ID: 1181732921

View in Genome Browser
Species Human (GRCh38)
Location 22:24860409-24860431
Sequence GCTTGAGGAGGCTTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181732916_1181732921 13 Left 1181732916 22:24860373-24860395 CCATGGTGCAGAGGTGTGGCTGG 0: 1
1: 0
2: 4
3: 53
4: 332
Right 1181732921 22:24860409-24860431 GCTTGAGGAGGCTTGGCTGCTGG 0: 1
1: 1
2: 0
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181732921 Original CRISPR GCTTGAGGAGGCTTGGCTGC TGG Intronic
900379744 1:2377932-2377954 GCCTGAGGGGGCTGGGCAGCTGG - Intronic
900461472 1:2804068-2804090 GCTGGGGCAGGCATGGCTGCAGG + Intergenic
901150769 1:7099767-7099789 GTTTGAGCTGGCCTGGCTGCTGG + Intronic
901454290 1:9354302-9354324 GCTGTTGGAGCCTTGGCTGCCGG - Intronic
903568125 1:24284320-24284342 GCTTGAGGAGGTTCGGCCACCGG - Intergenic
904293894 1:29505505-29505527 GCTTCAGGGGGCTGGGCTGGGGG - Intergenic
906128834 1:43443680-43443702 CCGTGAGGAGCCTTGGCTGAAGG + Exonic
906612057 1:47210319-47210341 GCTGACTGAGGCTTGGCTGCAGG + Intergenic
907077497 1:51591963-51591985 GATTGAGGAGGGTTGGCTACGGG - Intronic
909629812 1:77759688-77759710 GCTTGCGGAGGTGCGGCTGCAGG - Exonic
911043542 1:93610208-93610230 GGTACAGGAGGCCTGGCTGCTGG + Intronic
913720518 1:121588107-121588129 ACTTGGGGAGGCTTTGCTGCTGG - Intergenic
919763606 1:201112907-201112929 GCTTGGGGAGTTTTGGCTGATGG - Intergenic
920736771 1:208539935-208539957 GCATGAGTGGGCTGGGCTGCCGG + Intergenic
922539114 1:226405653-226405675 GTTAGAGGAGGCTTAGCTGTGGG - Intronic
922842007 1:228650306-228650328 GCTGGATGGTGCTTGGCTGCCGG + Intergenic
923304579 1:232676257-232676279 GTTTGAGCAAGCTTGGCTTCAGG - Intergenic
1063115573 10:3069118-3069140 GCCTGGGGAGGCTGCGCTGCGGG - Intronic
1064561722 10:16600391-16600413 GCTTGAAGCGGCCTGTCTGCAGG - Intronic
1065898957 10:30188102-30188124 CCAGGAGGAGGCTGGGCTGCTGG - Intergenic
1067914983 10:50387560-50387582 GATGGAGGAGGCTTGGCTTGCGG - Intronic
1070794965 10:79211091-79211113 GCTTGAAGGGGCTTGGTGGCGGG + Intronic
1070826428 10:79392964-79392986 GCTGTTGGAGGCTTGGCTGGTGG - Intronic
1071086664 10:81874705-81874727 GCTGGCCGAGGGTTGGCTGCGGG + Intergenic
1071997483 10:91162720-91162742 GCTCGAGGAGGCCTGGCGGGCGG + Intergenic
1073456023 10:103637212-103637234 GCTGGAGAAGGCTGGGCTTCAGG + Intronic
1074924807 10:118057253-118057275 GTTTGAGGGGTCTTGGCAGCAGG + Intergenic
1075010682 10:118867320-118867342 GCTTGAGCCGATTTGGCTGCAGG + Intergenic
1076810486 10:132884114-132884136 GCCTGAGGAGGGGAGGCTGCGGG - Intronic
1077199092 11:1296622-1296644 GCTGGTGGAGGCCTGGTTGCTGG + Intronic
1077353308 11:2103009-2103031 GCTCCAGGAGCCTTGGCTGCAGG - Intergenic
