCAATTCAAAAATGGGCAAAGG - Intergenic
954471382 3:50698826-50698848 CCCAATTCAAAAATGGGCAAAGG - Intronic
954643086 3:52113969-52113991 ATGAAATGAAAAATGCACAAAGG + Intronic
954728134 3:52633831-52633853 CCCAATTCAGAAATGGGCAAAGG - Intronic
954741677 3:52756918-52756940 CCCAACTCAAAAATGGGCAAAGG + Intronic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
954932059 3:54292491-54292513 CACAATTTAAAAATGAACAAAGG + Intronic
954988875 3:54820702-54820724 CTGAATTCAACAATGAAGAGAGG + Intronic
955293064 3:57710757-57710779 CCCAATTCAAAAATGGGCAAAGG + Intergenic
955304071 3:57811897-57811919 CCCAATTCAAAAATGGGCAAAGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955593488 3:60562832-60562854 ATGAATTCCAAAATAAACAAAGG - Intronic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956105703 3:65815939-65815961 CAGAATTCAAAGGAGGACAAAGG + Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956393213 3:68796803-68796825 CCCAATTTAAAAATGGCCAAAGG + Intronic
956514399 3:70030708-70030730 TCCAATTCAAAAATGGGCAAAGG + Intergenic
956677238 3:71747449-71747471 CCAATTTTAAAAATGGACAAAGG - Intronic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
956966646 3:74469518-74469540 CCCAATTTAAAAATGGGCAAAGG + Intronic
957605520 3:82393712-82393734 CTTAATTTAAAAATGGGAAAAGG - Intergenic
957655888 3:83074860-83074882 CCCAATTAAAAAATGGGCAAAGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
957993800 3:87662103-87662125 CACAATTTAAAAATGGGCAAAGG + Intergenic
957995676 3:87687075-87687097 TCTAATTCAAAAATGGGCAAAGG + Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958263100 3:91405308-91405330 CCCAATTCAAAAATAGACAAAGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958559715 3:95730259-95730281 CCCAATTGAAAAATGGGCAAAGG - Intergenic
958703483 3:97622925-97622947 CCTGATTCAAAAATGGAAAATGG - Intronic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959694055 3:109230957-109230979 TCTAATTCAAAAATAGACAAAGG + Intergenic
959839486 3:110958212-110958234 CTGAAGTGAAAACTGTACAAAGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
959987281 3:112588559-112588581 CCAGATTCAAAAGTGGACAAAGG - Intergenic
960059243 3:113302902-113302924 TAGAAATCAAAAATGGACAAAGG + Intronic
960479006 3:118165110-118165132 CCAACTTAAAAAATGGACAAAGG + Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960597984 3:119424152-119424174 CTGAATTAAAAAATAGGCAAGGG - Intergenic
960633837 3:119763136-119763158 CCCAATTAAAAAATGGGCAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961366055 3:126400191-126400213 CCCAATTCAAAACTGGGCAAAGG + Intronic
961408526 3:126701092-126701114 CCCAATTTAAAAATGGGCAAAGG - Intergenic
961468334 3:127095344-127095366 AGCAATTCAAAAATGGGCAAGGG - Intergenic
961587341 3:127943515-127943537 CCTAATTAAAAAATGGGCAAGGG - Intronic
961700012 3:128736318-128736340 CTGAATGATAAAATGTACAAAGG - Intronic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962047884 3:131779998-131780020 CTGCATTAAAAAATGGGCAAAGG + Intronic
962275124 3:134007148-134007170 CCGAATTTAAAAATTGGCAAAGG - Intronic
962346380 3:134621881-134621903 CCCAATTCAAAAAGGGGCAAAGG + Intronic
962819180 3:139030880-139030902 CCCAACTAAAAAATGGACAAAGG - Intronic
962912628 3:139867753-139867775 CACAATTTAAAAATGGGCAAAGG + Intergenic
963007910 3:140743170-140743192 CTGATTTTAAGAAGGGACAAAGG + Intergenic
963144889 3:141983333-141983355 CTCAATTCAAAAATGGGCAAAGG + Intronic
963172327 3:142263502-142263524 CCTAATTTAAAAATAGACAAAGG - Intergenic
963242638 3:143023300-143023322 CTGGATACAACACTGGACAAAGG - Intronic
963272216 3:143296852-143296874 CCCAATTTAAAAATGGGCAAAGG - Intronic
963333349 3:143941808-143941830 TCCAATTAAAAAATGGACAAAGG + Intergenic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963389809 3:144646663-144646685 CTCAATTTAAAAATGAGCAAAGG - Intergenic
963621843 3:147619105-147619127 CTGAGTTTCAAAATTGACAAGGG + Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
963805735 3:149719942-149719964 CTCAATTCAAAAATGGGTGAAGG - Intronic
963812473 3:149792202-149792224 GTGCATTTAAAAATGTACAAAGG - Intronic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
963861969 3:150321291-150321313 CTTCATTGAAAAATGGGCAAAGG - Intergenic
963913394 3:150834943-150834965 CTCCATTAAAAAATGGGCAAAGG - Intergenic
964554377 3:157919621-157919643 CTAGATTCAAAAATGCATAATGG - Intergenic
964742465 3:159981726-159981748 TTCAATTCAAAACTGGGCAAAGG - Intergenic
964785152 3:160388353-160388375 CTGATATCAAAACTGGACAGGGG + Intronic
964903020 3:161682768-161682790 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
965032275 3:163387407-163387429 CTGATTTAAAAAATAGTCAAAGG + Intergenic
965049763 3:163630700-163630722 CTCCATTACAAAATGGACAATGG - Intergenic
965224757 3:165973658-165973680 CTTCATTAAAAAGTGGACAAGGG + Intergenic
965251184 3:166346573-166346595 CTGAAACCAAAACTAGACAAAGG + Intergenic
965268579 3:166582526-166582548 CTCCATCAAAAAATGGACAAAGG - Intergenic
965430915 3:168587318-168587340 CTTCATTAAAAAATGGGCAAGGG - Intergenic
965655818 3:170983564-170983586 CCCGATTTAAAAATGGACAAAGG - Intergenic
965676024 3:171197572-171197594 CCCAATTTAAAAATGGGCAAAGG + Intronic
965894333 3:173555781-173555803 CTGATATCAAAACTTGACAAGGG - Intronic
966160306 3:176960598-176960620 CTTAATTCAAAAATGGAATTTGG - Intergenic
966178186 3:177162344-177162366 CTGACTGGAAGAATGGACAAGGG + Intronic
966467290 3:180244626-180244648 CTGATTTTTAAAATGGGCAAAGG - Intergenic
966553962 3:181237418-181237440 TAGAATTCAAAAATGAACAGTGG - Intergenic
966650115 3:182291178-182291200 ATGACTTCAAAAATGCAAAATGG - Intergenic
966833793 3:184033454-184033476 CCCAATTCAAAAATGGGCAAAGG + Intronic
966969923 3:185034463-185034485 CAGAATTAAAAAATGAGCAAAGG - Intronic
967141094 3:186561258-186561280 CCTAATTAAAAAATGGACTATGG + Intronic
967167381 3:186794020-186794042 CCCAATTAAAAAATGGGCAAAGG - Intronic
967172981 3:186838184-186838206 TTCAATTAGAAAATGGACAAAGG - Intergenic
967232019 3:187348240-187348262 CCCAATTTAAAAATGAACAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967704040 3:192629681-192629703 ATGAATACAAAAAAGTACAAAGG + Intronic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
968544029 4:1186693-1186715 CTCAATTTAAAAATGGGCAGAGG + Intronic
968773991 4:2528093-2528115 CCCAATTTGAAAATGGACAAAGG + Intronic
969128935 4:4976417-4976439 CACAATTCAAAAATGGGCAAAGG - Intergenic
969421622 4:7100919-7100941 CCCAATTTAAAAATGGGCAAAGG - Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970196560 4:13556749-13556771 CTAAATTCAAAAATGAGCAAAGG - Intergenic
970420311 4:15899620-15899642 CTGAATTAAGAAGTGGACACTGG - Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970564033 4:17313940-17313962 CTCAGTTAAAAAATGGGCAAAGG - Intergenic
