ID: 1181730005

View in Genome Browser
Species Human (GRCh38)
Location 22:24838298-24838320
Sequence GGGTGCTGCAGCTGAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 3, 1: 44, 2: 93, 3: 200, 4: 594}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181730002_1181730005 -2 Left 1181730002 22:24838277-24838299 CCAAGGAAGAAGGGTTTAATTGG 0: 1
1: 51
2: 146
3: 237
4: 358
Right 1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG 0: 3
1: 44
2: 93
3: 200
4: 594
1181729998_1181730005 23 Left 1181729998 22:24838252-24838274 CCGATCACTGAGATGACAAGTAT 0: 14
1: 29
2: 84
3: 147
4: 380
Right 1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG 0: 3
1: 44
2: 93
3: 200
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181730005 Original CRISPR GGGTGCTGCAGCTGAAGAGA AGG Intronic
900124600 1:1063896-1063918 GCGGGCTGCATCTGCAGAGAAGG + Intergenic
900314879 1:2051520-2051542 GGTGGCTGCTGCTGCAGAGAGGG + Intronic
900731165 1:4261542-4261564 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
901002277 1:6154747-6154769 GGTGGCTGCGGCTGTAGAGACGG - Exonic
901184563 1:7364615-7364637 GGAGGCTGCAGCTGCAGATATGG + Intronic
901537666 1:9893082-9893104 GGCAGCTGGAGCTGAAGGGAAGG + Intronic
902033166 1:13437553-13437575 AGGTGCTGAAGCTGAGGAAATGG + Intergenic
903039057 1:20514804-20514826 CAGTGCTGCAGCTGAGGAGATGG + Intergenic
903627923 1:24744918-24744940 GGGTGCTGCAGCGGGGGAGTGGG + Intergenic
904320088 1:29690909-29690931 AGGTCCTGGAGCTGAGGAGATGG + Intergenic
904368330 1:30032501-30032523 AGGTGCTACAGCTGAGGAGATGG - Intergenic
905661582 1:39730366-39730388 AGGTGCTGCGGCTGAGAAGATGG - Intronic
905766800 1:40608188-40608210 GGGTGCTGCAGCCAAGAAGATGG + Intergenic
905794595 1:40808510-40808532 GGGTGGGGGATCTGAAGAGATGG - Intronic
905876078 1:41432880-41432902 GGGCGCTGCAGCAGCAGAAATGG - Intergenic
905937573 1:41837047-41837069 GGGAGATGAAGCTGAAGAGAAGG - Intronic
906085186 1:43126971-43126993 GGGTGCTGTAGCCAAGGAGATGG + Intergenic
906099678 1:43251260-43251282 AGGTGCTGCAGCCAAGGAGATGG + Intronic
906148832 1:43576040-43576062 GGGTGCTGGAGCTGGAGATGAGG - Intronic
907907636 1:58798947-58798969 AGGAGCAGCAGCTGAGGAGAAGG - Intergenic
908326907 1:63031940-63031962 GGGTGATGCAGCAGAAGCCAAGG + Intergenic
909872048 1:80753071-80753093 GGGAGCTACAGTTGAAGATAAGG + Intergenic
910617490 1:89215634-89215656 GGGTGCTGAAGCCAAGGAGAGGG - Intergenic
911548492 1:99251005-99251027 AGGTGCTACAGCTGAGGAAACGG + Intergenic
912165261 1:107035960-107035982 GGGTGCAGCAGCCAAGGAGATGG + Intergenic
913147251 1:116004164-116004186 GGGTGCTGCAGCCAAAGAGATGG - Intronic
913237484 1:116797435-116797457 GAGAGCTGCAGCTGTAGAGAAGG + Intergenic
913240782 1:116827471-116827493 GGTTGCTGGAGGTGAACAGATGG - Intergenic
913568927 1:120101025-120101047 GGGAGCTGAAGCTGAAAGGATGG + Intergenic
913607301 1:120477799-120477821 GGGTGCTGCAGCTGAGTAGACGG + Intergenic
914000427 1:143690073-143690095 GTGTGCTGCAGCTGAGGAGACGG - Intergenic
914197724 1:145458172-145458194 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914234611 1:145797259-145797281 GGGTGCTGTAGCTGAGGAGAGGG - Intronic
914289736 1:146262016-146262038 GGGAGCTGAAGCTGAAAGGATGG + Intergenic
914319474 1:146545222-146545244 AGATGCTGCAGTTGGAGAGAGGG + Intergenic
914476828 1:148031283-148031305 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914503389 1:148266560-148266582 GGGTGTTGCAGCTGAGGAGATGG + Intergenic
914510373 1:148327368-148327390 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
914550780 1:148712799-148712821 GGGAGCTGAAGCTGAAAGGATGG + Intergenic
915006647 1:152644531-152644553 GGCTGCTGCAGCTCAGGAGGTGG - Intergenic
915340686 1:155175103-155175125 GGCTACTGCAGCTGGAGAAATGG + Intronic
915476911 1:156158435-156158457 AGGTGCCGCAGGTGTAGAGATGG - Exonic
915556601 1:156664353-156664375 GGGTCCTGCAGCAGGACAGATGG - Intergenic
917443000 1:175083366-175083388 GGGCTCTGCAGCTGAAGAGTGGG + Intronic
917453042 1:175163020-175163042 CCATCCTGCAGCTGAAGAGATGG + Intronic
918362706 1:183775110-183775132 GGGTGCTGCAGCTGAGGAGATGG - Intronic
919165760 1:193889373-193889395 AGGTGCTGCAGCCCAGGAGATGG - Intergenic
919178209 1:194047174-194047196 AGGTACTGCAGATGAGGAGATGG + Intergenic
919282761 1:195512300-195512322 GGGTCCTGCAGCTGAGGAAATGG - Intergenic
920006307 1:202836019-202836041 GGGTCCTGGAGATGGAGAGAGGG - Intergenic
920764018 1:208813654-208813676 GCATGCTGCAGCCGAGGAGATGG + Intergenic
920850383 1:209624345-209624367 TGGAGCTGCAGCTGTACAGATGG - Intronic
921092836 1:211859586-211859608 GGGTGCTGCAGCCAAGCAGATGG + Intergenic
921095708 1:211885530-211885552 GGGTGATGCAGCAGGAGGGAAGG - Intergenic
921684173 1:218070894-218070916 GGGTGGTGGAGGAGAAGAGAAGG + Intergenic
921724125 1:218505798-218505820 GGGTGCTGCAGCTGAGGAAATGG + Intergenic
921775918 1:219099967-219099989 GGATGCTGCCGCTGACGAGATGG - Intergenic
921791568 1:219296338-219296360 GGGTTCTGCACCTGAATAAACGG + Intergenic
921826494 1:219678006-219678028 GAGTACTGAAGCTGAAGAAAAGG + Intergenic
922058588 1:222065400-222065422 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
922449263 1:225723584-225723606 GGGTGCTACAGCCGAGGAGATGG - Intergenic
923921747 1:238573773-238573795 GGCCGCTGCAGCTGAGGAGATGG + Intergenic
924080619 1:240393946-240393968 GGGTGCTGCAGCCGAGGCGATGG + Intronic
924320483 1:242843671-242843693 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
924333832 1:242967081-242967103 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1062785715 10:263106-263128 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1065301711 10:24328164-24328186 AGGTGCTGCAGCCAAGGAGATGG + Intronic
1065707803 10:28487366-28487388 GGGTGCTGCAGTCAAGGAGATGG - Intergenic
1065790635 10:29257210-29257232 GGGTTCTGGAGCTGAAGACATGG + Intergenic
1065835773 10:29656760-29656782 GGGTGCTGCAGCCGAGGAGATGG - Intronic
1065837947 10:29676182-29676204 AGGTGCTGCAGGTGAGGAGATGG - Intronic
1065893133 10:30138004-30138026 GGGGGCTGAAGATGAAGGGATGG + Intergenic
1065983259 10:30924275-30924297 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1066182361 10:32975581-32975603 GGGTGTTGCAGCCAAGGAGATGG - Intronic
1066256881 10:33688265-33688287 GGGTACTGCAGCTGTGGAGATGG - Intergenic
1066279244 10:33898963-33898985 GGGTGCTGCAGCTGAGGAGCTGG - Intergenic
1066393095 10:34994669-34994691 GGGAGCTGAAGCTGTAGAGCTGG - Intergenic
1066617021 10:37305521-37305543 GGGAGGTGCAGGTGAAAAGAGGG + Intronic
1067008385 10:42687483-42687505 TGGTGCTGCAGCCCAGGAGATGG + Intergenic
1067751585 10:48975290-48975312 GGGGGCTGCAGCTGAAAAATTGG + Intronic
1068211864 10:53930814-53930836 GGGTGTTGAAGCTGAGGAGATGG - Intronic
1068212035 10:53932839-53932861 GGGTGCTGCAGCTGAGGACATGG + Intronic
1068215437 10:53977126-53977148 AGGTGCTGCAGCCCAGGAGATGG - Intronic
1068228952 10:54144609-54144631 GGGTGCTGCCGCTGAGGCGATGG - Intronic
1068334115 10:55608664-55608686 AGGTGCTGCAGCCGAGGAAATGG + Intronic
1068700633 10:60015934-60015956 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1069088975 10:64176392-64176414 GGGTGCTGCAGACAAGGAGATGG + Intergenic
1069947343 10:71997142-71997164 GGGTTCTGCAGTGGAAGAGTGGG - Intronic
1070290733 10:75111729-75111751 GGGAGCTGAGGCTGAGGAGAGGG + Intronic
1070637576 10:78141596-78141618 GGGTGCTGAGGATGGAGAGAAGG + Intergenic
1070689502 10:78514179-78514201 GGGGGCTGGAGGTGAGGAGATGG + Intergenic
1070825354 10:79387526-79387548 AGGGGCTCCAGCTGAACAGAAGG - Intronic
1070973693 10:80588134-80588156 AGGTGCTGCAGCTGAGGAGATGG + Intronic
1071056211 10:81510771-81510793 GGGTGCTGCAGGTGAGGAGATGG - Intergenic
1071073517 10:81724712-81724734 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1071403611 10:85304865-85304887 GGATGCTGCAGCTGAAGAGACGG - Intergenic
1072877045 10:99183637-99183659 GGGTGCTGCAGTTGAGGAGATGG - Intronic
1073218752 10:101852213-101852235 GGTTACTGCATATGAAGAGATGG + Intronic
1073260379 10:102185449-102185471 GGGTGCTGCAGCTGAGAAGATGG - Intergenic
1073261238 10:102192138-102192160 GGGTGCTGCAGCCCAGGATATGG - Intergenic
1073428267 10:103469538-103469560 GGATGCTGAAGCTGCAGAAATGG - Intergenic
1073765427 10:106677085-106677107 GGGTGCTGCAGCCAAGGATATGG - Intronic
1073773111 10:106756981-106757003 AGGTGCTGCAGCCAAGGAGACGG - Intronic
1073792227 10:106952179-106952201 GGGTGCTAGAGCTGAGGAGATGG - Intronic
1074563769 10:114558037-114558059 GGGTGCTTCAGCCAAGGAGATGG - Intronic
1075307898 10:121384146-121384168 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1075676715 10:124300902-124300924 GGGTGCTGCGGCTGAGGAGTTGG - Intergenic