1078467807 11:11563073-11563095 GCTGGAGGAGTCTTGTTTGCAGG - Intronic
1079248927 11:18773204-18773226 GGGAGAGGCGGCTTGGCTGCAGG + Intronic
1079452257 11:20607149-20607171 GCCTGAGGAGGCTGAGCGGCAGG - Intronic
1083591507 11:63898035-63898057 GCTGGAGGAGGGCTGGCTGTGGG - Intronic
1084179127 11:67437800-67437822 TCTGGAGGAGGCTGGGCTGCCGG + Exonic
1084412404 11:69012446-69012468 GATTGAAGAGGCTTGTCTGGGGG + Intronic
1086012318 11:82120469-82120491 GCTCAAGGAGGCCTGCCTGCCGG + Intergenic
1086890279 11:92249758-92249780 GATGGAGGAGGGTTTGCTGCTGG - Intergenic
1088368791 11:109066449-109066471 GTTTGAGGAGAGTTGGCAGCTGG + Intergenic
1088969683 11:114761868-114761890 GCATAAAGAGGCTTGGCGGCCGG - Intergenic
1089525658 11:119094923-119094945 GCATGGGGAGGCCTGGCGGCCGG + Exonic
1091357581 11:134949474-134949496 GCTGGAGGCAGCTTGGCAGCTGG + Intergenic
1096281161 12:50255091-50255113 GCTTGGGGAGGGCTGGTTGCAGG - Intronic
1097426240 12:59448057-59448079 GCTTGAAGAGGCTAGACTTCTGG - Intergenic
1098692899 12:73511512-73511534 GCCTCAGGAGTCTAGGCTGCAGG - Intergenic
1102028034 12:109724526-109724548 GCCCGAGGAGGGTGGGCTGCTGG - Intronic
1102298291 12:111753852-111753874 GATTGAGCAGGCACGGCTGCTGG + Exonic
1103044488 12:117724507-117724529 ACTTTAGGTGGCTTTGCTGCTGG + Intronic
1104668013 12:130661146-130661168 CCAAGAGGAGGCATGGCTGCTGG - Intronic
1105694461 13:22874162-22874184 GCTTGAGGAGCCTCTGCTGTAGG - Intergenic
1105707980 13:22980604-22980626 CCTGGAGGAGGCTGGGATGCCGG + Intergenic
1112203661 13:97302874-97302896 GCTGGAACACGCTTGGCTGCAGG - Intronic
1113436855 13:110299192-110299214 GCTTGAGCAGCCTTAGGTGCAGG - Intronic
1113930389 13:113965172-113965194 CCTTGATGAGGCCTGGCTCCTGG + Intergenic
1114671691 14:24415097-24415119 GCTTGAGGAGGCTGTGCAGGGGG - Exonic
1114931352 14:27471905-27471927 GCTTGGGTAGGCTTGGATACAGG + Intergenic
1117500711 14:56348409-56348431 ACTTGAAGAGGCTATGCTGCTGG - Intergenic
1117999674 14:61511311-61511333 TCTAGAGGAGGCTTTGCAGCAGG - Intronic
1120399243 14:84007108-84007130 GCTTCAGGAAGCCTGGATGCTGG - Intergenic
1121798444 14:96754483-96754505 GATGGAGGAGGCCTGGCTGGTGG + Intergenic
1122824801 14:104364413-104364435 GCCTGAGGAGCCCTGGGTGCTGG - Intergenic
1124134597 15:27022973-27022995 GCTTGTTGAGGCTTAGCTGGCGG + Intronic
1125432013 15:39605049-39605071 GCTGGATGAGGCCTGGTTGCCGG - Intronic
1125502800 15:40249997-40250019 CTTTGAGGAGCCTTGGCTGCTGG - Intronic
1128200436 15:65801006-65801028 GCTTTAGGAGAGTTTGCTGCTGG + Intronic
1129692394 15:77721225-77721247 GCTTGGGGAGGTATGGCTGGAGG - Intronic
1132504493 16:300600-300622 GCTGGTGTGGGCTTGGCTGCGGG + Intronic
1132558220 16:582053-582075 GCTGCAGGAGGCTTTGATGCCGG + Intronic