970648754 4:18154482-18154504 CTCAATTAAGAAATGGGCAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971430390 4:26559483-26559505 CACAATTCAAAAACGGGCAAAGG - Intergenic
971533639 4:27720613-27720635 CTCATTTCAGAAATGAACAAAGG - Intergenic
971717618 4:30199758-30199780 CCCAATTTAAAAATAGACAAAGG - Intergenic
971749803 4:30632398-30632420 CCCTATTTAAAAATGGACAAAGG + Intergenic
971808017 4:31385567-31385589 ACCAATTCAAAAATGGGCAAAGG + Intergenic
971850820 4:31984644-31984666 CTGTATTCATAAATGTTCAAAGG - Intergenic
971993765 4:33936239-33936261 CTAAGTGCAAAAATGTACAAAGG + Intergenic
972005431 4:34097937-34097959 CCCAATTTAAAAATGGTCAAAGG + Intergenic
972030711 4:34454171-34454193 CTCCATTAAAAAGTGGACAAAGG + Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
972834154 4:42848562-42848584 CTTCATTTAAAAATGGACACAGG - Intergenic
973026403 4:45277590-45277612 ATGAGTTCAAAAATGTACAGTGG - Intergenic
973229417 4:47824754-47824776 TTGAATTCAAAAAACCACAAAGG + Intronic
973530123 4:51828947-51828969 CTCAATTTCAAAATGGGCAAAGG - Intergenic
973574249 4:52270155-52270177 CAGAATTCAAAATTGGAGTAAGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973881553 4:55277793-55277815 CCCAATTGAAAAATGGGCAAAGG - Intergenic
973922245 4:55699747-55699769 CCCAATTAAAAAATGGGCAAAGG + Intergenic
974067435 4:57092219-57092241 CTCAATTCAATTATGTACAAAGG + Intronic
974298051 4:60029858-60029880 CCTAATTCAAAAATGTACAAAGG - Intergenic
974623801 4:64396476-64396498 CCACATTTAAAAATGGACAAAGG - Intronic
974785436 4:66613864-66613886 CCCAATTAAAAAATGGGCAAAGG - Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
975350267 4:73338596-73338618 CCCAATTTAAAAATGGGCAAAGG - Intergenic
975478398 4:74849458-74849480 CTCCATTAAAAAGTGGACAAAGG - Intergenic
975538575 4:75478342-75478364 CTCAATTAAAACATGGGCAAAGG + Intergenic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
975608184 4:76177177-76177199 CTCAATTTTAAAATGGGCAAAGG + Intronic
976112072 4:81686269-81686291 CTGAGTTCCAAAAGGGAGAAAGG + Intronic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
976436657 4:85026178-85026200 CCTGATTAAAAAATGGACAAAGG - Intergenic
976443122 4:85099420-85099442 TTCAATTAGAAAATGGACAAAGG - Intergenic
976458056 4:85272988-85273010 CTTTATTTAAAAATGGGCAAAGG + Intergenic
976464965 4:85356686-85356708 CTCAATTTAAAAATGCAGAATGG - Intergenic
976851771 4:89555784-89555806 CTGGATTTTAAAATGGGCAAAGG - Intergenic
976904581 4:90220889-90220911 TTTATTTCAAAAATGGAGAAGGG - Intronic
976933423 4:90598633-90598655 TCCAATTAAAAAATGGACAAAGG - Intronic
977053202 4:92156297-92156319 CTTAATTTCAAAATAGACAAAGG + Intergenic
977137125 4:93319359-93319381 CTAAATTAAGAAATTGACAAGGG - Intronic
977432381 4:96946657-96946679 CCGCATTAAAAAGTGGACAAAGG + Intergenic
977453884 4:97233396-97233418 CCTAATTAAAAAATGGGCAAAGG + Intronic
977492796 4:97735861-97735883 CTCGATTTAAAAATGGGCAAAGG + Intronic
977585054 4:98765782-98765804 CTCAATTTTAAAATGGGCAAGGG - Intergenic
977721675 4:100246212-100246234 CTGAAATCAGAAATTGTCAAGGG + Intergenic
977780954 4:100980325-100980347 TTAAATTCCAAAAAGGACAAAGG - Intergenic
977798425 4:101196235-101196257 CTGAATTAAAATATGATCAAGGG + Intronic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978181676 4:105805073-105805095 CTAAATTCAATAATTGAAAAGGG + Intronic
978360084 4:107922076-107922098 CCTAATTCAAAAATGGGCAAAGG + Intergenic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
978796933 4:112717407-112717429 CTCAATTCCAAAATGAACTAAGG - Intergenic
978870489 4:113570963-113570985 CCTGATTAAAAAATGGACAAAGG + Intronic
979071314 4:116210819-116210841 CTAAATTCAACTATGGACATGGG + Intergenic
979219197 4:118201606-118201628 CTTCATTAAAAAATGGGCAAAGG - Intronic
979435787 4:120688304-120688326 CCCAATTGAAAAATGGACAAAGG - Intronic
979509942 4:121541115-121541137 CTGATTTTTAAAATGGACTAAGG + Intergenic
979590552 4:122474679-122474701 CCCAATTAAAAAATGGGCAAAGG - Intergenic
979632242 4:122916737-122916759 CAGAAAGCAAAACTGGACAAGGG - Intronic
979936561 4:126705000-126705022 CAGATTTTAAAAATGGGCAAAGG - Intergenic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
980699402 4:136404220-136404242 CAGACTTCAAAAATTGATAAGGG - Intergenic
980759783 4:137215950-137215972 CCCAATTAAAAAATGGGCAAAGG - Intergenic
980829893 4:138117925-138117947 CCCAATTTAAAAATGGGCAAGGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981272826 4:142864702-142864724 CTCTAATCAAAAATGGAAAATGG - Intergenic
981466567 4:145079195-145079217 CTCTATTAAAAAATGGGCAAAGG + Intronic
981572474 4:146167343-146167365 CTTTATTGAAAAATGGGCAAAGG - Intergenic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982152669 4:152478875-152478897 CCTAATTCAAAAATGGGTAAAGG - Intronic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
982681024 4:158430829-158430851 CTCAAATAAAAAATGGGCAAAGG + Intronic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983985743 4:174058905-174058927 CTCAATTTAAAAATAGGCAAAGG + Intergenic
984005900 4:174307776-174307798 CCTAATTAAAAAGTGGACAAAGG + Intronic
984062534 4:175008512-175008534 CCCAATTAAAAAATGCACAAAGG - Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
984838323 4:184043099-184043121 CCTGATTCAAAAATGGGCAAAGG - Intergenic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
984986711 4:185337993-185338015 CCCAATTTAAAAATGCACAAAGG - Intronic
985036374 4:185844274-185844296 CCCAATTCAAAAATGGGCAAAGG + Intronic
985437893 4:189950206-189950228 CACAATTCAAAACTGGGCAAAGG - Intronic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
985710559 5:1425832-1425854 CCCAATTCAAAAATGGGCAAAGG + Intronic
985793156 5:1942844-1942866 CCTGATTCAAAAATGGGCAAAGG - Intergenic
986122252 5:4851168-4851190 CCAATTTAAAAAATGGACAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986782566 5:11080141-11080163 CCTGATTAAAAAATGGACAAAGG + Intronic
986907082 5:12508081-12508103 CTCCATTAAAAAATGGGCAAAGG - Intergenic
986975624 5:13389840-13389862 CCTCATTTAAAAATGGACAAAGG + Intergenic
987184599 5:15403069-15403091 GAGAATTCAAAAATTTACAAAGG - Intergenic
987526978 5:19064324-19064346 CTGAATTCAAAATAAGAAAATGG - Intergenic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
987770184 5:22292581-22292603 CCCAATTCAAAATTGGACAAAGG + Intronic
987888423 5:23842644-23842666 TCCAATTTAAAAATGGACAAAGG + Intergenic
987927170 5:24357106-24357128 CTCAATGAAAAAATTGACAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988740587 5:34065210-34065232 CCCCATTTAAAAATGGACAAAGG + Intronic
988881672 5:35510091-35510113 CTTAATTAAAAAATGAGCAAAGG + Intergenic
988950197 5:36248703-36248725 CTGAATTGAAAAATGAAATAGGG + Intronic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989132497 5:38121755-38121777 CCCAATTAAAAAATGGACAAAGG - Intergenic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989403037 5:41029294-41029316 CCTGATTTAAAAATGGACAAAGG - Intronic