1076701343 10:132274924-132274946 GGGTGCCCCAGCTCCAGAGAGGG + Intronic
1076736217 10:132460303-132460325 GGGGGCTGCAGCTGAAAAGTGGG + Intergenic
1077293168 11:1809723-1809745 GGGTGCTGCAGCTGAGGTGATGG + Intergenic
1077384843 11:2263901-2263923 GCGTGCTACAGCTGAGGACATGG + Intergenic
1077492760 11:2869797-2869819 GGCTGCTGCAGCCGCAGAGCCGG - Intergenic
1077500615 11:2908294-2908316 GGGTGCTGCAGCTGCTGGGCGGG + Exonic
1077555446 11:3223911-3223933 AGATGCTGCCGTTGAAGAGATGG + Intergenic
1078445193 11:11398961-11398983 GGGAGCTGGAGCTGAAAGGAAGG + Intronic
1078516428 11:12026592-12026614 GGGTGCTGCAGCTGAGGATATGG + Intergenic
1078671592 11:13370536-13370558 GGGTGGTGAAGCAGAAGTGAGGG - Intronic
1079102059 11:17547915-17547937 GGGTGCTGCGGCTGGGGAGGGGG - Intronic
1079570768 11:21940938-21940960 AGGTGCTGCAGCAGAGGAGTTGG - Intergenic
1079723356 11:23847255-23847277 GGGTGCTGCAGCAAAAGAGATGG - Intergenic
1079724953 11:23869174-23869196 GGGTGCTGTAGCCAAGGAGATGG - Intergenic
1080582511 11:33655833-33655855 GGGAGGTGCAGTAGAAGAGATGG + Intronic
1080599398 11:33807756-33807778 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1080850264 11:36062477-36062499 AGGTGCTGCAGCTTAGGAGATGG + Intronic
1081119384 11:39246679-39246701 AGGTGCTACAGCTGAGGTGATGG + Intergenic
1081130561 11:39373829-39373851 GGGTGCTACAGCTGAGGAGATGG - Intergenic
1081136346 11:39444214-39444236 AGGTGCTGCAGCTGAGAAGATGG - Intergenic
1081415212 11:42806777-42806799 GTGTGTTGCAGGTGAAGAAAAGG + Intergenic
1081735207 11:45398337-45398359 GGGGGCTCCAGCTGGAGACAAGG + Intergenic
1081943376 11:46964838-46964860 GGGTGCTGAAGCTGAGGACATGG + Intronic
1082098672 11:48153134-48153156 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1083546526 11:63553061-63553083 GTGACCTGCAGCAGAAGAGAAGG + Exonic
1084368299 11:68718123-68718145 GGGGGCTGTAGCTGAGGAGTGGG - Intronic
1085563486 11:77492127-77492149 GGGTTCTGCAGATACAGAGATGG + Intergenic
1086750115 11:90482321-90482343 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1087384208 11:97448987-97449009 AGGTGCTACAGCTGAAAAGATGG - Intergenic
1087416458 11:97862242-97862264 AGGTGCTGCAGCTGAGTAGACGG + Intergenic
1087482852 11:98722912-98722934 AAGTTCTGCAGCTGAGGAGATGG + Intergenic
1087486904 11:98769206-98769228 AGGTGCTGCAGCTGAGCAAATGG + Intergenic
1088754782 11:112876724-112876746 GGGAGCTGGGGCTGGAGAGAGGG - Intergenic
1089761227 11:120725438-120725460 GGGTGCTGTAGCCAAGGAGATGG + Intronic
1090203138 11:124870040-124870062 GAGTGCGGCAGCTGAAGTCATGG + Exonic
1090667366 11:128923671-128923693 GGGTGCTTCATCTGAAGAGGAGG - Intergenic
1091265519 11:134268268-134268290 GGCTGCTGCAGCCGCGGAGATGG + Intergenic
1091283447 11:134395274-134395296 GGGAGCGGCAGCTGGAGAGAAGG + Intronic
1091373560 12:12405-12427 GGGTGCAGCTGCTGGAGCGAGGG - Intergenic
1091805454 12:3352838-3352860 AGGTCCTGGAGATGAAGAGAAGG + Intergenic
1091877674 12:3949733-3949755 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1092200428 12:6578897-6578919 AGGTGCTGCTGATGTAGAGAAGG - Exonic
1092627451 12:10342246-10342268 GGGTGCCGCAGCTGAGGAGATGG - Intergenic
1094436814 12:30430073-30430095 GGGTGCTTCAGCTGAGCAGATGG - Intergenic
1094582890 12:31750661-31750683 CAGTGCTGCAGCAGAGGAGATGG + Intergenic
1094598517 12:31887596-31887618 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1095696263 12:45147534-45147556 GAGTGCTGCAGCCAAGGAGATGG - Intergenic
1095826164 12:46531873-46531895 GCATGTTGCAGGTGAAGAGAAGG + Intergenic
1095923346 12:47553379-47553401 GGGTGCTGCAGCTGAGGGGATGG - Intergenic
1096024675 12:48350743-48350765 GGGAGCTGCGGCTGGAGGGAGGG - Exonic
1096436183 12:51592118-51592140 GGGTGCTGCTGCTGATGGTAAGG - Intronic
1096605610 12:52763384-52763406 GGATGCAGCAGCGGAAGTGACGG + Intergenic
1097555991 12:61138349-61138371 AGGTGCTGCTGCTGAGGAAATGG + Intergenic
1098435014 12:70459593-70459615 TGGTGCTGCAGCTAAGGAGATGG + Intergenic
1098435481 12:70464156-70464178 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1099065978 12:77979915-77979937 GGGTGCTGCAGCTGAGGAGAAGG + Intronic
1099468012 12:83010566-83010588 GGGTGCCATAGCTGAGGAGATGG - Intronic
1099517479 12:83615325-83615347 GGGTGCTTCAGCCAAGGAGATGG - Intergenic
1099896527 12:88654611-88654633 GGATGCTGCAGCTGAGAAGATGG - Intergenic
1100068216 12:90677787-90677809 AAGTGCTGCAGCTGAATATAAGG + Intergenic
1100112259 12:91259943-91259965 GGGTCCAGTAGGTGAAGAGAGGG - Intergenic
1100705073 12:97191698-97191720 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1101022799 12:100571099-100571121 AGGTGCTGCAGCTGAAAAGATGG + Intergenic
1101098013 12:101363596-101363618 TGGTGCTGTTGCTGAAGAGAAGG + Exonic
1102082762 12:110111838-110111860 GGGTGCTGCAGCTGAAGTGATGG - Intergenic
1102444869 12:112994275-112994297 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1102880127 12:116478433-116478455 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1103201247 12:119089646-119089668 TGGTGCTGGAGCTGCAGAGTTGG + Intronic
1103733579 12:123044253-123044275 GGGTGCTGCTGCTGAAATGGTGG - Intronic
1104120102 12:125790796-125790818 GGTTGCTGCAGCTGAGGAGATGG - Intergenic
1104447190 12:128844147-128844169 GGATGCTCCAGCAGAGGAGAAGG + Intergenic
1104611067 12:130228231-130228253 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1104651888 12:130540742-130540764 GGGTGCTGCAGCCAAGAAGATGG - Intronic
1104830503 12:131747626-131747648 AGGTGCTGCAGCTGGAGGGCAGG + Intronic
1104880780 12:132068919-132068941 GAGGGCTGCAGCTGAAGTGCTGG + Intronic
1105451100 13:20501112-20501134 GGCTGCTGCAGCCAAGGAGATGG - Intronic
1106095759 13:26641497-26641519 GGGTGCTATAGCTCAGGAGATGG + Intronic
1106462769 13:29987768-29987790 GGGTGTTCCAGGAGAAGAGAAGG - Intergenic
1106841467 13:33688921-33688943 GGGTGCTGCAGCCATGGAGATGG - Intergenic
1108189934 13:47927845-47927867 GGGTGCTGAGGGAGAAGAGATGG - Intergenic
1108383265 13:49874588-49874610 GGGTGCTACAGCCAAGGAGATGG - Intergenic
1108751280 13:53450673-53450695 GTGTGCTGCAGCGAAGGAGATGG - Intergenic
1108752051 13:53457772-53457794 GGGTGCTGCAGTTGAGAGGATGG + Intergenic
1108855621 13:54789379-54789401 AGGTGCTGCAGCTGAGGAGACGG + Intergenic
1109119029 13:58430102-58430124 GGGTGCTCCAGTTGAGAAGATGG + Intergenic
1109140569 13:58710031-58710053 GGGTGCTGCAGCTAAGGACATGG - Intergenic
1109292034 13:60488118-60488140 GGGTGCTACAGCTGAAGAGATGG + Intronic
1109428824 13:62205166-62205188 GGATGCTGCAGCTGAAGAGATGG + Intergenic
1109591938 13:64496077-64496099 GGGTGCTGCATCCAATGAGATGG - Intergenic
1109698332 13:65992146-65992168 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1109912290 13:68930462-68930484 GGGTGCTGTAGCAGAGGAGAAGG + Intergenic
1111197074 13:84888826-84888848 GGGTGCTGCTTCTAAGGAGATGG + Intergenic
1111207024 13:85024346-85024368 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
1111253917 13:85641035-85641057 AGATGCTGCAGCTGAGGAGATGG - Intergenic
1111290498 13:86162447-86162469 AGGTGCTGCCACTGAAGAGTTGG + Intergenic
1111352432 13:87048725-87048747 TGGTGCTGCAGCTGAGGAGATGG + Intergenic
1111430385 13:88142377-88142399 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1111462040 13:88558178-88558200 TGGTGATGCAGTTGAGGAGATGG + Intergenic
1111488582 13:88938410-88938432 GGATGCTGCAGCGGAGGAGATGG - Intergenic
1111538996 13:89646862-89646884 AGATGCTACAGCTGAGGAGATGG - Intergenic
1111592452 13:90367765-90367787 GGGTTCTGCAGCTGAGGAGATGG - Intergenic
1111669099 13:91305700-91305722 GGGCGCTGCAGCTGAGGAGTTGG - Intergenic
1111723559 13:91976433-91976455 GGGTGCCACTGCTGAGGAGATGG + Intronic
1112136032 13:96578512-96578534 GGCTGCTGAAGCTGGAGAGTAGG + Intronic
1112921140 13:104614304-104614326 GGGTGCTGCAGCTAAAGAGATGG - Intergenic
1113263028 13:108587047-108587069 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1113341388 13:109429576-109429598 GGGTGCTGCAGCCAAGAAGATGG + Intergenic
1113601708 13:111574008-111574030 GGGTGCTGCAGCTGAGGAGACGG + Intergenic
1113932677 13:113976585-113976607 GGGAGCTGCAACTGAAGATGAGG + Intergenic
1114315197 14:21503403-21503425 GGGTGCTGTGGCAGAAAAGAAGG - Exonic
1114850789 14:26380147-26380169 GGGTGTTGCAGCAGAAGCAATGG - Intergenic
1115596333 14:34913083-34913105 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1116403125 14:44533451-44533473 GGGTGCAGAAGCAGTAGAGATGG + Intergenic
1117614459 14:57519281-57519303 TGATGCTGCAGCTGGACAGAGGG - Intergenic
1118380079 14:65210408-65210430 GGGTGCTGCAGCTGGGGAGATGG - Intergenic
1118875745 14:69783532-69783554 GAGTGTTCCAGGTGAAGAGAAGG + Intronic