1133040106 16:3056159-3056181 GCTTGAGGAGGGATGGGGGCAGG + Intronic
1133043983 16:3076004-3076026 GCTTGAGGAGGGATGGGGGCAGG + Intronic
1134081584 16:11328483-11328505 GCTGGAGGAGGCTGGGTTCCAGG - Intronic
1134215978 16:12317218-12317240 GCCTGTGAAGGCTTGGCTGCTGG + Intronic
1137251868 16:46747107-46747129 GCTAATGGAAGCTTGGCTGCTGG - Intronic
1139272481 16:65697282-65697304 GCTGGAGGATGCTTCACTGCCGG - Intergenic
1140987913 16:80176705-80176727 GCTTGAAGATGCTCTGCTGCTGG + Intergenic
1141510059 16:84506061-84506083 GCATCAGGAGCCCTGGCTGCAGG - Intronic
1142001953 16:87669254-87669276 GGTTCAGGATGCTTGCCTGCTGG + Intronic
1142302827 16:89268648-89268670 GCATGAGGAGGCAAGTCTGCGGG + Exonic
1142412347 16:89923156-89923178 GCTGGGGGATCCTTGGCTGCGGG + Intronic
1142698205 17:1645007-1645029 TCTTGAGGAGGCATGGCCCCTGG - Intronic
1142878336 17:2865981-2866003 GCTTCAGGAGCATGGGCTGCTGG - Intronic
1142957294 17:3530608-3530630 GCTGGAGGAGTCTTGGCTTAGGG - Intronic
1144784082 17:17822377-17822399 TCTTGAGGCTACTTGGCTGCAGG - Intronic
1149446591 17:56717876-56717898 GCTGGAGGAGGCTGGGATGGAGG + Intergenic
1149536760 17:57439199-57439221 GCTGGGGAAGGCTTGGCTTCTGG + Intronic
1151287334 17:73122402-73122424 GCTTCAGGAGGCCAGGCTGGCGG - Intergenic
1152335092 17:79696151-79696173 GCCGGTGGAGGCTGGGCTGCAGG + Intergenic
1153063405 18:1017825-1017847 GCTTCAGCAGTCTTGGCTGAGGG + Intergenic
1153263606 18:3247189-3247211 GATAGTGGAGGCTTGGCTGAGGG + Intergenic
1157422037 18:47555591-47555613 GGTGGAAGAGGCTTGGCAGCTGG - Intergenic
1157692029 18:49691580-49691602 GCTTTTGGAGGGTTGGCTGGAGG + Intergenic
1158433202 18:57410818-57410840 GCTTGTGGAGGCTGGGCTGGAGG - Intergenic
1160958836 19:1708206-1708228 ACTGGAGGAGGCTGTGCTGCTGG - Intergenic
1161750469 19:6092587-6092609 TCTTGGGGAGGCCTGGCTGCTGG - Intronic
1163550784 19:17965557-17965579 GACTGAGAAGGCTTGGCTGGAGG + Intronic
1165423789 19:35734669-35734691 CCTGGAGGAGGCTTGGCTGATGG + Intronic
1166153885 19:40896107-40896129 GCTTGAAGAAGCTACGCTGCTGG - Intronic
1166539755 19:43597215-43597237 GCTAGAGGAGGGTGGGGTGCAGG + Intronic
1167591262 19:50405775-50405797 GCTGGAGGGCGCCTGGCTGCAGG - Intronic
1168102009 19:54146298-54146320 GCCTGAGGAGGCTGGGTAGCTGG + Intronic
1168300561 19:55402473-55402495 GCTGCTGGAGGCCTGGCTGCAGG - Intronic
924992865 2:328829-328851 GCTGGGTGAGGCTTGGCTGCTGG - Intergenic
925327964 2:3037402-3037424 GGCTGAGGAGGCTCTGCTGCAGG - Intergenic
926288112 2:11506711-11506733 GCTTGGGGAGGCTTGGGAACTGG + Intergenic
926748836 2:16182071-16182093 CCTTCACCAGGCTTGGCTGCTGG - Intergenic
926891153 2:17639915-17639937 GATAGAGGAGAATTGGCTGCTGG - Intronic
927706951 2:25302303-25302325 GGATGAGGAGGCTTGGCTAGGGG + Intronic