989446058 5:41530026-41530048 CTGATTTTAAAAATGAGCAAAGG + Intergenic
989548479 5:42702887-42702909 CCCAATTAAAAAATGGGCAAAGG - Intronic
989564045 5:42883802-42883824 CTGAATTCTAAAAGGGAAGAGGG - Intronic
989954399 5:50340443-50340465 CCCAATTTAAAAATGGATAAAGG + Intergenic
990180952 5:53160054-53160076 CTCAATTCAAAAATGGGCAAAGG + Intergenic
990215409 5:53526473-53526495 CTTCATTTAAAAATGGGCAAAGG - Intergenic
990257202 5:53983005-53983027 CTGCATCAAAAACTGGACAAAGG - Intronic
990567047 5:57040643-57040665 CCCAATTAAAAAATGGGCAAAGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990585340 5:57206065-57206087 CTCAATTTTAAAATGTACAAAGG - Intronic
990940279 5:61195717-61195739 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
991226576 5:64280149-64280171 CTCCATTAAAAAATGGGCAAAGG - Intronic
991259753 5:64653842-64653864 AGCAATGCAAAAATGGACAAAGG + Intergenic
991317284 5:65323044-65323066 CTGATACCAAAACTGGACAAAGG + Intronic
991425185 5:66483583-66483605 CTAAGTTAAAAAATGGGCAAGGG - Intergenic
991431853 5:66556218-66556240 CCCAATTTAAAAATGGTCAAAGG - Intergenic
991716832 5:69458883-69458905 CCCAATTCAAAAATAGACAAAGG - Intergenic
992065825 5:73107092-73107114 CTGATTCAAAAAATGGGCAATGG - Intergenic
992148049 5:73872308-73872330 ACCAATTCAAAAATGGTCAAAGG - Intronic
992283829 5:75211812-75211834 CTGAATTAAAAAATGAGTAAAGG - Intronic
992368549 5:76118457-76118479 CTCAATACAAAAATGGGAAAAGG + Intronic
992428703 5:76686131-76686153 CCTAATTTTAAAATGGACAAAGG - Intronic
992433141 5:76729328-76729350 CCTGATTTAAAAATGGACAAAGG - Intronic
992519120 5:77531324-77531346 CCCAATTTAAAAATGGGCAAAGG + Intronic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
992843288 5:80717800-80717822 CCAAATTTAAAAATGGGCAAAGG - Intronic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993147437 5:84113172-84113194 CTGAATACAAAAATAGAATACGG + Intronic
993166963 5:84368789-84368811 CTCGATTCAAAAATGGGCAAAGG + Intronic
993208492 5:84918240-84918262 TTCAATTAAAAAATGGGCAAAGG + Intergenic
993236819 5:85321416-85321438 CCCAATTAAAAGATGGACAAAGG + Intergenic
993237920 5:85338702-85338724 CTCAAATCAAAGATGCACAAAGG + Intergenic
993239498 5:85362847-85362869 CCCAATTAAAAAATGGGCAAGGG - Intergenic
993327021 5:86553143-86553165 CCCAATTAAAAAATGGGCAAAGG + Intergenic
993386841 5:87270744-87270766 CTTAAGTCAAAAATGGATTAGGG - Intronic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
993625387 5:90218415-90218437 CCTGATTCAAAAATGGACAAAGG + Intergenic
993837231 5:92830305-92830327 ATCAATTAAAAAGTGGACAAAGG - Intergenic
994031110 5:95144231-95144253 TTCAATTAAAAAATGGGCAAAGG - Intronic
994100658 5:95888594-95888616 CTGATTTGAAATATAGACAATGG + Exonic
994508568 5:100673535-100673557 CTGAGGTCAAAAATCGGCAAAGG + Intergenic
994577788 5:101602291-101602313 CACAATTACAAAATGGACAAGGG + Intergenic
994765035 5:103904697-103904719 CTCCATTAAAAAATGGGCAAAGG + Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994782135 5:104104052-104104074 CATAATTCAAAAATGGGCAAAGG - Intergenic
994946516 5:106400311-106400333 CTGTATTCCAAAATGGTAAAAGG + Intergenic
995167051 5:109055897-109055919 CTGTTTTTAAAAATGGGCAAAGG + Intronic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995261143 5:110105932-110105954 CTGCATTGAGAAATGGACCACGG - Intergenic
995293654 5:110491141-110491163 CCCAATTAAAAAGTGGACAAAGG + Intronic
995382988 5:111555685-111555707 CCCCATTCAAAAATGGGCAAAGG - Intergenic
995431111 5:112078767-112078789 ATGCATTCAAAAGTGGGCAAAGG - Intergenic
995482245 5:112604871-112604893 CTGAATTCAGAAATGGTGGAGGG + Intergenic
995553783 5:113306546-113306568 CCCAATTTAAAAATGGGCAAAGG - Intronic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995594347 5:113731725-113731747 CTGAATTCTAAAAGGGAGAAGGG + Intergenic
995607937 5:113878395-113878417 CCCCATTCAAAAATGGGCAAAGG - Intergenic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995816203 5:116171146-116171168 CTGCATCAAAAAATGGGCAAAGG + Intronic
996166166 5:120226553-120226575 TTAAATTGAAAAATGTACAATGG - Intergenic
996208210 5:120770029-120770051 CCCAATTTAAAAATGGGCAAAGG - Intergenic
996446557 5:123560042-123560064 CCCAATTGAAAAATGGACAAAGG + Intronic
996451793 5:123634005-123634027 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
996517523 5:124388864-124388886 CCTAATTCAAAAATGGACAAAGG + Intergenic
996632478 5:125651031-125651053 CTAAAAACAAAAATAGACAATGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996890625 5:128414947-128414969 CTTAATTAAAAACTGGGCAAAGG - Intronic
997017738 5:129956378-129956400 CTCCATTAAAAAGTGGACAAAGG - Intronic
997581911 5:135023343-135023365 ACAAATTCAAAAATGGGCAAAGG - Intergenic
997914686 5:137912763-137912785 TCCAATTTAAAAATGGACAAAGG - Intronic
997937292 5:138124369-138124391 CCCAATTAAAAAATGGGCAAAGG - Intronic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
998029539 5:138853271-138853293 TTGAATTCAACAGTGGTCAAGGG - Intronic
998062496 5:139130039-139130061 CCCAATTTAAAAATGGGCAAAGG + Intronic
998255838 5:140587047-140587069 CCCAATTTAAAAATGGGCAAAGG + Intronic
998663855 5:144273139-144273161 CCCAATTTAAAAATGGGCAAAGG + Intronic
998763792 5:145461766-145461788 GTGGATTCAAAATTGGTCAAAGG + Intergenic
998928218 5:147151406-147151428 CCTGATTTAAAAATGGACAAAGG + Intergenic
999072082 5:148754342-148754364 CTCATTTAAAAATTGGACAAAGG - Intergenic
999421017 5:151443492-151443514 CCCAATTTAAAAATGGGCAAAGG - Intronic
999634506 5:153606938-153606960 CTGAATACCAAATTGAACAAGGG - Intronic
999665912 5:153912914-153912936 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
1000108664 5:158085821-158085843 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1000131899 5:158308215-158308237 CTAAAATCAAAAATAGACAAAGG + Intergenic
1000842623 5:166240224-166240246 CAGAGTTCAAAAATGGGCAAAGG + Intergenic
1001531770 5:172467432-172467454 CCTAATTCAAAAATGGACAAAGG - Intergenic
1001537995 5:172512906-172512928 CCCAATTAAAAAATGAACAAAGG + Intergenic
1001922931 5:175614825-175614847 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1002111376 5:176916236-176916258 CAGATTTCAAAAAGGAACAATGG + Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002499707 5:179640056-179640078 CTCAATTCAAAAATGCATGAAGG + Intergenic
1002502318 5:179655063-179655085 CTCAATTCAAAAATGCATGAAGG - Intergenic
1002651497 5:180699492-180699514 CCCAACTCAATAATGGACAAAGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003023519 6:2532305-2532327 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1003169094 6:3706710-3706732 CCCAATTCAAAAATGGGCAAAGG + Intergenic
1003381960 6:5632806-5632828 CTCAATTGAAAAGTGGGCAAAGG - Intronic