1119882572 14:78112728-78112750 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1120313851 14:82866437-82866459 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1122000083 14:98640707-98640729 GGGTGCTGCAGTCGAGGAGGTGG - Intergenic
1122061690 14:99140345-99140367 GGGTGCTGGGGCTGCAGAGATGG - Intergenic
1122848487 14:104513702-104513724 GGGGGCTGCTGCTGACGCGATGG - Intronic
1202890684 14_KI270722v1_random:154389-154411 GTGGGCTGTAGCTGCAGAGAAGG - Intergenic
1124060578 15:26290233-26290255 GGGTGCTGTAGCCAAGGAGATGG - Intergenic
1124062262 15:26305427-26305449 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124062838 15:26310653-26310675 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1124091702 15:26610289-26610311 GGGTGCTTCAGCTGAGGACATGG - Intronic
1124475104 15:30026336-30026358 GGGTTCTGCAGCAGAGGAGATGG + Intergenic
1124486250 15:30119777-30119799 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1124541324 15:30588762-30588784 GGGTGCTGCAGCTAAGGAGATGG + Intergenic
1124547976 15:30650260-30650282 GGGTACTGCAGCTAAGGAGATGG + Intronic
1124757334 15:32418825-32418847 GGGTGCTGCAGCTAAGGAGATGG - Intergenic
1124937330 15:34185688-34185710 AGGTGCTGCAGCTCAGGAAATGG + Intronic
1125236531 15:37520541-37520563 GGGTGGTACAGATGGAGAGAAGG + Intergenic
1125365878 15:38915440-38915462 GGGTGCTGCAGCTGAGGAAATGG - Intergenic
1125534739 15:40436555-40436577 GGGTACTGCAGCCTGAGAGAGGG - Intergenic
1126522710 15:49614908-49614930 GGGTGCTGCAGCCGAGGAGATGG - Intronic
1126868519 15:52962482-52962504 GGGAACTGCAGCAGAATAGATGG - Intergenic
1127082577 15:55395032-55395054 GGGTGCTGCAGCCAAGGACATGG - Intronic
1128309611 15:66622118-66622140 GGGGACTGCAGCCAAAGAGACGG + Intronic
1128558108 15:68645375-68645397 TGGAGCTGCAGCTGGAGTGAAGG - Intronic
1128647662 15:69388913-69388935 GTGTGCTTCAGCTGGGGAGATGG - Intronic
1129361659 15:75028332-75028354 GGGTGCAGCAGCTGGACAGGAGG - Exonic
1129749815 15:78054131-78054153 AGGAGCTTCAGCAGAAGAGATGG - Exonic
1130177818 15:81593275-81593297 GAGAGCTGGAGCTGAGGAGAAGG + Intergenic
1130421676 15:83754150-83754172 GGTTGTTGCAACTGAGGAGAGGG - Intronic
1132017967 15:98335825-98335847 GGGTGCTGCGGCCGAGGAGATGG - Intergenic
1132519078 16:379155-379177 GGGAGCTGCAGCAGAGGGGAGGG - Intronic
1132574187 16:657139-657161 GGGAGCAGGAGCTGAAGAGCAGG - Exonic
1132586569 16:708137-708159 GGGTGCTCCAGGTGAAGGGAGGG - Intronic
1132586587 16:708190-708212 GGGAGCTCCAGGTGAAGGGAGGG - Intronic
1132878304 16:2149859-2149881 GGGGGCTGCAGGTGAGGAGCAGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133886158 16:9829648-9829670 GGGTGCTGCAGAAGATGAAAAGG + Exonic
1134350102 16:13429408-13429430 GGGTAATGCAGCAGAAGACAAGG - Intergenic
1134355255 16:13476390-13476412 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1134597386 16:15506805-15506827 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1134599339 16:15521128-15521150 GCGTGCTGCAGCCAAGGAGATGG - Intronic
1134888426 16:17816302-17816324 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1135075563 16:19390442-19390464 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1135166240 16:20141566-20141588 AGGTCCTGCAGCTCAAGGGATGG + Intergenic
1135921340 16:26651449-26651471 AGGTGATGCAGCTGAGGAGATGG + Intergenic
1136345722 16:29674465-29674487 GGGTGCTGCAGGAGTGGAGAAGG - Intronic
1136392647 16:29974897-29974919 GGGTGCTTCAGCTAATCAGATGG + Intronic
1136870406 16:33802583-33802605 GGGTGGGACATCTGAAGAGAGGG - Intergenic
1137701504 16:50501225-50501247 GGATTCTGCAGGTGGAGAGAAGG + Intergenic
1137825570 16:51491588-51491610 GGAAACTGAAGCTGAAGAGATGG - Intergenic
1138273353 16:55712114-55712136 GGGTGAGGAAGCTGCAGAGAGGG - Intergenic
1138742991 16:59332256-59332278 AGGTGCTACAGCTGATGAGATGG - Intergenic
1139418363 16:66832258-66832280 GGGTGGTGGTGCTGAAGACAAGG + Intronic
1139522292 16:67490899-67490921 GGGTGATGCAGGTGAGAAGACGG - Intergenic
1139683180 16:68581160-68581182 GGATCCTGCAGCTGTTGAGAGGG + Intergenic
1140014049 16:71164859-71164881 AGATGCTGCAGTTGGAGAGAGGG - Intronic
1140019729 16:71226924-71226946 GGGTGCTGCAGCTGTGGAGATGG - Intronic
1141622990 16:85247033-85247055 GGGTGGGGCAGGTGACGAGATGG - Intergenic
1141825300 16:86474805-86474827 GGTTGCTGGGGTTGAAGAGAGGG + Intergenic
1142115103 16:88352419-88352441 GGGTGCTGCAGGTGCACAGAGGG + Intergenic
1142232758 16:88907438-88907460 GGGTGCGGAATCTGACGAGAAGG + Intronic
1203101767 16_KI270728v1_random:1313467-1313489 GGGTGGGACATCTGAAGAGAGGG + Intergenic
1142930242 17:3278332-3278354 GGGTGCTGGAGCAGGAGAGCTGG + Exonic
1142931847 17:3291997-3292019 GGGTGCTGGAGCAGGAGAGCTGG + Exonic
1142945265 17:3421149-3421171 GGGTGCTGGAGCAGGAGAGCTGG - Exonic
1143355559 17:6325531-6325553 GGTTGCTGCACCTTAAGAGCAGG + Intergenic
1143364667 17:6398539-6398561 GGGTGATGCAGCAGAAGCCAAGG + Intronic
1143463710 17:7121391-7121413 AGGTGCTGCAGCCAAAGAGATGG + Intergenic
1143520520 17:7441758-7441780 GTGGGCTGCAGGTGGAGAGAGGG - Exonic
1143847393 17:9782928-9782950 GCCTGCTGCAGGTGGAGAGAAGG + Intronic
1144133025 17:12266293-12266315 GGTTTCTGCAACTGAAAAGATGG + Intergenic
1144608518 17:16688923-16688945 AGATGCTGCAGCCGAGGAGATGG - Intergenic
1144963345 17:19059467-19059489 AGGTGCTGCAGCTGAGGGGATGG + Intergenic
1144964345 17:19066573-19066595 AGGTGCTGCAGCTGAGGGGATGG - Intergenic
1144971814 17:19115058-19115080 AGGTGCTGCAGCTGAGGGGATGG - Intergenic
1144983621 17:19185571-19185593 AGGTGCTGCAGCTGAGGGGATGG + Intergenic
1144984604 17:19192668-19192690 AGGTGCTGCAGCTGAGGGGATGG - Intergenic
1145016239 17:19400182-19400204 GGGTGGTACAGCAGAGGAGAGGG + Intergenic
1145128289 17:20319845-20319867 AGATGCTGCAGCCGAGGAGATGG - Intergenic
1145196319 17:20897363-20897385 AGATGCTGCAGCCGAGGAGATGG + Intergenic
1146295480 17:31646705-31646727 GGGTGCTGCAGCAGAGGAGATGG + Intergenic
1146295570 17:31647486-31647508 AGGTGCTGCGGCAGAGGAGATGG - Intergenic
1148354702 17:46968129-46968151 GCTTGTTGGAGCTGAAGAGAAGG - Intronic
1149271001 17:54977031-54977053 GGGTGCCGCAGCCAAGGAGATGG - Intronic
1149411345 17:56410685-56410707 GGGGGCTGGAGATGGAGAGATGG - Intronic
1149746782 17:59106610-59106632 CGGCGCTGGACCTGAAGAGATGG - Exonic
1150285185 17:63950191-63950213 GGGTGAGGCCTCTGAAGAGAAGG + Intronic
1150465807 17:65391755-65391777 GGGAGTTCCAGCTGTAGAGAAGG + Intergenic
1150505356 17:65693188-65693210 GGGTTCTGCAGGTGAAGGCAAGG - Intronic
1150542354 17:66115769-66115791 GGGTGCTGCAGCCAAGGAGATGG - Intronic
1152119128 17:78407226-78407248 GGGGGCTGCTGCTGAGCAGAGGG + Intronic
1152888259 17:82865220-82865242 GTGTGCTGGTGCTGAAGGGAGGG + Intronic
1152888270 17:82865272-82865294 GTGTGCTGGTGCTGAAGGGAGGG + Intronic
1152901845 17:82946896-82946918 GGGTCCGTCAGCTGAAGTGAAGG + Exonic
1152941814 17:83176794-83176816 GGCTGCAGGAGCTGCAGAGAGGG + Intergenic
1153646487 18:7200537-7200559 AGGTGCTGCAACCAAAGAGATGG - Intergenic
1154194162 18:12253965-12253987 GGGTGGGGCAGGTGAGGAGACGG - Intergenic
1154219516 18:12440099-12440121 AGGTGCAGCAGCTGCAGTGAGGG - Intergenic
1154230889 18:12555155-12555177 GGTGCCTGCAGCTGAGGAGATGG - Intronic
1154295530 18:13143681-13143703 GGGTGCTGCAGCTGAAGAGATGG + Intergenic
1154472374 18:14717006-14717028 CGGTGCTGCAGCCAAGGAGAGGG - Intergenic
1155053930 18:22169397-22169419 GGGCGCTGGAGGTGAAGAGGAGG - Intergenic
1155446367 18:25916873-25916895 TGGTGCTGCAGCCAAGGAGATGG - Intergenic
1155790848 18:29968843-29968865 GGATGCTGCAGCTGAGGAGATGG + Intergenic
1155821436 18:30382903-30382925 CGGTGCTGCAGCCAAGGAGATGG + Intergenic
1156645681 18:39159631-39159653 GGGTGCTGCAGCTGAGGAGAAGG + Intergenic
1156788426 18:40943486-40943508 AGGTCCTGCAGCAGAGGAGATGG + Intergenic
1157161318 18:45316766-45316788 GGGAGCTGGAGGTGAAGGGAAGG - Intronic
1157348106 18:46858857-46858879 GAATGCTGCAACTGAAGAGATGG + Intronic
1157504485 18:48217021-48217043 GGGTGATGCAGCTGAAGCCAAGG + Intronic
1158522519 18:58183548-58183570 GGGTGCTGCAGGTGAGCAGCTGG - Intronic
1159105103 18:63995832-63995854 GGGTGCTACAGCTGAGGAGATGG + Intronic
1159188793 18:65015226-65015248 AGATGCTACAGCTGAAGAGATGG - Intergenic
1159327284 18:66938575-66938597 GGGTGCTGCAGCCAAGGAGGTGG - Intergenic
1159333892 18:67038533-67038555 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1159433960 18:68391773-68391795 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1159453132 18:68627477-68627499 GGTTTCTGCAGGTGAAGAGAAGG + Intergenic
1159669907 18:71210578-71210600 GGGTGCTGCAGCTGAGGAGACGG - Intergenic
1160389785 18:78521469-78521491 GGGTGCTGCTGAGGCAGAGAAGG + Intergenic
1160408368 18:78658696-78658718 CTGTGCTGGAGCTGCAGAGAGGG + Intergenic