929936801 2:46298965-46298987 GCTTGGCGAGGCTATGCTGCGGG + Intronic
930709191 2:54534064-54534086 AATTGAAGAGGCTAGGCTGCAGG + Intronic
931648173 2:64444323-64444345 GCATGAGCACGCTTGGCTGCTGG + Intergenic
932167175 2:69519040-69519062 GCTTGAGGAAGAGTTGCTGCTGG + Exonic
932291299 2:70582290-70582312 GCTTGAGGAGAGATGGGTGCAGG + Intergenic
932924967 2:75962924-75962946 GCTTTCTGTGGCTTGGCTGCAGG - Intergenic
934640322 2:96023869-96023891 GCTGGAGGAGGCCAGGCTCCAGG + Intronic
934793329 2:97081547-97081569 GCTGGAGGAGGCCAGGCTCCAGG - Intergenic
935359977 2:102238723-102238745 GCTTTAGGAGTGGTGGCTGCTGG + Intronic
935468974 2:103434038-103434060 GGGAGAGGAGGCTTTGCTGCTGG - Intergenic
937744541 2:125396095-125396117 GCTTGAAGATCCTTGACTGCAGG - Intergenic
938176912 2:129142140-129142162 GCTGCAGGAGCCTTGGCTGCTGG - Intergenic
938749190 2:134312618-134312640 GGTAGAGGAGGCTTCGTTGCCGG + Intronic
942545201 2:177056358-177056380 GCTGCAGGAAGCATGGCTGCTGG + Intergenic
943814899 2:192240380-192240402 GCTTGAGTGGTCTTGGCTCCAGG + Intergenic
945216232 2:207436978-207437000 CCTTGAGGGGGCTGGCCTGCTGG + Intergenic
948510190 2:238458828-238458850 GCTGGAGCAGGCTGGGCTCCCGG + Intergenic
948843713 2:240672896-240672918 GCTGGAGGTGGCTGCGCTGCGGG + Intergenic
948960191 2:241328775-241328797 ACTTGAGGAGGCTAGGCGGGTGG + Intronic
1170812830 20:19687910-19687932 GTATGAGGAGACATGGCTGCAGG + Intronic
1171127905 20:22620597-22620619 GCTCTAGGAGGCTGGGGTGCAGG - Intergenic
1172448986 20:35008555-35008577 GCTTCAGGAGGCATGGACGCTGG + Intronic
1173503110 20:43567529-43567551 GGGTGAGGAGGCATGGCTCCTGG + Intronic
1173571787 20:44081776-44081798 GGCTGAGGAGGCCTGGGTGCGGG - Intergenic
1174453764 20:50635866-50635888 GCTGGAGGAGGTCTGGCTCCTGG - Intronic
1175153757 20:56955357-56955379 GCTTCTGGAGGCTGGGCTGTGGG - Intergenic
1175281459 20:57806751-57806773 CCTTGCGGTGGCTTGGCTGCTGG - Intergenic
1175944672 20:62553177-62553199 GCTGGTGGAGGCTGGGCGGCTGG + Intronic
1176408972 21:6437493-6437515 GCCTGAGGAGAGTTGGGTGCGGG + Intergenic
1179684465 21:43045815-43045837 GCCTGAGGAGAGTTGGGTGCGGG + Intergenic
1179876253 21:44269913-44269935 GCTTTAGGAGGCTGAGCTGAAGG + Intergenic
1179969699 21:44827955-44827977 GGTTGAGGATGGTTTGCTGCAGG - Intergenic
1180962946 22:19770518-19770540 GCACGCGGGGGCTTGGCTGCGGG + Intronic
1180966644 22:19791976-19791998 GCTTGTGCAGGCTTGGCTTTTGG - Intronic
1181118460 22:20649428-20649450 GCTTGAGGAGTCTTGGCTGCTGG - Intergenic
1181732921 22:24860409-24860431 GCTTGAGGAGGCTTGGCTGCTGG + Intronic
1181985934 22:26799847-26799869 GATTGGGGAGGATTGGCTGAAGG + Intergenic