1003405783 6:5826097-5826119 ATCAATTAAAAAATGGACACAGG + Intergenic
1003541273 6:7020110-7020132 CTCAATTGAAAAATGAACTAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004539121 6:16532533-16532555 CTTGATTAAAAAATGGGCAAAGG + Intronic
1004753005 6:18583103-18583125 GTGGATTCAAAAAGGGACCATGG + Intergenic
1005435771 6:25810424-25810446 CCCAATTAAAAAATGGGCAAAGG + Intronic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005596780 6:27387020-27387042 CCTAATTCAAAAATAGGCAAAGG + Intronic
1005851063 6:29822659-29822681 CTTCATTAAAAAGTGGACAAAGG + Intergenic
1005907166 6:30273356-30273378 CCTAATTCAAAAATGGACAAAGG + Intergenic
1005908530 6:30287360-30287382 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1006293285 6:33157403-33157425 CTAAAATCAAAAGTGGAAAAGGG + Intergenic
1006993786 6:38238893-38238915 CTGAATTCTAAAAGGGAAGAGGG + Intronic
1007045356 6:38768124-38768146 CCCAATTCAAAAATGGAGAAAGG - Intronic
1007047215 6:38788607-38788629 CTCAATTTAAAAATGAGCAAAGG - Intronic
1007063734 6:38968450-38968472 CCCAATTTAAAAATGGGCAAAGG + Intronic
1007281481 6:40715570-40715592 CAGTATTCAAAAATGGTCAGAGG - Intergenic
1007288628 6:40767052-40767074 CTTCATTAAAAAATGGGCAAAGG - Intergenic
1007849101 6:44786787-44786809 TAAAATTCAAAAATTGACAATGG - Intergenic
1007868890 6:45009098-45009120 CCCAATTTAAAAATGGGCAAAGG - Intronic
1008262345 6:49382083-49382105 CCCCATTAAAAAATGGACAAAGG - Intergenic
1008523656 6:52386014-52386036 CTCAATTAAAAAGTGGGCAAAGG + Intronic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008730264 6:54473579-54473601 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1008774629 6:55022730-55022752 TTCAATTAAAAAATGGGCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008992308 6:57617580-57617602 CCCAATTCAAAAATAGACAAAGG - Intronic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009180932 6:60516692-60516714 CCCAATTCAAAAATAGACAAAGG - Intergenic
1009356707 6:62756938-62756960 CTGAATTTTAAAATTGAGAAAGG - Intergenic
1009559928 6:65226447-65226469 ACCAATTTAAAAATGGACAAGGG + Intronic
1010543179 6:77117562-77117584 CTTAATTGAACAATGGAGAAAGG + Intergenic
1010689006 6:78887202-78887224 CTGATTTTAAAAATGAACGAAGG + Intronic
1010907568 6:81510579-81510601 CTCAATTTAAAAATGAGCAAAGG - Intronic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1011045363 6:83076154-83076176 CTGAATTTTAAAATGGGCCAAGG + Intronic
1011300565 6:85868576-85868598 CCTTATTCAAAAATAGACAAAGG - Intergenic
1011368481 6:86606416-86606438 CTCGATTTAAAAATGGGCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011570785 6:88732199-88732221 CCTGATCCAAAAATGGACAAAGG + Intronic
1011600559 6:89056260-89056282 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1011741660 6:90367316-90367338 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1011866013 6:91828833-91828855 CAGAATTTAAAAATGGCCACAGG - Intergenic
1012128424 6:95459332-95459354 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1012205797 6:96458911-96458933 CTGAATTCCAAAAGGGACGAGGG + Intergenic
1012232279 6:96774184-96774206 CCCAATTAAAAAGTGGACAAAGG + Intergenic
1012256081 6:97033847-97033869 CTGAATTTTAAAATGGTCACAGG - Intronic
1012348999 6:98228131-98228153 TCCAATTCAAAAATGGGCAAAGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012482639 6:99684366-99684388 CTGAGTTCAAAATTGTACAAAGG + Intergenic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012544276 6:100399115-100399137 CTCAATTCAAAAATGGGCAAAGG - Intronic
1012789021 6:103668665-103668687 CCCAATTTAAAAATGAACAAAGG - Intergenic
1013023214 6:106241203-106241225 CCCAATTCAAAAATGGGCAAAGG + Intronic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013304528 6:108836108-108836130 CCCAATTTAAAAATGGCCAAAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013468912 6:110443390-110443412 TCCAATTCAAAAATGGGCAAAGG + Intronic
1013848757 6:114487626-114487648 ATCCATTAAAAAATGGACAAAGG - Intergenic
1013943958 6:115700065-115700087 CTTGATTTAAAAATGGATAAAGG - Intergenic
1014034029 6:116744593-116744615 CCCAATTAAAAAATGGACAAAGG - Intergenic
1014131903 6:117845101-117845123 TCCAATTCAAAAATGGACAAGGG + Intergenic
1014247996 6:119087406-119087428 CCCAATTAAAATATGGACAAAGG + Intronic
1014592627 6:123292472-123292494 CTAAATTCCAAAAGGGAAAAGGG - Intronic
1014716814 6:124875315-124875337 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015025522 6:128527750-128527772 CTTATTTGAAAAATGGAGAAGGG + Intergenic
1015172485 6:130269101-130269123 ATTAATTCAAAAATGGATCACGG - Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015284276 6:131467251-131467273 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1015459875 6:133477437-133477459 CTCAAATAAAAAATGGGCAATGG - Intronic
1015618282 6:135102472-135102494 CTCAATTCAAAAATAGGCAAAGG - Intronic
1015664445 6:135612096-135612118 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1015836798 6:137429110-137429132 CTGAAATCCAGAATGGAGAAAGG + Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016106258 6:140166715-140166737 CCCAATTCAAAAATGGACAAAGG - Intergenic
1016289132 6:142508310-142508332 CCCAATTAAAAAATGGACAGAGG - Intergenic
1016422998 6:143904162-143904184 AACAATTCAAAAATGGGCAAAGG - Intronic
1016633611 6:146260773-146260795 CCTAATTAAAAAATGGGCAAAGG - Intronic
1016679347 6:146810126-146810148 CTGGTTTTAAAAATGGGCAAAGG + Intronic
1016897893 6:149071808-149071830 CCCACTTCAAAAATGGGCAAAGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017016326 6:150103271-150103293 CTCAATTTTAAAATGGGCAAAGG + Intergenic
1017081766 6:150676400-150676422 CGGAAGTCAAAAATCAACAAGGG + Intronic
1017201599 6:151760422-151760444 CTGAAGTCTGAATTGGACAATGG - Intronic
1017436325 6:154418985-154419007 CTGATTTTAAAAATGGGTAAAGG + Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018377262 6:163225013-163225035 CCCAATTTAAAAATGGGCAAAGG + Intronic
1018549195 6:164975356-164975378 ATAAATTCTAAAATGGGCAAAGG - Intergenic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1019755652 7:2767060-2767082 CCCAATTAAAAAATGGGCAAAGG - Intronic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1019885686 7:3902947-3902969 CCTAATTTTAAAATGGACAAAGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1020145459 7:5638969-5638991 CTCAACTCAAAAATGGACAGAGG - Intronic
1020258746 7:6518292-6518314 AAGAAAACAAAAATGGACAAAGG + Intronic
1020421571 7:8012300-8012322 CCCAATTCAAAAATAGACAAAGG - Intronic
1020494371 7:8830004-8830026 CTCAATTCAAATATAGGCAAAGG - Intergenic
1020545543 7:9524637-9524659 CTCCATTAAAAAATGGGCAAAGG - Intergenic
1020549189 7:9577819-9577841 CTGAATCCTAAAATGGAAATTGG - Intergenic
1020606967 7:10351242-10351264 CTTCATTAAAAAGTGGACAAAGG - Intergenic