1160665643 19:326786-326808 AGGTGCAGCAGCTGCATAGAAGG - Intronic
1160901314 19:1430099-1430121 GAGTGCTGGAGAGGAAGAGAGGG + Intronic
1161832944 19:6623049-6623071 GGGTGCTGCAGCTGAGGAGGTGG + Intergenic
1161897734 19:7095191-7095213 AGCTGCTGCAGCTGAGGAGGTGG - Intergenic
1162786123 19:13036100-13036122 GGGGGCTGCGGCTGGAGGGAGGG + Intronic
1163584016 19:18154314-18154336 GGGTACTGCAGCTGAGGAGGAGG - Intronic
1164866095 19:31605642-31605664 GGGTGTTGCAATTGCAGAGAGGG + Intergenic
1165675503 19:37719370-37719392 GGGTGCTGGAGCTGCGGAGGAGG - Exonic
1165685684 19:37817683-37817705 GGGTGCTGGAGCTGCCGAGGTGG + Intergenic
1165704693 19:37967167-37967189 GGGTGCTGCAGCAGAGGCCACGG - Intronic
1165717548 19:38056188-38056210 GGGTGGTGCTGGTGCAGAGAAGG - Intronic
1165846431 19:38820872-38820894 GGGTGCTGCAGATGTGGAAACGG - Intronic
1165907662 19:39203645-39203667 GGGTGCTGGGGGTGAGGAGAAGG + Intronic
1166412518 19:42565618-42565640 GGCTGCTGCAGGTGCAGACATGG + Intergenic
1166439938 19:42804521-42804543 GGGTGCTGCAGCCAAGGAGGTGG + Intronic
1166468460 19:43056056-43056078 GGGTGCTGCAGCCAAGGAGGTGG + Intronic
1166474917 19:43115284-43115306 GGGTGCTGCAGCCAAGGAGGTGG + Intronic
1166638625 19:44474031-44474053 GAGGGTTGCAGGTGAAGAGATGG + Intergenic
1166953993 19:46449556-46449578 GGGCGCTGCCGCTGAGGAGATGG + Intergenic
1167004050 19:46763973-46763995 GGGGCCTGGAGCTGGAGAGAGGG + Intronic
1167033231 19:46977463-46977485 CGTTTCTCCAGCTGAAGAGAGGG - Intronic
1167240022 19:48338207-48338229 GGGAGCTGCAGAGGAGGAGACGG - Intronic
1167671493 19:50856228-50856250 GGGTGCAGCACCTGCAGAGGGGG - Exonic
1168073291 19:53964285-53964307 GGGAGCAGCAGCCAAAGAGAAGG - Intronic
1168408296 19:56121725-56121747 GGGAGGTGCAGCGGCAGAGAAGG - Intergenic
1168519816 19:57040397-57040419 GGAAGCTGCAGCTGAAGCAAGGG + Intergenic
1202666107 1_KI270708v1_random:121227-121249 GTGGGCTGTAGCTGCAGAGAAGG - Intergenic
925204641 2:1995817-1995839 GGCTGCTGCAGGTGACGAGGTGG + Intronic
925274473 2:2638852-2638874 CGGCGCTGCAGCTGAGGAGGGGG + Intergenic
925931003 2:8707886-8707908 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
925983852 2:9199078-9199100 GGGAGCTGATGCTGAAGAGGTGG - Intergenic
926008734 2:9392306-9392328 GGCTGCTGCAGCAGGAGACAGGG - Intronic
926041119 2:9674028-9674050 GCGTGCTGAGGCTGGAGAGAAGG + Intergenic
926346413 2:11950385-11950407 GGATGCTGCAGCCAAGGAGACGG - Intergenic
926346812 2:11954478-11954500 GGGTGCTTCAGGTGAGCAGATGG + Intergenic
926353769 2:12021266-12021288 AGGTGCTACAGCTGAGGAGATGG - Intergenic
927091686 2:19717310-19717332 GGGTGATGCAGCTGAAGCCAAGG + Intergenic
927412578 2:22843974-22843996 GGGGGATGCAGCTGAAGCCAAGG + Intergenic
928472669 2:31589781-31589803 AGAAGCTGCAGCTGAAGGGAAGG + Intergenic
928646283 2:33356103-33356125 GGGTGCTACAGCCAAGGAGATGG + Intronic
928672753 2:33619246-33619268 GGTTGCTGCAGCCAAGGAGATGG + Intergenic
928838737 2:35579693-35579715 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
928840080 2:35595478-35595500 AGGTGCTGCAGCTGAGCAGATGG + Intergenic
929397119 2:41535749-41535771 GGGTGCTGCAGCCAAAGAGATGG - Intergenic
929490588 2:42392592-42392614 GGGTGCTACAGCCAAAGAGATGG + Intronic
929852132 2:45601878-45601900 AGGTGCTACAGCTGGATAGAGGG - Intronic
929885887 2:45878080-45878102 AGGTGCTGCAGCCAAGGAGATGG - Intronic
929998481 2:46845187-46845209 TGGAGCAGCAGTTGAAGAGAGGG + Intronic
930086328 2:47500027-47500049 GGGTGCTGCAGCCAAGGAGATGG - Intronic
931369510 2:61649326-61649348 GGGTGCTACAGCTGAGAATAGGG + Intergenic
931748010 2:65307712-65307734 GGCTGCTCCAGCTGAGGAGATGG + Intergenic
931859946 2:66344558-66344580 GGGTGGGGCAGCTGGTGAGATGG + Intergenic
931964484 2:67518236-67518258 GGGTGCTACAGCTGAGGAGATGG + Intergenic
932022916 2:68106058-68106080 AGGTGCTGCAGCCAAGGAGAAGG - Intronic
932460582 2:71879521-71879543 GGACTCTGCAGCTGCAGAGATGG + Intergenic
932480071 2:72033734-72033756 GGGTGCTTCGGCTGGAGAGGAGG - Intergenic
932828868 2:74968818-74968840 GGGGGCTGCAGCAGAAAAGGAGG - Intronic
932960047 2:76402985-76403007 GGGTGCAGCAGCCAAGGAGATGG - Intergenic
933453570 2:82491632-82491654 GGGTGCTGCAGCAGAGGAGATGG + Intergenic
933463622 2:82621781-82621803 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
933810936 2:86032319-86032341 GGATGCTGAAGCTGAGGAGGGGG - Exonic
934130751 2:88946485-88946507 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934132768 2:88965448-88965470 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
934135391 2:88991579-88991601 AGGTACTGCAGCCGAGGAGATGG - Intergenic
934137327 2:89009165-89009187 AGGTGCTGCAGCTGTGGAAATGG - Intergenic
934140775 2:89045190-89045212 AGGTGCTGCAGCCGAGGAGACGG - Intergenic
934146418 2:89099046-89099068 AGGTGCTGCAGCCGAGGAGATGG - Intergenic
934148145 2:89116529-89116551 AGGTGCTGTAGCTGAGGAGATGG - Intergenic
934221142 2:90084082-90084104 AGGTGCTGTAGCTGAGGAGATGG + Intergenic
934222849 2:90101529-90101551 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
934228459 2:90155352-90155374 AGGTGCTGCAGCCGAGGAGACGG + Intergenic
934233775 2:90211324-90211346 AGGTGCTGCAGCTGAGGAAATGG + Intergenic
934544561 2:95204034-95204056 GGGTGCTGCAGCTGTGAAGATGG - Intergenic
935114707 2:100125550-100125572 TGGTACTGGAGGTGAAGAGAAGG + Intronic
935129873 2:100253644-100253666 AGAGGCTGCAGCTGAAGGGAGGG - Intergenic
935210740 2:100937936-100937958 GGGGGCTGCAGGTGAGAAGAGGG + Intronic
935296435 2:101653680-101653702 GGGTGCTGCAGCCTAGGAGATGG - Intergenic
935762320 2:106332759-106332781 GTGTGCTGCAGCCAAGGAGATGG - Intergenic
935765649 2:106365104-106365126 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
935794527 2:106628545-106628567 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
935962221 2:108437015-108437037 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
935962846 2:108444335-108444357 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
936026282 2:109033463-109033485 AGGTGCTGTAGCTGAGAAGATGG + Intergenic
936467701 2:112767876-112767898 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
937070226 2:119057510-119057532 GGGTGCTGGAGGAGCAGAGAGGG + Intergenic
937468705 2:122157015-122157037 GGGTGCAGCTGTTGAAAAGAGGG + Intergenic
938155840 2:128939366-128939388 GGATGAGGCAGCTGCAGAGATGG - Intergenic
938175894 2:129128477-129128499 GGGTGATGCAGCTAAGGAAATGG - Intergenic
938289082 2:130140086-130140108 AGGTGCTGCAGCTGAAAGGCAGG + Exonic
938308543 2:130270001-130270023 GGGTGCTGCAGAACAAGTGAAGG - Intergenic
938400283 2:130985428-130985450 GGGTGCTGCAGCCGAGGAAATGG + Intronic
938446787 2:131386835-131386857 GGGTGCTGCAGAACAAGTGAAGG + Intergenic
938708406 2:133953990-133954012 GGGTGCTACAGCTGAGGAGCTGG - Intergenic
938928883 2:136068377-136068399 GGGTCTTGCAGCTGGAGGGAAGG + Intergenic
939649054 2:144739683-144739705 GGTTGCTGCTGCACAAGAGAGGG + Intergenic
939802097 2:146722230-146722252 GGCTGCTGCAGCTGGGAAGATGG - Intergenic
939977305 2:148733187-148733209 GGATGATGAAGCTGGAGAGAGGG + Intronic
940492785 2:154386187-154386209 CAGTGATGCAGCTGAGGAGATGG + Intronic
940493265 2:154392230-154392252 GGTTGCTGCAGCCAAGGAGATGG + Intronic
941309516 2:163911920-163911942 AGGTGCTACAGCTGAGGAAATGG - Intergenic
942062474 2:172240517-172240539 GGTTGCTGAGGCTGAAGAGGAGG - Intergenic
942386788 2:175451249-175451271 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
943023973 2:182606950-182606972 AGGTGCTGCCGCTGAGGAGATGG + Intergenic
943436079 2:187867268-187867290 GGGTCATGCAGCTGAAGACTTGG - Intergenic
943436273 2:187868693-187868715 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
943436348 2:187869224-187869246 GTGTCCTGCAGCTGAAGACCCGG - Intergenic
943436407 2:187869683-187869705 GGGTCTTGCAGCTGAAGACCTGG - Intergenic
943443970 2:187959850-187959872 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
943551010 2:189339579-189339601 AGATGCTGCAGCTGAGGAGATGG + Intergenic
943687747 2:190836942-190836964 GGGTGCCACAGCTGCAGAGAGGG - Intergenic
943940007 2:193980748-193980770 GGGTGTTGCAGCCAAGGAGATGG - Intergenic
944856010 2:203767547-203767569 AGGTGCTGCAGCTGAGAAGGTGG - Intergenic
945366200 2:208957195-208957217 TGGTGCTGCAGCCAAGGAGATGG + Intergenic
945366988 2:208966328-208966350 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
945737799 2:213622482-213622504 GGGTGCTGCAGCAGAGGCCATGG - Intronic
945875620 2:215275048-215275070 GGGAGTTGCAGGTGAAGATAAGG + Intergenic
946201660 2:218074042-218074064 GGGAGCTGCAGAGGAGGAGAGGG + Intronic
946672561 2:222121755-222121777 TGGAGCTGCAGCTGGAGAGGTGG - Intergenic
