ID: 1181732730

View in Genome Browser
Species Human (GRCh38)
Location 22:24859407-24859429
Sequence CCCCAGGTTCCTTCAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181732730_1181732742 26 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732742 22:24859456-24859478 GTCAGAGTGTGAAAGTGATGGGG 0: 1
1: 0
2: 0
3: 27
4: 214
1181732730_1181732740 24 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732740 22:24859454-24859476 AAGTCAGAGTGTGAAAGTGATGG 0: 1
1: 0
2: 3
3: 38
4: 373
1181732730_1181732737 1 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732737 22:24859431-24859453 CAGGGACCCTGGAGCTCAGGAGG 0: 1
1: 0
2: 6
3: 50
4: 605
1181732730_1181732744 30 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732744 22:24859460-24859482 GAGTGTGAAAGTGATGGGGGTGG No data
1181732730_1181732736 -2 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732736 22:24859428-24859450 GGTCAGGGACCCTGGAGCTCAGG 0: 1
1: 0
2: 1
3: 38
4: 434
1181732730_1181732734 -10 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732734 22:24859420-24859442 GAACCTGGGGTCAGGGACCCTGG 0: 1
1: 0
2: 3
3: 37
4: 351
1181732730_1181732743 27 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732743 22:24859457-24859479 TCAGAGTGTGAAAGTGATGGGGG 0: 1
1: 0
2: 0
3: 22
4: 276
1181732730_1181732741 25 Left 1181732730 22:24859407-24859429 CCTGGCTCTGAAGGAACCTGGGG No data
Right 1181732741 22:24859455-24859477 AGTCAGAGTGTGAAAGTGATGGG 0: 1
1: 0
2: 0
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181732730 Original CRISPR CCCCAGGTTCCTTCAGAGCC AGG (reversed) Intronic
No off target data available for this crispr