1020772411 7:12411386-12411408 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1020808436 7:12820908-12820930 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020960084 7:14791454-14791476 TTGAATTGAAAAAGGGATAATGG + Intronic
1021204926 7:17768749-17768771 TTTAATTAAAAGATGGACAAAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021346311 7:19532957-19532979 CTCCATTTAAAAATGGGCAAAGG + Intergenic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021497119 7:21288155-21288177 CTTGATTTAAAAATGGGCAAAGG + Intergenic
1021697797 7:23290855-23290877 CTGATTTTTAAAATGGGCAAAGG - Intergenic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1021909837 7:25374196-25374218 CTGAAACCAAAACTAGACAAAGG - Intergenic
1022052643 7:26692950-26692972 ATAAATTAAAAAATGGATAAAGG + Intronic
1022056366 7:26739468-26739490 CTGAAATGAATAATAGACAATGG + Intronic
1022147614 7:27561129-27561151 CCCAGTTTAAAAATGGACAAAGG - Intronic
1022172923 7:27846776-27846798 CTTGATTAAAAAATGGGCAAAGG - Intronic
1022202974 7:28136007-28136029 CTGAAGTGAAACATGGAGAATGG - Intronic
1022225624 7:28359892-28359914 CTGATTTAAAAAATAGGCAAAGG + Intronic
1022335682 7:29419660-29419682 CCCAATTTAAAAATGGGCAAAGG + Intronic
1022602154 7:31771537-31771559 CCCAATTCAAAAATGGCCAAAGG - Intronic
1022625227 7:32029059-32029081 CCTAATTTAAAAATGGGCAAGGG + Intronic
1022753268 7:33254981-33255003 ACCAATTCAAAAATGGGCAAAGG - Intronic
1022883442 7:34616013-34616035 ATGACTTAAAAAATGGAAAAAGG + Intergenic
1022985448 7:35649861-35649883 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1023073917 7:36464243-36464265 GACAATTGAAAAATGGACAAAGG - Intergenic
1023288075 7:38639950-38639972 CCCATTTAAAAAATGGACAAAGG + Intergenic
1023372360 7:39524461-39524483 CTCAATTTAAAAATGAGCAAAGG + Intergenic
1023693701 7:42822911-42822933 TAGAATGCAAAAATGAACAATGG - Intergenic
1023712058 7:43005573-43005595 TCCAATTCAAAAATGGACAAAGG - Intergenic
1023880285 7:44314899-44314921 CCTAATTAAAAAATGGGCAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024020943 7:45368430-45368452 CTCAACTAAAAAATGTACAAAGG - Intergenic
1024181061 7:46895508-46895530 CCAAATTAAAAAATGGTCAAAGG - Intergenic
1024317108 7:48031198-48031220 CTGAATTTAAAAGTTGGCAAAGG + Intergenic
1024357847 7:48434334-48434356 CCCCATTCAAAAATGGGCAAAGG - Intronic
1024616727 7:51121342-51121364 CTCAATTAAAAAATGAGCAAAGG - Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025149173 7:56534417-56534439 CCTCATTCAAAAATGGGCAAAGG + Intergenic
1025195696 7:56930874-56930896 CTGAATTAGAATATGGGCAAAGG - Intergenic
1025270240 7:57505097-57505119 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1025621261 7:63173487-63173509 CTCCATTCAAAAGTGGGCAAAGG - Intergenic
1025676253 7:63646065-63646087 CTGAATTAGAATATGGGCAAAGG + Intergenic
1026434517 7:70383929-70383951 CTGAAGCCAAAAATGGGGAATGG - Intronic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026485992 7:70821877-70821899 CTCAATTTAAAAATGGGTAAAGG + Intergenic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027147667 7:75708180-75708202 CCCAATTCAGAAATGGGCAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028343487 7:89751769-89751791 CTTCATTAAAAAGTGGACAAAGG + Intergenic
1028501585 7:91524978-91525000 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1028541680 7:91949089-91949111 CCCAATTAAAAAATGGGCAAGGG - Intronic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028904808 7:96140928-96140950 CTGATTTTAAAAATGAGCAAAGG - Intronic
1029325644 7:99806355-99806377 CTGACTTAAAAAATAGGCAAAGG + Intergenic
1029673947 7:102053263-102053285 CTGAATTAGAATATGGGCAAAGG - Intronic
1029848360 7:103437104-103437126 CACAATTAAAAAATGGGCAAAGG + Intronic
1030043855 7:105476907-105476929 ACCAATTCAAAAATGGAGAAAGG - Intronic
1030098009 7:105918532-105918554 CCCAATTAAAAAATGGGCAAAGG - Intronic
1030364843 7:108633839-108633861 CCCAATTGAAAAATGGGCAAAGG - Intergenic
1030412169 7:109194562-109194584 CTCAATTTAAAAATGGGCCAAGG - Intergenic
1030452848 7:109734520-109734542 CTGATTTAAAAAATGGCCCAAGG + Intergenic
1030513724 7:110516453-110516475 CTCCATTAAAAAATGGGCAAAGG + Intergenic
1030522136 7:110611022-110611044 CCCAGTTCAAAAATGGGCAAAGG + Intergenic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031322262 7:120346162-120346184 CACAATTAAAAAATGGCCAAAGG - Intronic
1031651157 7:124291364-124291386 CTCAATTAGAAAATGGCCAAAGG - Intergenic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1032185752 7:129724206-129724228 CTCTATTCAAAAATGGGCAAAGG + Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032674615 7:134117674-134117696 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033522756 7:142178369-142178391 ATGAAACCAAAAATTGACAATGG - Intronic
1033633928 7:143190626-143190648 CTGAAGTTAAAAATTGGCAAAGG + Intergenic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034173818 7:149084626-149084648 CTGCATTAAAAAATGGGCAAAGG - Intronic
1034402383 7:150871653-150871675 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1034545844 7:151788503-151788525 CCCAATTAAAAAATGGGCAAAGG - Intronic
1034591366 7:152142307-152142329 AAAAATTGAAAAATGGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034712829 7:153209792-153209814 TTCAATTCAAAAATGGGCAAAGG - Intergenic
1034953813 7:155320288-155320310 CTGATTTAAAAAATGGGTAAAGG - Intergenic
1035046052 7:155966855-155966877 CTCAATTTAAAAGTGGGCAAAGG + Intergenic
1035451272 7:158978543-158978565 CTCGATTCAAAAATGGTCAAAGG - Intergenic
1035564753 8:634201-634223 CCTGATTCAAAAATGGCCAAAGG + Intronic
1036154191 8:6326463-6326485 ATGAATTCTAAAATGCACACTGG - Intergenic
1036636365 8:10552593-10552615 CCCAATTTAAAAATGGGCAAAGG + Intronic
1036959082 8:13224481-13224503 CATGATTCAACAATGGACAAAGG + Intronic
1036981028 8:13470434-13470456 CCTCATTAAAAAATGGACAAAGG + Intronic
1037123641 8:15319023-15319045 ATTGATTCAAAAATGGGCAAAGG - Intergenic
1037210268 8:16377606-16377628 CAGAATTCAGTCATGGACAAGGG + Intronic
1037269525 8:17111164-17111186 CCTAATTTAAAAATGGGCAAAGG - Intronic
1037382980 8:18308044-18308066 CTCAATTTTAAAATGGTCAAAGG + Intergenic
1037629822 8:20644800-20644822 CTTCATTTAAAAATGGTCAAAGG - Intergenic
1037648599 8:20816387-20816409 CAGAATTCTAAAATTGACATTGG + Intergenic
1037782921 8:21883211-21883233 CCCAATTCAAAAATGGACAAAGG + Intergenic
1037793468 8:21969277-21969299 CTGACTTCAACAATGAACAACGG - Intronic
1038197095 8:25378395-25378417 CAGAATTCAAGAATACACAAGGG - Intronic
1038273881 8:26102842-26102864 CCCAATTCAAAAATGGGCAAAGG + Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038357688 8:26845256-26845278 CCCAATTAAAAAATGGGCAAAGG + Intronic
1038506750 8:28091296-28091318 CTGAATTCTAAAAAGGAGGAGGG + Intronic
1038599356 8:28923935-28923957 CCTAATTAAAAAATGGGCAAAGG - Intronic