947151070 2:227116065-227116087 AGGTGCTGCAGCTGAGGAGTTGG + Intronic
947483123 2:230521559-230521581 AGGTGCTGCAGCCAAGGAGATGG - Intronic
947585209 2:231351847-231351869 GGGTGCTGGTGGTGAAGGGAGGG - Intronic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
948288945 2:236810044-236810066 AGGTACTGCAGTTGAAGAGATGG - Intergenic
948818307 2:240525207-240525229 GGGTGCTGCAGCTGAGGAGCTGG - Intronic
948821592 2:240552141-240552163 TGGAGGTGCAGCTGAAGAGATGG - Intronic
949070394 2:242020963-242020985 GGGTCCTGCAGCTGGAGACCCGG + Intergenic
949070803 2:242022915-242022937 GGGTGGTGCAGCTGGAGACCTGG + Intergenic
1169337905 20:4772298-4772320 AGGTGCTGCAGCTAAGAAGACGG - Intergenic
1169418095 20:5434489-5434511 TGGTGCAACAGCTGAAGAAAAGG + Intergenic
1170038643 20:12017180-12017202 GGATGCAGCAGCTGAGGAGATGG - Intergenic
1170231145 20:14048181-14048203 TCATGCTGCAGCTGAGGAGATGG + Intronic
1170474149 20:16698288-16698310 CTGTGCTGCAGCTGAGGAGATGG - Intergenic
1170491925 20:16886191-16886213 GGGTGCTACTGCTGCAGAGAGGG - Intergenic
1170928740 20:20749171-20749193 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1171025699 20:21628680-21628702 CAGTGCTGCAGCTGAGGAAATGG - Intergenic
1171255255 20:23685412-23685434 GGCTGCTGCAGCTGAAGGCTTGG + Intergenic
1171262591 20:23747334-23747356 GGCTGCTGCAGCTGAAGGCCTGG + Intergenic
1171283182 20:23918314-23918336 GGCTGCTGCAGCTGAAGGCCTGG + Intergenic
1171285144 20:23930749-23930771 AGGTGCTGCAGCTAAGAAGATGG + Intergenic
1171285699 20:23936583-23936605 GGGTGCCACAGCAGAGGAGATGG + Intergenic
1171288194 20:23960810-23960832 AGGTGCTGCAGTTGAGGAGATGG + Intergenic
1171288645 20:23966550-23966572 GAGTGCTGTAGCTGAGGAGACGG + Intergenic
1171357306 20:24557953-24557975 AGGTGCTGCAGCCGAGGAGATGG + Intronic
1171357843 20:24563952-24563974 GGGTGTTGCAGCCACAGAGATGG - Intronic
1171358798 20:24572120-24572142 CAGTGCTACAGCTGAGGAGATGG - Intronic
1171394924 20:24825921-24825943 GGGGCCTACAGCTGGAGAGATGG - Intergenic
1171466057 20:25328827-25328849 AGGTGCTGCTGTGGAAGAGAAGG - Intronic
1171946795 20:31386053-31386075 GGTTGCAGTGGCTGAAGAGAAGG + Intronic
1172012111 20:31851552-31851574 TGGTGCTGCAGATGGAGGGAGGG + Intronic
1172598489 20:36167311-36167333 GGGAGCTGATGCTGAATAGATGG + Intronic
1172966047 20:38836014-38836036 GGGCCCAGCAGCTGAAGAAATGG + Exonic
1173367629 20:42401606-42401628 GGGTTCATCAGCTGCAGAGAAGG - Intronic
1173441686 20:43083057-43083079 GGGCGCTGCAGCTGAGAAGATGG - Intronic
1173570093 20:44070381-44070403 CGGTGCTGCTGCTGACGGGACGG - Intergenic
1174073798 20:47917838-47917860 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1174153569 20:48502667-48502689 GGGTCGTGTAGCTGGAGAGAGGG - Intergenic
1174173075 20:48628963-48628985 GAGGGCTGCAGAGGAAGAGAGGG + Intronic
1174543054 20:51304757-51304779 TGGTGCAGCAGCAGAAGAGAAGG + Intergenic
1174787732 20:53448187-53448209 GGGTGCTGCAGCTGAGGAAAGGG + Intronic
1174788439 20:53455073-53455095 AGGTGCTGCAGCTCAGGAGATGG - Intronic
1175158196 20:56988430-56988452 AGGGGCTGCAGCTGAAGCCAAGG - Intergenic
1175891257 20:62317019-62317041 TGATGCTGCAGCGGAAGGGAGGG + Exonic
1175910150 20:62401399-62401421 GGGCGCTGCTGCTGACGGGACGG + Intronic
1176514926 21:7776944-7776966 GGGTGCTGCTGCCCAGGAGATGG - Intergenic
1176663477 21:9662188-9662210 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1176802117 21:13440893-13440915 CGGTGCTGCAGCCAAGGAGAGGG + Intergenic
1177198862 21:17931079-17931101 GGTTGCTGCAGTTGGAGAGGGGG - Intronic
1177282207 21:18995130-18995152 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1177548159 21:22585904-22585926 AGGAGTTGCAGCTGAGGAGATGG - Intergenic
1177640596 21:23839879-23839901 TGGGGCGGCAGCTGAAGAGATGG + Intergenic
1177861690 21:26462174-26462196 GGTTTCTGCAGCTTAAGTGAGGG + Intergenic
1178648981 21:34407003-34407025 GGGTGCTGCTGCCCAGGAGATGG - Intronic
1178790064 21:35691608-35691630 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1178835479 21:36093980-36094002 GGGTGCTGCAGCAGAGGAGATGG - Intergenic
1179007726 21:37529853-37529875 GGGTGCTGGAGCTGCACACACGG - Intergenic
1179236508 21:39552021-39552043 GGGTGCTGCAGCCCAGGAGATGG + Intergenic
1181009793 22:20033391-20033413 GGGTCCTGCAGCTGAACTGGGGG + Intronic
1181014038 22:20058214-20058236 GGTTGCAGGCGCTGAAGAGACGG - Intronic
1181108368 22:20587736-20587758 AGGTGCTGCAGCTGAAAGGCAGG + Intergenic
1181390769 22:22579351-22579373 CAAGGCTGCAGCTGAAGAGATGG + Intergenic
1181726583 22:24815340-24815362 GAGTCCCGCAGCCGAAGAGATGG + Intronic
1181730005 22:24838298-24838320 GGGTGCTGCAGCTGAAGAGAAGG + Intronic
1182370256 22:29805611-29805633 GGGTGTTGCAGGTGAGGTGAAGG - Intronic
1182814677 22:33150318-33150340 GGGGCTTGCAGCTGAGGAGATGG - Intergenic
1183335056 22:37241618-37241640 TGGTGGTGTAGCTGATGAGAAGG + Exonic
1183370205 22:37427751-37427773 GGGCGCTGCAGCTGCAGCGGCGG - Intergenic
1184130483 22:42514170-42514192 GGGTGCTGGAGAGGGAGAGACGG - Exonic
1184140659 22:42575992-42576014 GGGTGCTGGAGAGGGAGAGACGG - Intergenic
1184507053 22:44910190-44910212 GGGTGCTGCAGTTGGGGACATGG + Intronic
1184519827 22:44986814-44986836 GGGTCCTGGAGCTGGGGAGAGGG + Intronic
1184846946 22:47093933-47093955 GGGTGCTGCAGCCCAGGAGGTGG + Intronic
1184900322 22:47442746-47442768 CAGTGCTGCAGATGAAGAGATGG - Intergenic
1185258809 22:49850324-49850346 GGGGGCTGCTGCAGAGGAGATGG - Intergenic
949159231 3:860151-860173 GGGTGGTGCAGCTGAAGACTCGG - Intergenic
949159270 3:860440-860462 GTGTCCTGCAGCTGAAGACCTGG - Intergenic
949159322 3:860886-860908 GGGTTGTGCAGCTGAAGACTTGG - Intergenic
949439116 3:4061540-4061562 AGGTGCTGCAGCTGAGGAGATGG - Intronic
949615545 3:5749950-5749972 GGGTGCTCCAGCAGATGACAGGG - Intergenic
950128063 3:10522874-10522896 AGGTTCTTCAGCTGCAGAGATGG + Intronic
950204111 3:11064819-11064841 GGGTGCTGCAGCCCAGGAGATGG - Intergenic
950205143 3:11074303-11074325 GGGTGCTGCAGTCCAGGAGATGG - Intergenic
950401618 3:12773396-12773418 AAGTGCTACAGCTGAGGAGATGG + Intergenic
950666414 3:14497955-14497977 GGGTGCTGGAGCTGCTGGGAGGG + Intronic
950847447 3:16028661-16028683 GGGAGGTGCAGTTGAAGAGAAGG + Intergenic
950900309 3:16491570-16491592 GGATGCTGCAGCTGAAGCTCAGG + Intronic
952662650 3:35870264-35870286 AGGTGATGCAGCTGAACAGATGG - Intergenic
952920533 3:38281054-38281076 GAGTGCTGCTGCTCAAGAGTGGG + Intergenic
952941771 3:38451051-38451073 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
953312529 3:41892945-41892967 GGGTGCTGCAGCTAAGGAGATGG - Intronic
953381611 3:42476708-42476730 GGGTGCGGAAACTGCAGAGAGGG - Intergenic
953802951 3:46041944-46041966 GGGTGCTGAAGCTGAGGAAATGG - Intergenic
953804306 3:46054675-46054697 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
954076825 3:48187890-48187912 GGGGGCTGCAGGCGAAGAGCAGG + Exonic
954230800 3:49215640-49215662 GGGTGCTACAGCCAAGGAGATGG + Intronic
954397129 3:50298830-50298852 GGGTGCGGCTGCTGCAGAGGTGG - Intronic
954841840 3:53518133-53518155 GGGTGCTGAAGCTGGGGAGCTGG + Intronic
955158204 3:56438419-56438441 AGGTGCTGCAGCTGAGGAGATGG - Intronic
956226029 3:66959582-66959604 GGGTGCAGCAGCTGAGGATCTGG + Intergenic
956788175 3:72660068-72660090 GGGTACAGAAGCTGAAGAGGAGG + Intergenic
957592031 3:82211619-82211641 GGGTGCTGTAGCTGAGGAGATGG - Intergenic
957914630 3:86672333-86672355 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
959005584 3:101015818-101015840 GGGTGCTGCAACATAAGAAAGGG - Intergenic
959158142 3:102692114-102692136 GACTGGTGAAGCTGAAGAGAAGG + Intergenic
959312419 3:104756107-104756129 GGGTGCTACAGCCAAGGAGATGG + Intergenic
959417794 3:106098399-106098421 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
961991874 3:131200787-131200809 GGGTGCTGCAGCCAAAAAGATGG - Intronic
962158785 3:132977383-132977405 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
962404706 3:135091050-135091072 AGGTGCTGCATCTCAAGAGAAGG - Intronic
963743758 3:149105618-149105640 CAGTGCTGCAGTGGAAGAGATGG + Intergenic
963969720 3:151416300-151416322 GGCTGCTGCATCTGGAAAGAGGG - Exonic
964378230 3:156070707-156070729 GGGTGCTGCAGTCGAGGAGATGG + Intronic
964720886 3:159765909-159765931 GGGTGCTGGAGTGGAAAAGAGGG + Intronic
964869620 3:161299022-161299044 AGGTGCTGCAGCCGAGGTGATGG + Intergenic
965015882 3:163156054-163156076 GGGTGCTGCAGCCGAGGAGATGG + Intergenic
965135643 3:164763821-164763843 GGGTGTTGCAGCAAAGGAGATGG - Intergenic
965662622 3:171057607-171057629 GGGTGCTGCGGCCAAGGAGATGG + Intergenic
965952644 3:174329655-174329677 GAGAACTGCAGCGGAAGAGATGG + Intergenic
965962803 3:174448647-174448669 AGGTGCTGCACCTGAGGAGATGG + Intronic