1183721484 22:39565286-39565308 GCTTGGGGAGGCCTGGTTCCAGG + Intergenic
1184039710 22:41935579-41935601 GCTTGAGGAGGGGAGGCTCCAGG - Intergenic
1184383117 22:44158740-44158762 GCTGTGAGAGGCTTGGCTGCGGG - Intronic
950610889 3:14125813-14125835 GTTGGAGGAGGCCTGGCTGAGGG + Intronic
952159340 3:30678233-30678255 TCTTGAGCAGGCTTCTCTGCAGG - Intronic
954537798 3:51374393-51374415 TCCTGAGGATGCTTGACTGCTGG + Intronic
954575499 3:51673835-51673857 GCTTGGGGAGGCTGGGCTGGTGG + Intronic
954672259 3:52297405-52297427 GCTGGAGGAGGGTGGGCTGGGGG + Intergenic
954804020 3:53204883-53204905 ACTTGAGGAGGCGTCTCTGCAGG - Intergenic
955875247 3:63482467-63482489 GGTTGAGGAGGACTGGCTGGTGG - Intronic
960320114 3:116224272-116224294 GCTTGAGGATTCTTGGGTGAAGG - Intronic
961695137 3:128698850-128698872 GCTTGGGGAGGGCTGGCCGCAGG + Intergenic
968916000 4:3497318-3497340 GCCTGTGGAGGCTGGGCTGGTGG + Intronic
968958981 4:3733316-3733338 GCTTGAGGGAGCAGGGCTGCCGG + Intergenic
969110970 4:4844082-4844104 GCTCCAGGAGGGGTGGCTGCTGG - Intergenic
969149600 4:5158209-5158231 GCCTGAGAACACTTGGCTGCTGG - Intronic
969254255 4:5991787-5991809 GCCTGAGGGGGCTCTGCTGCTGG - Intergenic
969565193 4:7973180-7973202 GCAGGAGGAGCCTTGGCTGCTGG + Intronic
977719498 4:100223432-100223454 GAATGAGGAGGCATGGCTACAGG - Intergenic
981084573 4:140669769-140669791 GCTGGAGGAGACGAGGCTGCTGG + Exonic
985121296 4:186645185-186645207 TCTTGTGCAGGCTTGGCTGGTGG - Intronic
985561448 5:588442-588464 GTATCAGGAGGCTTGGCCGCTGG - Intergenic
985645918 5:1084731-1084753 GCCTCAAGGGGCTTGGCTGCTGG + Intronic
987085376 5:14462883-14462905 GCTGGAGGAGGCTGTGCTGCTGG - Exonic
989989653 5:50746260-50746282 GCTTAAGGATGCTTGGGTGAAGG + Intronic
990428584 5:55712478-55712500 GCTTCAGGAGGCTGGGCAGCCGG + Exonic
992052621 5:72955586-72955608 GCTGGAGGAAACTTGGCCGCTGG - Intergenic
992277984 5:75140790-75140812 TCTTGAGGATGGTTGGCTGAGGG - Intronic
995478230 5:112569370-112569392 GTTGGAGGAGGGTTAGCTGCTGG - Intergenic
1003055675 6:2817719-2817741 GGTTGATGAGGATTGGGTGCTGG + Intergenic
1003116459 6:3286859-3286881 GGTTGAGGAGGCCGAGCTGCAGG + Exonic
1003694762 6:8392837-8392859 GCCTGAGGAGGCTTGTGTGGTGG - Intergenic
1004319371 6:14620809-14620831 GCTGGAGGAGCCGTGGCAGCTGG - Intergenic
1008511730 6:52282423-52282445 GCTGGAGGAGTCTTGGTTCCTGG - Intronic
1008879783 6:56370218-56370240 GCTTGAGGACACTAGGCTCCTGG + Intronic
1010818968 6:80391084-80391106 GCTTGAGGCTGCTTGGCTGTTGG - Intergenic
1014246886 6:119078775-119078797 GCTGGGCGGGGCTTGGCTGCGGG - Intronic
1017684659 6:156899620-156899642 GCTCCAGGAAGTTTGGCTGCAGG - Intronic
1019322636 7:422594-422616 GCTGGAAGAGGCCTGGCTCCCGG - Intergenic
1019551607 7:1606062-1606084 CCTGGAGGAGGCAGGGCTGCAGG - Intergenic