1038657251 8:29465000-29465022 CTCAGTTCAAAAATGGGCAAAGG - Intergenic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1038852461 8:31293196-31293218 ATAAATTTAAAAATGGGCAAAGG - Intergenic
1039156859 8:34569794-34569816 CTGGTTTCAAAAATGTACACAGG + Intergenic
1039168847 8:34717693-34717715 CTTCATTAAAAAATGGGCAAAGG - Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039259746 8:35758447-35758469 GTGATTTCAAAAATGGACTTAGG + Intronic
1039267963 8:35848134-35848156 CTGATTTTAAAACTGGGCAAAGG + Intergenic
1039398085 8:37244451-37244473 CTGTATTAAAAAATGGGCAGGGG - Intergenic
1039581868 8:38673579-38673601 CCTAATTTAAAAATGGGCAAAGG - Intergenic
1039631214 8:39113479-39113501 CTGAATTCAAAAACTCAAAACGG + Intronic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040020884 8:42739904-42739926 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1040037086 8:42881175-42881197 CCCGATTCAAAAATGGGCAATGG + Intronic
1040056344 8:43060920-43060942 TTTAATCAAAAAATGGACAAAGG + Intronic
1040060459 8:43099251-43099273 CTCAATTTAAAAATGTGCAAAGG - Intronic
1040627664 8:49169336-49169358 CTGAAATCAAAAATGAAAAGAGG - Intergenic
1040633342 8:49241378-49241400 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1040727891 8:50405472-50405494 TCCAATTCAAAAATAGACAAAGG - Intronic
1040793344 8:51260374-51260396 CCAAATTAAAAAATGGGCAAAGG - Intergenic
1040994037 8:53383242-53383264 CTCAATCAAAAAATGGGCAAAGG + Intergenic
1041049480 8:53919210-53919232 CCCAATTTAAAAATGGAGAAAGG - Intronic
1041140695 8:54816227-54816249 CTGCATTCTAAAATGCATAAAGG + Intergenic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041339281 8:56824826-56824848 CCCAATTCAAACATGGATAAAGG + Intergenic
1042074262 8:64972441-64972463 CCCAATGAAAAAATGGACAAAGG - Intergenic
1042078503 8:65022739-65022761 TCCAATTAAAAAATGGACAAAGG + Intergenic
1042220142 8:66465544-66465566 CTCAATTCAAAAATGGGCATAGG - Intronic
1042293300 8:67192374-67192396 TTCAATTTGAAAATGGACAAAGG - Intronic
1042425833 8:68647110-68647132 CCCAATTTAAAAATGGGCAAAGG + Intronic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042670342 8:71255882-71255904 CTGATTTAAAAAATGGGAAAAGG + Intronic
1042901057 8:73728023-73728045 CTCAACTAAAAAATGGGCAAAGG - Intronic
1042933487 8:74035610-74035632 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1042999144 8:74735806-74735828 GTGAAATCAAAAAAGGACATTGG + Intronic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043277793 8:78421851-78421873 CCAATTTAAAAAATGGACAAAGG - Intergenic
1043307376 8:78812718-78812740 CTTGATTTAAAAATGGGCAAAGG - Intergenic
1043346705 8:79306122-79306144 CCAATTTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043539835 8:81248499-81248521 CCCAATTATAAAATGGACAAAGG + Intergenic
1043675149 8:82942136-82942158 CTGCATTAAAAAGTGGGCAAAGG + Intergenic
1043700230 8:83277645-83277667 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1043754984 8:83992145-83992167 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1043767037 8:84149135-84149157 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1044086583 8:87949797-87949819 CCCCATTAAAAAATGGACAAAGG + Intergenic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044168264 8:89016774-89016796 CTGCATTAAAAATTGGGCAAAGG + Intergenic
1044175565 8:89116905-89116927 CCCAATTTAAAAATGGACCAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044483515 8:92722043-92722065 CCCCATTTAAAAATGGACAAAGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044783256 8:95765765-95765787 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045138938 8:99256714-99256736 CCCACTTCAAAAATGGACAAAGG - Intronic
1045190397 8:99876451-99876473 CTGGATTCAATATAGGACAAAGG - Exonic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045228908 8:100281086-100281108 TTGAATTAAATAATGGACCATGG - Intronic
1045364745 8:101465322-101465344 CCAGATTCAAAAATGGAGAAAGG + Intergenic
1045453361 8:102350861-102350883 CCTAATTAAAAAATGGGCAAAGG + Intronic
1045456587 8:102386101-102386123 CTGGCTTCAAAAATGAACAGTGG + Intronic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1045856917 8:106774976-106774998 CTTCATTAAAAAATAGACAAAGG - Intergenic
1045967768 8:108045245-108045267 CTCCATTAAAAAATGGGCAAAGG + Intronic
1046214999 8:111132830-111132852 CTGATTTAAAAAATTAACAAAGG + Intergenic
1046370601 8:113300827-113300849 CTGAATTCAAAAATTTAAAAAGG + Intronic
1046408358 8:113804944-113804966 CCTAATTTAAAAATGGGCAAAGG - Intergenic
1046684744 8:117212628-117212650 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1046688302 8:117252558-117252580 TTGATTTCTAAATTGGACAAGGG - Intergenic
1046701972 8:117411300-117411322 CCGCATTAAAAAATGGCCAAAGG + Intergenic
1046862053 8:119104497-119104519 TAGCATTAAAAAATGGACAAGGG - Intronic
1047039798 8:120980272-120980294 CTCAATTGAAAAATGAAAAAAGG + Intergenic
1047061588 8:121232914-121232936 TTGAATTCAAAATTTGACAGTGG + Intergenic
1047223569 8:122938300-122938322 ATGGATTCATAACTGGACAAAGG - Intronic
1047265332 8:123302219-123302241 CTCAATTCAAAATTGGGCAAAGG - Intergenic
1047572826 8:126119137-126119159 CCCAATTAAAAAATGGGCAAGGG - Intergenic
1047602649 8:126441820-126441842 CTAATTTTTAAAATGGACAAAGG + Intergenic
1047652863 8:126942695-126942717 CTCAATTTAAAAATAGGCAAAGG - Intergenic
1047711645 8:127558715-127558737 CTGAACTTGAAAAAGGACAAAGG + Intergenic
1047811807 8:128418572-128418594 CTGATTTCAACAATGCACAGAGG - Intergenic
1048640319 8:136350919-136350941 ATTAATTCAAAAATGCAAAAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049692539 8:143968671-143968693 GTAAATTCTAAAATGGACAAAGG + Intronic
1049866053 8:144936993-144937015 CCCAATTTAAAAATGGGCAAAGG - Intronic
1049984887 9:940856-940878 CCCATTTCAAAAATGGCCAAAGG + Intronic
1049993953 9:1016988-1017010 CACAATTTAAAAATAGACAAAGG - Intergenic
1050164899 9:2755152-2755174 CCCCATTCAAAAATGGGCAAAGG + Intronic
1050241385 9:3639394-3639416 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1050392812 9:5164462-5164484 GTTAATACAAAAATGTACAAAGG - Intronic
1050488294 9:6159278-6159300 CACAATTCAAAAATGGGCAAAGG + Intergenic
1050530342 9:6582880-6582902 CCCAATTAAAAAATGGGCAAAGG + Intronic
1050672076 9:8008580-8008602 CTGGATTAAAAAATGAGCAAAGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051324622 9:15951689-15951711 CTGATTTAAAAAATGGGCAAAGG - Intronic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1051716091 9:19986099-19986121 CTCAATTTAAAAATAGGCAAAGG + Intergenic
1051858269 9:21594745-21594767 TGCAATTCAAAAATGGGCAAAGG - Intergenic
1051875818 9:21792130-21792152 CTGATTTAAAAAATGGGCAAAGG + Intergenic
1052005845 9:23347439-23347461 CTGATTTAAAAAATGGGTAAAGG + Intergenic
1052234831 9:26198186-26198208 CCCAATTCAAAAATGGGCAAAGG + Intergenic