965984318 3:174733717-174733739 GGGTGCTGCAGCTGAGGAGATGG + Intronic
966110604 3:176396571-176396593 AGGTGCTGCAGCCACAGAGATGG - Intergenic
966152274 3:176877686-176877708 GGGCACTGCAACTGCAGAGATGG - Intergenic
967162135 3:186748237-186748259 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
967590778 3:191271398-191271420 GGGTGCTGCAGCTGAGGAGATGG - Intronic
967790750 3:193546411-193546433 GGGTGCTGCAGCTGAGAAGATGG - Intronic
968049550 3:195644771-195644793 GGGTCATGCAGCTGAAGACTCGG + Intergenic
968049611 3:195645245-195645267 GGGTCGTGCAGCTGAAGACCCGG + Intergenic
968049669 3:195645762-195645784 GGGTCGTGCAGCTGAAGACTCGG + Intergenic
968049681 3:195645856-195645878 GGGTCGTGCAGCTGAAGACTTGG + Intergenic
968097617 3:195942732-195942754 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968097629 3:195942826-195942848 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968097693 3:195943437-195943459 GGGTCGTGCAGCTGAAGACCCGG - Intergenic
968097726 3:195943674-195943696 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968097762 3:195943958-195943980 GGGTCCTGCAGCTGAAGACTCGG - Intergenic
968097791 3:195944242-195944264 GGGTCGTGCAGCTGAAGACTTGG - Intergenic
968097800 3:195944336-195944358 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968097824 3:195944526-195944548 GGGTCTTGCAGCTGAAGACTTGG - Intergenic
968097932 3:195945325-195945347 GGGTCCTGCAGCTGCAGATCCGG - Intergenic
968106017 3:196001646-196001668 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968106053 3:196001927-196001949 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968106059 3:196001973-196001995 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968106138 3:196002676-196002698 GGGTCGTGCAGCTGAAGACCTGG - Intergenic
968106174 3:196002913-196002935 GGGTCCTGCAGCTGAAGACTCGG - Intergenic
968106180 3:196002960-196002982 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968106208 3:196003197-196003219 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968106244 3:196003481-196003503 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968106346 3:196004330-196004352 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968106384 3:196004611-196004633 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968304454 3:197640126-197640148 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968304466 3:197640220-197640242 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
968304524 3:197640737-197640759 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304554 3:197640974-197640996 GGGTCATGCAGCTGAAGACTCGG - Intergenic
968304586 3:197641258-197641280 GAGTCCTGCAGCTGAAGACTCGG - Intergenic
968304620 3:197641587-197641609 GGGTCGTGCAGCTGAAGACTTGG - Intergenic
968304682 3:197642105-197642127 GGGTCTTGCAGCTGAAGACTTGG - Intergenic
968304714 3:197642340-197642362 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304746 3:197642575-197642597 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304759 3:197642669-197642691 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304776 3:197642810-197642832 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304815 3:197643140-197643162 GGGTCTTGCAGCTGAAGACTTGG - Intergenic
968304847 3:197643374-197643396 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304860 3:197643468-197643490 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304877 3:197643609-197643631 GGGTCGTGCAGCTGAAGACCCGG - Intergenic
968304890 3:197643703-197643725 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304903 3:197643797-197643819 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304944 3:197644127-197644149 GGGTCTTGCAGCTGAAGACTTGG - Intergenic
968304977 3:197644362-197644384 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968304990 3:197644456-197644478 GGGTCGTGCAGCTGAAGACCCGG - Intergenic
968305003 3:197644550-197644572 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968305022 3:197644691-197644713 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968305041 3:197644832-197644854 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968305060 3:197644973-197644995 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968305104 3:197645302-197645324 GGGTCATGCAGCTGAAGACCCGG - Intergenic
968305147 3:197645631-197645653 GGGTCCTGCAGCTGCAGACCTGG - Intergenic
968954444 4:3711054-3711076 AGGAGCTGCAGCTGAGGAGCTGG - Intergenic
969040268 4:4290303-4290325 AGCTGCTGCAGGTGAAGAGTAGG + Exonic
970574391 4:17413157-17413179 GGGTGCTGCATCTGAGAGGATGG - Intergenic
971220449 4:24700828-24700850 GGGTGATGCGACTGAGGAGAGGG + Intergenic
971359203 4:25921455-25921477 GGCTCCAGCAGCTGAGGAGATGG + Intronic
971923298 4:32971747-32971769 GGGTGCTGCAGCTGAGCAGATGG - Intergenic
972648968 4:40997222-40997244 GGGTGCTGCAGCTGAGGAGATGG - Intronic
972724468 4:41734265-41734287 GGCTGCTGCAGGTGCAAAGATGG - Intergenic
972791977 4:42381472-42381494 GGATGCTACAGCTGAGGAGATGG - Intergenic
973030531 4:45331967-45331989 CTGTGCTGCAGCTGAGGCGATGG + Intergenic
973138526 4:46736275-46736297 AGGTACTGCAGCAGAGGAGATGG + Intronic
973920774 4:55682638-55682660 AGGTACTGTGGCTGAAGAGATGG - Intergenic
974124368 4:57677453-57677475 AGGTCCTGCTGCTGAGGAGATGG - Intergenic
974453861 4:62100886-62100908 AGATGCTGCAGCTAAGGAGATGG - Intergenic
974553939 4:63418798-63418820 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
975370651 4:73582704-73582726 GGGTTCAGCAGATGTAGAGATGG + Intronic
976632184 4:87250284-87250306 GGACGCTGCAGCTGAGGAGATGG - Intergenic
976632760 4:87255933-87255955 GGGTGCTGCAGCTGAGAAGATGG - Intergenic
976633407 4:87263059-87263081 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
976659470 4:87524679-87524701 AGGTGCTGCAGCTGAGGAGATGG - Intronic
978747687 4:112212337-112212359 AGGTGCTACAGCTGAGGAGATGG + Intergenic
978748173 4:112218780-112218802 GGGTGTTGCACCTGAGGAGATGG + Intergenic
978809761 4:112837362-112837384 GTCTGCTGCAGCTGCAGGGATGG + Intronic
979078890 4:116309782-116309804 GGGTGCTGCATTTGAGGACATGG + Intergenic
980311777 4:131140742-131140764 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
981147260 4:141339689-141339711 GGGTGCTGCAACTGAGGAGATGG - Intergenic
981279103 4:142936536-142936558 GTGTCCTGGAGCTAAAGAGAGGG - Intergenic
982102050 4:151977606-151977628 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
982448324 4:155521574-155521596 GGGTGCTGCAGCCCAGGAGATGG + Intergenic
982783534 4:159516292-159516314 GAGAGCTGCAGCTACAGAGAAGG + Intergenic
983066970 4:163222334-163222356 GGATGCTGCAGCTGAGGAGATGG - Intergenic
983140168 4:164140626-164140648 GGGTGCTGTAGCCGAGGAGCTGG - Intronic
983474175 4:168194549-168194571 TGGTGCTGCAGCCAAGGAGATGG - Intergenic
984805603 4:183748662-183748684 GGGTGCTACAGCTGAGGAGGTGG + Intergenic
984890096 4:184484126-184484148 GGGTGTTGCAGCCAAGGAGATGG + Intergenic
984955153 4:185037659-185037681 AGGTGCTACAGCTGAGGAGATGG - Intergenic
985206967 4:187549439-187549461 AGGTGCTGCAGGCCAAGAGATGG + Intergenic
985234283 4:187856105-187856127 GGGTGCTGCAGCTGAGAAGATGG + Intergenic
985245894 4:187979416-187979438 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
985270221 4:188187240-188187262 GGATGCTGCAGCCAAGGAGATGG - Intergenic
985283145 4:188306816-188306838 GGGTGTTGCAGCTGAAAAGATGG + Intergenic
985290780 4:188384782-188384804 GAGTGCTGCAGCAAAGGAGATGG - Intergenic
985295254 4:188431055-188431077 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
985301069 4:188490280-188490302 CGGTGCTGCAGCAGAGGAGGTGG + Intergenic
985411828 4:189693729-189693751 TGGTGCTGCAGCTGAGGAGATGG - Intergenic
985429469 4:189865071-189865093 TGGTGCTGCAGGAGAAGGGATGG - Intergenic
985506187 5:281970-281992 GGGTCATGCAGCTGAAGACTCGG + Intronic
985506211 5:282158-282180 GGGTTCTGCAGCTGAAGACTCGG + Intronic
985506265 5:282538-282560 GGGTCATGCAGCTGAAGACTCGG + Intronic
985506333 5:283198-283220 GGGTCATGCAGCTGAAGACTCGG + Intronic
985506339 5:283245-283267 GGGTCATGCAGCTGAAGACTTGG + Intronic
985506366 5:283529-283551 GGGTCATGCAGCTGAAGACTCGG + Intronic
985506372 5:283576-283598 GGGTCGTGCAGCTGAAGACTCGG + Intronic
985506377 5:283623-283645 GGGTCATGCAGCTGAAGACTCGG + Intronic
985506401 5:283859-283881 GGGTCCTGCAGCTGAAGACTCGG + Intronic
985506418 5:284000-284022 GGGTGTTGCAGCTGAAGACTCGG + Intronic
985741722 5:1621269-1621291 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
985741767 5:1621598-1621620 GGGTCATGCAGCTGAAGACTCGG - Intergenic
985741793 5:1621788-1621810 GGGTCTTGCAGCTGAAGACTTGG - Intergenic