1019616197 7:1963663-1963685 GCTTCCGGAGGCGAGGCTGCTGG + Intronic
1019710886 7:2517741-2517763 GCTTGGCCATGCTTGGCTGCAGG + Intronic
1021984126 7:26082453-26082475 GCTGGACCAGACTTGGCTGCAGG - Intergenic
1026689141 7:72537197-72537219 ATTTGAGGATGCTTTGCTGCTGG + Intergenic
1029578822 7:101421244-101421266 GCTTGAGATGGGCTGGCTGCTGG + Intronic
1033004805 7:137550083-137550105 GCATGGGGTGGCTTGGATGCAGG + Intronic
1034152565 7:148928499-148928521 GTTGGACTAGGCTTGGCTGCTGG - Intergenic
1034963632 7:155377977-155377999 GCTTGAGCCGGCTTGGCCCCCGG + Intergenic
1035082842 7:156232201-156232223 GCTTGGAGAGGCATGGCAGCTGG + Intergenic
1035904889 8:3499281-3499303 GTCTGAGTAGCCTTGGCTGCAGG + Intronic
1036202379 8:6780231-6780253 GCCTGATGGGGCCTGGCTGCTGG - Intergenic
1036757685 8:11482126-11482148 GCTACCGGAGGCATGGCTGCAGG + Intergenic
1039613779 8:38938816-38938838 TCATGAAGAGGCGTGGCTGCAGG - Intronic
1040954026 8:52961623-52961645 GCTTGTGGATGATGGGCTGCAGG - Intergenic
1042474522 8:69232168-69232190 GATTGAGGAGGAATGGCAGCAGG - Intergenic
1047526093 8:125635360-125635382 GCTGCAGGTGGCTGGGCTGCAGG + Intergenic
1049657444 8:143805026-143805048 GGTGGAGGAGGCAGGGCTGCCGG + Intronic
1049854079 8:144850804-144850826 GCATCAGGACGCTCGGCTGCAGG + Exonic
1050287494 9:4118250-4118272 GGTTGACCAGGCCTGGCTGCAGG + Exonic
1050467336 9:5941891-5941913 GCATCAGGAGGCTTCTCTGCAGG - Intronic
1055900128 9:81224621-81224643 GCTGGAGCAGGGTTGGCTGAAGG - Intergenic
1057210392 9:93198161-93198183 GCTTGAGGAGGGTGGACTGCAGG + Intronic
1058738469 9:107918955-107918977 GCCCAAGGAGGCATGGCTGCAGG + Intergenic
1060512233 9:124242501-124242523 GCTTTGGGAGGCTTTTCTGCGGG + Intergenic
1060963663 9:127699416-127699438 GCTTGGGGAGGCCGGGCTTCCGG + Intronic
1061047734 9:128176224-128176246 GTGTGAGGAGGCCTGGCTGGGGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061934421 9:133849456-133849478 GGCTGAGGAGGCGTGGCTGAGGG + Intronic
1185779022 X:2829482-2829504 GCTTGGGGAGGATGGGCGGCAGG + Intronic
1186720260 X:12296579-12296601 GCTTGCTGAGCCTTGGCTTCAGG + Intronic
1188284929 X:28315666-28315688 ATTTGTGGAGGCTTTGCTGCTGG - Intergenic
1192238213 X:69309682-69309704 GCTTGAGCTGGCTGGCCTGCAGG + Intergenic
1197779288 X:130143479-130143501 GCTTGATGAGGCTTGGTGGTTGG - Intronic
1198084371 X:133268464-133268486 GCAGGAGGCGGCCTGGCTGCAGG - Intergenic
1198218618 X:134579420-134579442 TCCTGAGGTGGCTTGGCTTCCGG + Intronic
1198312366 X:135435245-135435267 GCTGGAGCAGGCTCGGCTGGAGG + Intergenic
1199872323 X:151911222-151911244 GTTGGAGGGGGGTTGGCTGCAGG + Intergenic
1201685567 Y:16698028-16698050 GCTTCAGGAGGTCTGGATGCTGG - Intergenic