1052255393 9:26449929-26449951 GTCAATTTAAAAATGGGCAAAGG + Intergenic
1052350384 9:27452564-27452586 CATAATTTAAAAATGGGCAAAGG + Intronic
1052500094 9:29278153-29278175 CCCATTTTAAAAATGGACAAAGG - Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052581974 9:30369124-30369146 CCCAATTAAAAAATGGTCAAAGG - Intergenic
1052713422 9:32086186-32086208 CTTAATTGAAAAATGCACAAAGG + Intergenic
1052782109 9:32792088-32792110 ACGAATGCAAAAATAGACAATGG + Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053587527 9:39475949-39475971 CTGATATCATAAATAGACAACGG - Intergenic
1053612277 9:39726788-39726810 ACGAATACAAAACTGGACAAAGG + Intergenic
1053725992 9:41001614-41001636 CACAATTCAAAACTGGGCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053870311 9:42484781-42484803 ACGAATACAAAACTGGACAAAGG + Intergenic
1054085978 9:60744367-60744389 ACGAATACAAAACTGGACAAAGG - Intergenic
1054241240 9:62615604-62615626 ACGAATACAAAACTGGACAAAGG - Intergenic
1054339941 9:63850251-63850273 CACAATTCAAAACTGGGCAAAGG + Intergenic
1054555369 9:66650128-66650150 ACGAATACAAAACTGGACAAAGG - Intergenic
1054578771 9:66889289-66889311 CTGATATCATAAATAGACAACGG + Intronic
1054834708 9:69664968-69664990 CTGAACTCAGAAGTGGACATGGG - Intronic
1055002318 9:71465783-71465805 ATGAAGTCAAAAATGAACGATGG - Intergenic
1055046828 9:71934935-71934957 CCCAATTCAAAAATGGGCAGAGG + Intronic
1055222323 9:73951428-73951450 CTGCATTAATAAATGGGCAAAGG - Intergenic
1055378577 9:75680080-75680102 CTCAATTAAAAAAGGGACCAAGG + Intergenic
1055385576 9:75758585-75758607 CCTAATACAAAAATGGGCAAAGG - Intergenic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1055940123 9:81641596-81641618 CCTAATTTAAAAATGGGCAAAGG + Intronic
1056079702 9:83078873-83078895 CTGCATTAAAAAGTGGGCAAAGG - Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056378816 9:86039113-86039135 CTCAATTAAAAAATGAGCAAAGG + Intronic
1056421200 9:86428034-86428056 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1056433787 9:86555579-86555601 CTCAATTTAAAAAGGGGCAAAGG + Intergenic
1056574402 9:87843722-87843744 CTAATTTCAAGAAGGGACAAAGG - Intergenic
1056651241 9:88465618-88465640 CCTAATTAAAAAATGGTCAAAGG - Intronic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1057103049 9:92382054-92382076 CCCAATTCAAAAATGGGCTAAGG - Intronic
1057121148 9:92575364-92575386 CTCTGTTCAAAAATGGGCAAAGG + Intronic
1057187926 9:93068037-93068059 CAAAATTGAAAAATGGCCAAAGG - Intronic
1057444833 9:95106285-95106307 CCCAATTCAAAAATGGGCAAAGG - Intronic
1057458181 9:95233617-95233639 GTGGATGCAAAAATGGAAAATGG + Intronic
1057620408 9:96629654-96629676 CTGCATTTAAAAATGGAAAGAGG - Intergenic
1057622841 9:96652221-96652243 CCTGATTAAAAAATGGACAAAGG + Intronic
1057740551 9:97707723-97707745 ATCAATTTTAAAATGGACAAAGG - Intergenic
1057760046 9:97864738-97864760 CTTAATTCAAAAATGGGCAAAGG - Intergenic
1057846075 9:98525323-98525345 CCCAATTAAAAATTGGACAAAGG + Intronic
1057979309 9:99642871-99642893 CTCAATTTGAAAATGGCCAAAGG + Intergenic
1058109949 9:101021488-101021510 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058319637 9:103612851-103612873 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1058916663 9:109573494-109573516 CTCTATTAAAAAATGGGCAAAGG + Intergenic
1059163231 9:112055001-112055023 CCCAATTCAAAAATGAGCAAAGG + Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059358763 9:113722557-113722579 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1059614692 9:115936341-115936363 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1059825831 9:118028083-118028105 ATGAACTCTAAAATGGAGAAAGG + Intergenic
1059979481 9:119754459-119754481 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1061018590 9:127998444-127998466 CCTGATTCAAAAATGGGCAAAGG - Intergenic
1061329676 9:129884760-129884782 CTGAATTTAAAACAGAACAAAGG - Intergenic
1062557311 9:137119754-137119776 CCCAATTCAAAAATGGGCGAAGG - Intergenic
1062701810 9:137910214-137910236 CTCAATTTTAAAATGGGCAACGG - Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1202804013 9_KI270720v1_random:33309-33331 CACAATTCAAAACTGGGCAAAGG + Intergenic
1203448818 Un_GL000219v1:90351-90373 CACAATTCAAAACTGGGCAAAGG + Intergenic
1185556636 X:1026456-1026478 CTGAATTCTAAAATGGGAACTGG + Intergenic
1185817358 X:3168727-3168749 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1185841581 X:3396881-3396903 CTGAATTTAAAAAATTACAAAGG - Intergenic
1185957731 X:4510219-4510241 ATGATTTCCAAAGTGGACAATGG - Intergenic
1186208779 X:7228551-7228573 CCCAATTAAAAAATGGCCAAAGG - Intronic
1186392356 X:9173718-9173740 CCCCATTAAAAAATGGACAAAGG + Intergenic
1186767532 X:12786395-12786417 CCGAATTTTAAAATGGGCAAAGG - Intergenic
1186902320 X:14070090-14070112 CTGAATACAAAAATAAGCAAAGG + Intergenic
1186946129 X:14569430-14569452 CCCAATTCAAAAATGGGTAAAGG + Intronic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187326886 X:18299209-18299231 CTTAATTAAAAAGTGGACAAAGG + Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187571116 X:20503258-20503280 CACAATTAAAAAATGGGCAAAGG - Intergenic
1187640520 X:21283742-21283764 CAACATTCAAAAATGGGCAAAGG + Intergenic
1187910553 X:24107177-24107199 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1188038941 X:25349937-25349959 CTCAATTCAAAAATAGGCAAAGG - Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188138337 X:26517524-26517546 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1188236141 X:27733353-27733375 CCGAATTAAAATATGGCCAAAGG - Intronic
1188263826 X:28045759-28045781 CTAATTTCTAAAATGGGCAAAGG - Intergenic
1188362357 X:29271687-29271709 CAGCATTCAAAACTGGGCAAAGG - Intronic
1188398038 X:29709041-29709063 CCCAATTAAAATATGGACAAAGG - Intronic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1188542222 X:31263547-31263569 CTTAACTCACAAATGGGCAATGG - Intronic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1188891826 X:35620998-35621020 CCCAATTAAAAAATGGGCAAAGG + Intergenic
1188897705 X:35689237-35689259 CACAATTTAAAAATGGTCAATGG - Intergenic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189446005 X:41082358-41082380 CCCAAGTCAAAAATGGGCAAAGG - Intergenic
1189448647 X:41105947-41105969 CTCAATTGAAAAATGGGCAAAGG - Intronic
1189538854 X:41965268-41965290 TTAAATTTAAAAATGGGCAAAGG + Intergenic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189686412 X:43568355-43568377 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1189699718 X:43705776-43705798 CCCAATTCAAAAATGGACAAAGG + Intronic
1189718406 X:43888526-43888548 CTCAATTAAAAAATGAGCAAAGG - Intergenic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1189764405 X:44355535-44355557 CCCAATTTAAAAGTGGACAAAGG + Intergenic
1189881169 X:45494138-45494160 CTGATGCCAAAACTGGACAAAGG - Intergenic