985741827 5:1622070-1622092 GGGTCTTGCAGCTGAAGACTCGG - Intergenic
985741900 5:1622634-1622656 GGGTCATGCAGCTGAAGACCCGG - Intergenic
985741909 5:1622681-1622703 GGGTCATGCAGCTGAAGACTCGG - Intergenic
985741939 5:1622963-1622985 GGGTCATGCAGCTGAAGACCTGG - Intergenic
985741982 5:1623292-1623314 GGGTCATGCAGCTGAAGACCCGG - Intergenic
985741990 5:1623339-1623361 GGGTCGTGCAGCTGAAGACTTGG - Intergenic
985742053 5:1623857-1623879 GGGTCATGCAGCTGAAGACCCGG - Intergenic
985742134 5:1624446-1624468 GGGTCGTGCAGCTGAAGACTCGG - Intergenic
986341311 5:6791502-6791524 GGGTGCAGCAGCAGAAGGAAAGG + Intergenic
986590044 5:9359063-9359085 GGGTGCTGCTGCTGAGGATCTGG - Intronic
986954883 5:13138523-13138545 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
986954984 5:13139645-13139667 AGATGCTGCAGCTGAGGAGATGG + Intergenic
987817920 5:22928222-22928244 GAGTGCTGCAGCCAAGGAGATGG + Intergenic
988011169 5:25488075-25488097 AGATGCTGCAGCTGAGGAGATGG + Intergenic
988039597 5:25872670-25872692 GGTTGCTGCAGCTGAGGAGATGG - Intergenic
988045756 5:25950888-25950910 AGGTGCTGCAGTTGAGGACATGG + Intergenic
988065455 5:26225470-26225492 GGGTCGTGCAGCTGGAGAAATGG - Intergenic
988065729 5:26227675-26227697 GGGTCGTGCAGCTGAAGACTTGG - Intergenic
988210918 5:28202271-28202293 TGGTGTTGCAGCTGAGGAGATGG + Intergenic
988315637 5:29623224-29623246 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
988566244 5:32321762-32321784 AGGTGCTGCAGCCGAGGAGATGG + Intergenic
988911494 5:35847893-35847915 GGGTGCTGCAACTGAGGAGATGG + Intergenic
989218123 5:38926243-38926265 TGAAGCTGCAGCTGTAGAGATGG + Intronic
990168817 5:53024606-53024628 GGGTGCTGCTGCTACACAGAGGG + Intronic
990965925 5:61447811-61447833 AGGTGCTGCAGCTAAGGAGATGG + Intronic
991418953 5:66421251-66421273 GGGTTCTGAAGCTGAGGAGGAGG + Intergenic
991639571 5:68739287-68739309 GGGAGCAGCAGGTGAAGAAAAGG - Intergenic
991717861 5:69468713-69468735 GGGTGCTGCAGCTGAAGACATGG + Intergenic
992369538 5:76128485-76128507 GGGTGAGGCAGATGAAGATAAGG + Intronic
992480917 5:77151951-77151973 GGCTGCTGAAGCTGAGGAGAGGG + Intergenic
992589878 5:78283524-78283546 GTGTGCGGCATGTGAAGAGAAGG - Intronic
992970108 5:82047735-82047757 AGGTGCTGGAGGTGAAAAGAAGG + Intronic
994453285 5:99971309-99971331 GGGTGCTGCAGTCAAAGAGATGG + Intergenic
994571503 5:101520594-101520616 GGGTGCTGCAGCTGAAGAGATGG - Intergenic
994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG + Intergenic
994913983 5:105948701-105948723 GGGTGCTGCAGCTGAGCAGGTGG + Intergenic
995181109 5:109231087-109231109 GGGTGCTGCAGTTGGAGAGGAGG + Intergenic
995932989 5:117473293-117473315 GGCAGCTGCAGCTGAAGTGAAGG - Intergenic
996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG + Intergenic
998032980 5:138889229-138889251 GAGTGTGGCAGCTGAAGAGAGGG + Intronic
999333458 5:150694404-150694426 GGGTGCTGCTGATTGAGAGAAGG + Intronic
999515487 5:152297920-152297942 GGGTACTGCAGCTGGGGAGTGGG + Intergenic
1000540849 5:162538079-162538101 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1000814932 5:165909215-165909237 CAGTGCTGCAGCTGAGGAGATGG + Intergenic
1001474423 5:172039895-172039917 GGGTCATGAGGCTGAAGAGATGG - Intergenic
1002025800 5:176395552-176395574 GGATTGTGGAGCTGAAGAGAAGG - Intronic
1002529942 5:179838282-179838304 GGGTTCTGCAGCTGCAGAGGTGG + Intronic
1002616335 5:180458785-180458807 GGGCGCTGCAGCCAGAGAGATGG - Intergenic
1002842476 6:918123-918145 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1002872127 6:1176680-1176702 GGCTGCAGCAGCTGAAGGGAGGG - Intergenic
1002905181 6:1442594-1442616 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1003043412 6:2710652-2710674 GGGTGCTGCAGCCAAGGAGATGG - Intronic
1003068266 6:2921251-2921273 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1003683570 6:8279161-8279183 GGGAAATGCAGATGAAGAGACGG - Intergenic
1004244968 6:13965781-13965803 GGGTGCTGGGGCTGAGGAGATGG + Intronic
1004341108 6:14808115-14808137 AGGTGCTGCCAATGAAGAGATGG + Intergenic
1005035154 6:21549178-21549200 AGGTGCTGCAGAAGAGGAGATGG + Intergenic
1006220891 6:32490300-32490322 AGGTGCTGCAGCTGAGGATACGG - Intergenic
1006622960 6:35379507-35379529 GGGTGCTATTGCTGAAGATACGG + Intronic
1007970364 6:46046021-46046043 GGGAGCTGGGGCTGAGGAGAGGG + Intronic
1008204943 6:48643455-48643477 GGGTGCTGCAGCCAAGGAGAAGG - Intergenic
1008684781 6:53913171-53913193 GCAGGCTGCAGCTGAAGAAATGG + Intronic
1010005833 6:70993948-70993970 AGGTGCTGCAGCTGAGGAAATGG + Intergenic
1010445329 6:75943181-75943203 GGGTGAGGCTGCTGAAGAGGAGG - Intronic
1010462987 6:76134217-76134239 CGGTGCTGAAACTGCAGAGAGGG - Intergenic
1011008626 6:82677946-82677968 AGGTGCTGCAGCTGAAGAGATGG + Intergenic
1011490032 6:87882222-87882244 AGGTGCTGTAGCAGAGGAGATGG + Intergenic
1012432707 6:99182622-99182644 GGGTGCAGAATCTGAACAGAAGG - Intergenic
1013076805 6:106779125-106779147 GGGTGCTACAGCCCAGGAGATGG + Intergenic
1013328323 6:109070446-109070468 GTGTGCAGCAGCTGATGTGAGGG + Intronic
1014024355 6:116627859-116627881 GGAAGATGTAGCTGAAGAGAGGG + Exonic
1014139889 6:117929240-117929262 TGGTGCTGCAGCTGAGGAGATGG - Intronic
1014142915 6:117964839-117964861 CAGTGCTGCAGCAGAGGAGACGG + Intronic
1015043094 6:128745014-128745036 GGATTCTGCAGCTGGGGAGAGGG + Intergenic
1015342372 6:132115947-132115969 AGGTGATGCAGCTGGTGAGAGGG + Intergenic
1015349172 6:132196373-132196395 CGGTTCTGAATCTGAAGAGATGG - Intergenic
1016148255 6:140703317-140703339 AGGTGTTGCAGCTGAGGAGATGG + Intergenic
1016200629 6:141403180-141403202 TGGTGCTGCAGCTGAGGAGACGG - Intergenic
1016201075 6:141409160-141409182 TGGTGCTGCAGCCAAGGAGATGG - Intergenic
1016236412 6:141872690-141872712 GGGTGCTGCAGCCGAGGAGTTGG - Intergenic
1016242757 6:141951631-141951653 GGGTACTGCAGCTGAGGGAATGG - Intergenic
1016282378 6:142433207-142433229 GGAGGCTGCAGCTCCAGAGAAGG - Intronic
1016756918 6:147697221-147697243 GGGCGCTGCAGCCAAGGAGATGG + Intronic
1017383688 6:153858842-153858864 GGGTGCTGCAGTCGAGGAGATGG - Intergenic
1017656415 6:156633783-156633805 GGCTCCTGCAGATGAAGAAAAGG + Intergenic
1019522866 7:1468483-1468505 GGGTGTTGCACCTGGGGAGAAGG + Intergenic
1019732422 7:2635287-2635309 CGATGCTCTAGCTGAAGAGAAGG - Intronic
1020771298 7:12398572-12398594 GGGTGCTCCAGCTGAGGAGATGG - Intronic
1020814046 7:12882465-12882487 AGATGCTGCAGCTGAGGAGATGG + Intergenic
1021588697 7:22237671-22237693 AGGTGCTGCAGCGGAGGAGTTGG - Intronic
1021959281 7:25856606-25856628 GTGTGCTGCAGATGAAGGTACGG + Intergenic
1022350264 7:29561424-29561446 GGGAGCTGAAGCTGGAGAGGTGG - Intergenic
1022396202 7:29989744-29989766 GGGGGCTGCAGCTGCAGTGGCGG + Intronic
1022505560 7:30907057-30907079 GGCTGCTGCAGCTGGGGAGGAGG + Intergenic
1022772955 7:33494057-33494079 GGGTTTTGCTGCTGATGAGAAGG + Intronic
1022837255 7:34130106-34130128 AGATGCTGAAGCTAAAGAGATGG - Intronic
1023175177 7:37429205-37429227 GGGTGCTGCAGACTAAGGGATGG + Intronic
1023175195 7:37429314-37429336 GGGTGCTGCAGACTAAGGGATGG + Intronic
1023768104 7:43530761-43530783 GTGAGCAGCAGCAGAAGAGAAGG - Intronic
1024025694 7:45408246-45408268 TGGGCCTGAAGCTGAAGAGACGG - Intergenic
1024137618 7:46426749-46426771 GGGTTCAGCAGCAGAATAGAGGG + Intergenic
1024268918 7:47627618-47627640 AGGTGCTGCAACCGAGGAGATGG + Intergenic
1024307715 7:47942219-47942241 AGGTGCTGCAGATGAGGAGAAGG - Intronic
1024350659 7:48359538-48359560 GGGGGCAACTGCTGAAGAGAAGG - Intronic
1024421379 7:49170925-49170947 AGGTGCTGCAGCCAAAGAGATGG - Intergenic
1024654800 7:51442569-51442591 GGGTGCTGCGGCTGAGGAGATGG + Intergenic
1024794656 7:53007101-53007123 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1024802663 7:53099046-53099068 AGGTGCTGCAGCTGAGAACAGGG + Intergenic
1024894866 7:54246197-54246219 GGGGGCAGCAGGTGAGGAGAGGG - Intergenic
1025938102 7:66053179-66053201 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1025956335 7:66185985-66186007 GGGTGCTGCAGGCCAGGAGAGGG - Intergenic
1026055567 7:66980758-66980780 GGGTGCTCCAGCCAAGGAGATGG - Intergenic
1026160195 7:67861947-67861969 CGGTGCTGCAGTTAAGGAGATGG + Intergenic
1026280432 7:68917430-68917452 GGGTGCTGCAGCTGAGGATATGG - Intergenic
1026506120 7:70985580-70985602 GGGTACTGCAGCCAAGGAGATGG - Intergenic
1026722126 7:72841061-72841083 GGGTGCTCCAGCCAAGGAGATGG + Intergenic
1026930452 7:74220503-74220525 GGGTGCTGCAGCCCAAGGCAGGG - Intronic
1027625819 7:80543808-80543830 GGGTGCTGTGGCTGAGGAGATGG + Intronic
1027666772 7:81049672-81049694 AGGTGCTGCAGCCCAGGAGACGG - Intergenic
1027749659 7:82126844-82126866 GGGTGTTGCAGCTGAGGAGATGG - Intronic