1189892099 X:45613641-45613663 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1190097206 X:47491302-47491324 CAGAATTCAGCAATGGAAAAGGG + Intergenic
1190254106 X:48749612-48749634 CCCAATTCAAAAATGGATAAAGG + Intergenic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190578252 X:51863800-51863822 CCCAATTTAAAAATGGGCAAAGG - Intronic
1190616190 X:52235312-52235334 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1190724912 X:53182668-53182690 TTCAATTTAAAAATGGGCAAAGG - Intergenic
1190961418 X:55252959-55252981 CTGTTTTAAAAAATGGGCAATGG + Intronic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191695949 X:63990520-63990542 ATCAATTCAAAAATAGACAAAGG + Intergenic
1191708333 X:64117741-64117763 CCCAATTAAAAAGTGGACAAAGG - Intergenic
1191727396 X:64295625-64295647 CCCAATTCAAAAATGGGCAATGG + Intronic
1191769947 X:64744081-64744103 CTCAATTATAAAATGGGCAAAGG - Intergenic
1191822045 X:65321206-65321228 CTCAATTAAAAAGTGGACAAAGG + Intergenic
1191836827 X:65472208-65472230 CTCAATTTAAAAATGAATAAAGG - Intronic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192276752 X:69639585-69639607 CCTGATTAAAAAATGGACAAAGG - Intronic
1192281131 X:69687238-69687260 CTCAATTGAAAAATGGGCAAAGG - Intronic
1192288346 X:69763135-69763157 ATGAATTCATAAAAGGACATAGG - Intronic
1192607378 X:72532692-72532714 CTCAATTGAAAAATGTATAAAGG - Intronic
1192737052 X:73859294-73859316 CTCAATTAAAAAATGGGCACAGG - Intergenic
1192749369 X:73972582-73972604 CCCAATTTAAAAATGGGCAAGGG - Intergenic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1192902822 X:75518298-75518320 CCCATTTAAAAAATGGACAATGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1192990369 X:76447226-76447248 CCAAATTCTAAAATGGGCAAAGG - Intergenic
1193017629 X:76753708-76753730 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1193099180 X:77588788-77588810 TCCAATTCAAAAATGGGCAAAGG + Intronic
1193287409 X:79728638-79728660 CAGAATTCAAAACTACACAAAGG - Intergenic
1193523747 X:82563194-82563216 CTCCATTAAAAAATGGTCAAAGG + Intergenic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1193622069 X:83765864-83765886 CCCCATTAAAAAATGGACAAAGG - Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193767781 X:85551933-85551955 CTAATTTCAAAAATGGACAAAGG - Intergenic
1193837025 X:86355855-86355877 CCCCATTAAAAAATGGACAAAGG - Intronic
1193839262 X:86388746-86388768 ATGAATTACATAATGGACAAAGG - Intronic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194238384 X:91413129-91413151 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1194562771 X:95443672-95443694 CCCAATTCAAATATGGACAAAGG - Intergenic
1194597836 X:95880916-95880938 CCCAATTAAAAAATGGGCAAAGG - Intergenic
1194636869 X:96355994-96356016 AAAAATTCAAAAATGGGCAAAGG + Intergenic
1194652171 X:96529028-96529050 CCCAAATAAAAAATGGACAAAGG + Intergenic
1194897629 X:99464764-99464786 CCCAATTCAAACATGAACAAAGG - Intergenic
1195059553 X:101180435-101180457 CCCAATTTAAAAATGGGCAAAGG - Intergenic
1195145724 X:102015147-102015169 TGCAATTAAAAAATGGACAAAGG + Intergenic
1195210481 X:102649595-102649617 CTGAATTAAGAAGTGGACACTGG - Intergenic
1195253659 X:103073188-103073210 CCCAATTCAAAAATGGGCAAAGG + Intergenic
1195587578 X:106583161-106583183 TTTAATTAAAAAATGGGCAAAGG + Intergenic
1195653237 X:107309429-107309451 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1195714141 X:107802004-107802026 CCCAATTTAAAAATGGGCAAAGG + Intergenic
1195781492 X:108470470-108470492 CTCCATTTAAAAATGGGCAAAGG - Intronic
1195788213 X:108551322-108551344 CCCCATTCAAAAATGGGCAAAGG + Intronic
1195848086 X:109249984-109250006 CCCAATTAAAAAATGGGCAATGG - Intergenic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1196029293 X:111077973-111077995 CCCAATTAAAAAATGGAAAAAGG + Intronic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196476766 X:116096087-116096109 CTTATTTTTAAAATGGACAAAGG - Intergenic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1196930700 X:120679152-120679174 CCCAATTTAAAAATGGTCAAAGG - Intergenic
1197180427 X:123529846-123529868 CTCAATTAAAAAGTGGGCAAAGG - Intergenic
1197299267 X:124758205-124758227 CTTGATTAAAAAATGGGCAAAGG + Intronic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1197370829 X:125623840-125623862 CTAATTTCAAAAATGGGCAAAGG - Intergenic
1197411995 X:126128168-126128190 ATGAACTCAAAAATGGATCATGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197577391 X:128232470-128232492 CCCAATTCAAAAATAGGCAAAGG + Intergenic
1197747620 X:129942752-129942774 CTAAAATCAAATATGCACAAAGG - Intergenic
1197847636 X:130820129-130820151 CCGATTTTAAAAATGGACAAAGG + Intronic
1197882673 X:131184099-131184121 CTGATATCAAAACTGGACAAGGG - Intergenic
1198152921 X:133928757-133928779 CTTGATTTAAAAATGGGCAAAGG - Intronic
1198192261 X:134319886-134319908 CCAAATTTAAAAATGGGCAAAGG + Intergenic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1198527546 X:137517184-137517206 GTGAATTCCACAATGGAAAAGGG - Intergenic
1198541938 X:137649110-137649132 CCCAATTAAAAAGTGGACAAAGG + Intergenic
1198584443 X:138105117-138105139 CCTAATTAAAAAGTGGACAAAGG + Intergenic
1198773088 X:140151264-140151286 CTGAAGTCAAGAATGAACTAAGG - Intergenic
1198809837 X:140524242-140524264 CTGAATTAAATAGTGGAGAAAGG - Intergenic
1198885996 X:141338040-141338062 CCTGATTCAAAAATGGGCAAGGG - Intergenic
1198890027 X:141383848-141383870 CCCAATTTAAAAATGGGCAAGGG + Intergenic
1199205873 X:145147300-145147322 CCCAATTAAAAAATGGACAAAGG - Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200291891 X:154883428-154883450 CCGAATTAAAAAATGGGCAAAGG + Intronic
1200307334 X:155040836-155040858 CCCAATTAAAAAATGGGCAAAGG - Intronic
1200315269 X:155125962-155125984 CACAATTCAAAAATGGGCAAAGG + Intronic
1200338729 X:155379165-155379187 CCGAATTAAAAAATGGGCAAAGG + Intergenic
1200347740 X:155461527-155461549 CCGAATTAAAAAATGGGCAAAGG - Intergenic
1200354085 X:155529671-155529693 CCCAATTAAAAAATGGTCAATGG - Intronic
1200363867 X:155640034-155640056 CTCAATTAAAAAGTGGGCAAAGG - Intronic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201290130 Y:12414667-12414689 CTGAATTCCAAAATGGAGGAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201374808 Y:13307744-13307766 CCAAATTAAAAAATGGGCAAAGG + Intronic
1201375242 Y:13312048-13312070 CCGCACTAAAAAATGGACAAAGG + Intronic
1201579757 Y:15498869-15498891 CCCAGTTAAAAAATGGACAAAGG - Intergenic
1201758146 Y:17512364-17512386 TCAAATTGAAAAATGGACAAGGG - Intergenic
1201843409 Y:18393626-18393648 TCAAATTGAAAAATGGACAAGGG + Intergenic
1202251244 Y:22875713-22875735 CTGAATCAAAAAGTGGGCAAAGG + Intergenic
1202404232 Y:24509462-24509484 CTGAATCAAAAAGTGGGCAAAGG + Intergenic
1202466547 Y:25160620-25160642 CTGAATCAAAAAGTGGGCAAAGG - Intergenic