1028740914 7:94274030-94274052 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
1029285976 7:99466320-99466342 GGGTCCTGCAGTTAGAGAGAGGG + Exonic
1030012953 7:105189440-105189462 AGCTGCTCCAGCTGAGGAGAAGG + Intronic
1030443413 7:109618417-109618439 AGGTTCTGCAGCCGAGGAGATGG + Intergenic
1031063288 7:117076111-117076133 AGGTGCTGTAGCTGAGGAGATGG - Intronic
1031329802 7:120450604-120450626 GCATGCTGCAGCTGAATACAGGG - Intronic
1031346483 7:120673272-120673294 GGGATCTGGAGCTCAAGAGAAGG - Intronic
1032175310 7:129619190-129619212 GGTTGAAGAAGCTGAAGAGAGGG + Intronic
1032898029 7:136273949-136273971 GGGTGGTGCTGCAGGAGAGAAGG + Intergenic
1033168331 7:139061041-139061063 ATGTGCAGCAGATGAAGAGAGGG - Exonic
1033242979 7:139696057-139696079 GTGTGCTGCAGATGAACAGAAGG + Intronic
1033342686 7:140504444-140504466 GGGTGCTGCAGCCCAGGAGATGG - Intergenic
1033603694 7:142909364-142909386 GGGGGCTGGAGCTGAAGTGGAGG - Intronic
1034167459 7:149036839-149036861 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1034180146 7:149130783-149130805 GGGTGTTACTGCTGAGGAGATGG + Intronic
1034351509 7:150417922-150417944 GGGAGCTCCCGATGAAGAGATGG + Intergenic
1035017886 7:155782333-155782355 GGGTGCTGCAGGTGGAGAGTGGG - Intergenic
1036297919 8:7551191-7551213 GGGTGCTGCCTCTAAGGAGATGG - Intergenic
1036658240 8:10691371-10691393 GGCTGCTGGGGCTGAACAGAAGG + Intronic
1037973660 8:23193090-23193112 GGGTGCTGCAGTGGAAGAGATGG - Intronic
1038214131 8:25546140-25546162 GGGTGCTACAGAGGAGGAGATGG + Intergenic
1039269725 8:35867811-35867833 AGGTGCTGCACCTGAGGAAATGG + Intergenic
1039431605 8:37529347-37529369 GGGTGCTGCAGGGGAAAGGAAGG - Intergenic
1040659215 8:49549661-49549683 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1040659426 8:49552938-49552960 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1041711644 8:60899724-60899746 GGCTGCTGTGGCTGAAGAAATGG + Intergenic
1041834625 8:62197784-62197806 GGGTGCTGCAGCTGAGGAGATGG + Intergenic
1041848665 8:62361049-62361071 TGGTGCTCCAGCTGTAGAGATGG - Intronic
1041871013 8:62634435-62634457 GGTTGTTGCAGCTGTGGAGAAGG - Intronic
1041931963 8:63296636-63296658 TGGTGCTACATCTTAAGAGAGGG - Intergenic
1041955046 8:63549345-63549367 GGATGCCGAAGCTGGAGAGAAGG - Intergenic
1042397283 8:68307038-68307060 AGGTGCTGCAGCTGAGGAGATGG - Intronic
1042482728 8:69322508-69322530 GGGTCTTGCAGCTGAAGACCTGG + Intergenic
1042852702 8:73232341-73232363 GGGTGCTACAGCCAAAGAGATGG - Intergenic
1045493881 8:102691834-102691856 GGGTGCTACAGGTGAGGAGATGG - Intergenic
1045499839 8:102736760-102736782 GGGTGTTGCAGCTGAGCAGATGG - Intergenic
1045508366 8:102794560-102794582 GGGAGGTGCAGCTGGAGAGGAGG - Intergenic
1046277283 8:111980617-111980639 AGATGCTGCAGGTGAGGAGATGG + Intergenic
1046395379 8:113633243-113633265 GGGTGCTGCAGCTGCACCCAAGG + Intergenic
1046396593 8:113648667-113648689 GGGTGTTGCACCTGAGCAGATGG + Intergenic
1046481256 8:114821574-114821596 GGCTGCTGTAGCTGAAGCCATGG - Intergenic
1046681650 8:117177258-117177280 GGGTGCTGCAGAAGAAGAAAGGG + Intergenic
1047080724 8:121457178-121457200 GGGTGCTGCATCCAAGGAGATGG - Intergenic
1047298089 8:123588851-123588873 TTGTGCTGCAGCTTAAGAGGTGG - Intergenic
1047307850 8:123667651-123667673 GGGTGCTGCAGCTGAGGAGGTGG + Intergenic
1047331047 8:123887203-123887225 GGGTGCTGCAGCCAAGGAGGTGG - Intronic
1047620176 8:126598326-126598348 GGGTGCTGCAGCCAAGGATATGG + Intergenic
1048010667 8:130452898-130452920 AGGTGCTGCAGTGGAGGAGATGG - Intergenic
1048518403 8:135131732-135131754 GGATGCTTCAGCTGAGGAGAGGG - Intergenic
1048835956 8:138519156-138519178 AGGTGCTCCAGCTCTAGAGAGGG + Intergenic
1049224174 8:141441769-141441791 ACGTGCTGCAGCTGAGCAGAGGG + Intergenic
1049289110 8:141792143-141792165 GGGTGCAGTAGATGCAGAGAGGG - Intergenic
1050024347 9:1318845-1318867 GGCTCCTGCAGCTGAACTGAAGG - Intergenic
1050851772 9:10296551-10296573 GGGTGCTGCAGCCAAGGATATGG - Intronic
1050921233 9:11203374-11203396 GGGTGATGCAGCAGAAGCCAAGG + Intergenic
1051136122 9:13923578-13923600 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1052177036 9:25474456-25474478 GGGTGCTGCAGCTGTGGACATGG - Intergenic
1052424784 9:28290546-28290568 GGGTGCTACAGCTGAGGAGATGG + Intronic
1054874716 9:70083562-70083584 GGGAGTTGTAACTGAAGAGAAGG + Intronic
1055059049 9:72049959-72049981 GGGTGCTGCAGCTGAGGAGATGG - Intergenic
1055071154 9:72167344-72167366 AGGTGCTGCAGCTAAGGAGATGG - Intronic
1055189817 9:73504340-73504362 GGGTGCTGCTGCTGAGGAGATGG - Intergenic
1055590443 9:77807384-77807406 GTATGTTGCAGCTGATGAGAGGG - Intronic
1056320506 9:85430618-85430640 GGGTGCTTCAGCAAACGAGAGGG - Intergenic
1056573910 9:87840177-87840199 GGGTGCTGCAGCTGAGAAGATGG + Intergenic
1056998446 9:91485477-91485499 GGATGATGAAGCTGAGGAGAAGG - Intergenic
1057029323 9:91761972-91761994 CGGTGATGCAGCTGAGGAGATGG - Intronic
1057149457 9:92783498-92783520 GGGTGCTGCAGCCGAGTAGATGG + Intergenic
1057302144 9:93892949-93892971 GGGTGCTGCAGCTGGGCAGATGG - Intergenic
1057395794 9:94678920-94678942 AGGTGCTGCAGCTAAAGAGATGG + Intergenic
1057441276 9:95085517-95085539 AAGTTCTGCACCTGAAGAGAAGG + Intronic
1057630097 9:96712774-96712796 AGGTGCTGCAGCCAAGGAGATGG + Intergenic
1058318645 9:103601443-103601465 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1059049569 9:110909188-110909210 GGGTGCTGCAGCTGAGGAGATGG - Intronic
1059840871 9:118214262-118214284 GGGTTCTGCAGATAAAGAGGTGG - Intergenic
1061315128 9:129790677-129790699 GGGTGATTCAGCTGCAGAGAGGG - Intergenic
1061722865 9:132563926-132563948 GGGTCCCACAGCTGAAGAAAGGG - Intronic
1062211796 9:135368664-135368686 GGGTGTTGCAGCCGAGGAGAGGG - Intergenic
1062381198 9:136287587-136287609 GGGTGCCGCAGCCGAGGAGGTGG - Intronic
1062489934 9:136800159-136800181 GGCTGCTGCAGGTGGAGAGGCGG + Exonic
1062623719 9:137433842-137433864 GGGGGCTGCAGCTGCAGTGCAGG + Exonic
1203487781 Un_GL000224v1:73492-73514 GTGGGCTGTAGCTGCAGAGAAGG - Intergenic
1203500402 Un_KI270741v1:15387-15409 GTGGGCTGTAGCTGCAGAGAAGG - Intergenic
1203662621 Un_KI270753v1:59577-59599 CGGTGCTGCAGCTGAGGAGATGG - Intergenic
1203670769 Un_KI270755v1:9252-9274 CGGTGCTGCAGCTGAGGAGATGG + Intergenic
1185446135 X:258905-258927 ATGTGCTGGAGCTAAAGAGAGGG + Intergenic
1186184505 X:7007096-7007118 GGGTGCTGCAGCCAAGGAGGTGG + Intergenic
1186277506 X:7956011-7956033 GGGTGCTGCTGCTGAAAATGTGG - Intergenic
1186390296 X:9151955-9151977 GGGTGCTACAGCCAAAGAGATGG + Intronic
1186396699 X:9216323-9216345 AGATGCTGCCTCTGAAGAGATGG - Intergenic
1187914448 X:24140307-24140329 AGGTGCTGCAGCCAAGGAGATGG - Intergenic
1188495961 X:30783230-30783252 GGGTGCTGCATCAGAATACAAGG - Intergenic
1188618908 X:32195050-32195072 GGGAGATGCAGAGGAAGAGAAGG + Intronic
1188858790 X:35231096-35231118 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1189345694 X:40239694-40239716 GCGTACTGCAGCCAAAGAGATGG - Intergenic
1189992947 X:46611853-46611875 GGGCGCTGGGGCGGAAGAGAAGG - Intronic
1190281588 X:48934608-48934630 GGGTTCTGCAGAGAAAGAGAAGG + Exonic
1190744553 X:53314556-53314578 GGGTACAGCAGCCCAAGAGAAGG + Intronic
1192351837 X:70362314-70362336 GGGTGCTGCGGATGTAGAGAGGG + Intronic
1192586252 X:72320226-72320248 GAGTGCTGGACCTGAAGAGATGG + Intergenic
1194008486 X:88528915-88528937 AGGTGCTGCAGCCAAAGAGCTGG + Intergenic
1194085091 X:89516479-89516501 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1194282099 X:91965948-91965970 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1195472454 X:105246423-105246445 GGGTGTTGCAGCTGAGGAAATGG + Intronic
1195655599 X:107328820-107328842 GGGGGCTGCAGCAGAAAGGATGG - Intergenic
1196294095 X:113979127-113979149 AGGTGCTGTAGCTGAGGAGATGG - Intergenic
1196665119 X:118307961-118307983 AGGTGGTGCAGCTGAGGAGATGG + Intergenic
1196732647 X:118956709-118956731 GGGTGCTGCAGTTGAGGAGTTGG + Intergenic
1197082005 X:122429647-122429669 AGGTGCTGCAGCTGAGGAGATGG - Intergenic
1197179332 X:123517515-123517537 AGGTGCTGCACCTGAGAAGATGG + Intergenic
1198369764 X:135979078-135979100 GGGTGCTGCAGCCGAGAAGATGG - Intergenic
1199102632 X:143821854-143821876 GGGTGCTGCAGCCAAGGAGATGG + Intergenic
1199788709 X:151129735-151129757 AGGTGCTGCAGCTGAGGAGATGG + Intergenic
1199789385 X:151137787-151137809 GGGTGCAGCAGCCAAGGAGATGG + Intergenic
1200267764 X:154654962-154654984 GGGTGCTGCAGCCGGGGAGATGG - Intergenic
1200437739 Y:3172363-3172385 AGGTGCTGCAGCAGAGGAGATGG - Intergenic
1200599693 Y:5190609-5190631 GGGTGCTGCAGCCAAGGAGATGG + Intronic
1202390984 Y:24370319-24370341 GGGTGCTGCAGCCAAGGAGATGG - Intergenic
1202479800 Y:25299797-25299819 GGGTGCTGCAGCCAAGGAGATGG + Intergenic