ID: 1181737347

View in Genome Browser
Species Human (GRCh38)
Location 22:24892272-24892294
Sequence GAGTAGCCATAGGAGAGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181737336_1181737347 1 Left 1181737336 22:24892248-24892270 CCTCAGTCCCCCTCCCGAAGTCC 0: 1
1: 0
2: 0
3: 19
4: 358
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737334_1181737347 18 Left 1181737334 22:24892231-24892253 CCTTGGGCAGGATGGACCCTCAG 0: 1
1: 0
2: 1
3: 24
4: 247
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737339_1181737347 -8 Left 1181737339 22:24892257-24892279 CCCTCCCGAAGTCCTGAGTAGCC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737340_1181737347 -9 Left 1181737340 22:24892258-24892280 CCTCCCGAAGTCCTGAGTAGCCA 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737333_1181737347 19 Left 1181737333 22:24892230-24892252 CCCTTGGGCAGGATGGACCCTCA 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737335_1181737347 2 Left 1181737335 22:24892247-24892269 CCCTCAGTCCCCCTCCCGAAGTC 0: 1
1: 1
2: 1
3: 7
4: 152
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737337_1181737347 -6 Left 1181737337 22:24892255-24892277 CCCCCTCCCGAAGTCCTGAGTAG 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168
1181737338_1181737347 -7 Left 1181737338 22:24892256-24892278 CCCCTCCCGAAGTCCTGAGTAGC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181737347 Original CRISPR GAGTAGCCATAGGAGAGGGT CGG Intronic
900811120 1:4802046-4802068 GAGGAGCCAGAGCAGAAGGTGGG + Intergenic
901453232 1:9348845-9348867 GAGCAGCCATGGGACGGGGTGGG - Intronic
901613634 1:10519314-10519336 AAGTGGCCATAGCAGAGGGCAGG + Intronic
901761934 1:11477507-11477529 GAGGAGCCATGTGAGAGGGTGGG - Intergenic
902123919 1:14192344-14192366 GGTTAGCCACAGGACAGGGTGGG + Intergenic
904849417 1:33446194-33446216 GGGTACCCATAGCAGAGGCTTGG - Intergenic
906548616 1:46641548-46641570 GAGTAGACTTAAGAGAGGATGGG - Intronic
906623107 1:47300946-47300968 GAGTAGCCATTGTAGAAGTTGGG - Intronic
906669643 1:47645194-47645216 CAGTTGCAATATGAGAGGGTGGG + Intergenic
907371471 1:54006331-54006353 GAGAGGCCACAGTAGAGGGTGGG - Intergenic
909335282 1:74465565-74465587 CAGTGCCCATAGGAGAGGCTCGG - Intronic
909651468 1:77980260-77980282 GAGTACCCACAGGATGGGGTGGG - Intronic
915870833 1:159557919-159557941 GAGAAGCCTTAGGTGAGGATGGG + Intergenic
915992083 1:160528352-160528374 GAGTAGCCAGAGAAAAAGGTCGG - Intergenic
916015082 1:160742545-160742567 GAGTAGCCTAACGAGAAGGTGGG - Intronic
916031814 1:160883573-160883595 GACTAGTGATAGGAGAGGGTAGG - Intronic
916743512 1:167666658-167666680 GAGCATCCAGAGGAAAGGGTGGG + Intronic
917943997 1:179950910-179950932 GAATAGACATAGGGGAGGGGAGG - Intergenic
919982537 1:202651179-202651201 GAGGAGCCATGGGAGTGGGAAGG + Intronic
920149655 1:203894571-203894593 GAGTCTCCAAAGGAGAGGGGAGG + Intergenic
920495209 1:206449707-206449729 GGTGAGTCATAGGAGAGGGTGGG - Intronic
920596023 1:207270978-207271000 GAGCAGGCATGGCAGAGGGTGGG + Intergenic
923409258 1:233691070-233691092 GAGTGGCCAGGGGAGGGGGTTGG - Intergenic
923475995 1:234331835-234331857 GAGTAGACAAAGGAGAGACTGGG - Intergenic
1065669821 10:28103841-28103863 GAGAAGCCATAGGAATGGGGAGG + Intronic
1070540273 10:77410600-77410622 AAGAAGCCATAGGAGGGTGTTGG - Intronic
1075909920 10:126115354-126115376 GAGTAGCCGATGGAGAGGGAAGG + Intronic
1075925187 10:126245663-126245685 GATTTGCCATTGGAGAGGTTGGG + Intronic
1076656119 10:132024790-132024812 GAGAAGAAATAGGAGGGGGTGGG - Intergenic
1078088421 11:8248622-8248644 GAGTAGAAATAGGTAAGGGTAGG + Intronic
1083249523 11:61456760-61456782 GAGTATCCAGAGGAGAGAGGAGG - Intronic
1084461005 11:69296554-69296576 GAGAAGGAAGAGGAGAGGGTAGG - Exonic
1087181778 11:95149305-95149327 GATTAGGCAAAGGAGAAGGTGGG + Intergenic
1088645512 11:111913467-111913489 TAGTAGCCATGGTAGAGTGTGGG - Exonic
1089268989 11:117288325-117288347 GAGGGGCCATTAGAGAGGGTAGG + Exonic
1089401128 11:118165247-118165269 GAGGAGCCAGAGAAGAGGGCAGG + Exonic
1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG + Intergenic
1090848835 11:130553207-130553229 GTGTTGTCATAGCAGAGGGTGGG - Intergenic
1090874513 11:130776763-130776785 GGGTAGGAATAGAAGAGGGTTGG - Intergenic
1093944171 12:25088009-25088031 GAGTAGGCTTAGGAGAGGACAGG + Intronic
1097154943 12:57006019-57006041 GGGCAGCCAGAGGAGAGGGTGGG + Intronic
1100712104 12:97268653-97268675 GAGTGGCCGTGGGAGTGGGTAGG - Intergenic
1103443131 12:120978394-120978416 GAGTGGGCAGAGGGGAGGGTGGG - Intergenic
1105824366 13:24108813-24108835 GAGTAGTCACAGAAGAGGTTGGG - Intronic
1110338615 13:74363031-74363053 GAGTGGCCAGAGGAGAGGGGAGG - Intergenic
1114243803 14:20893806-20893828 GAGTAGCAGAAGGAGAAGGTGGG + Intergenic
1117110099 14:52443822-52443844 GACTAGACATAGGAAAGAGTAGG - Intronic
1118155154 14:63233054-63233076 GAGTAGCCAAAGGATAGGTGAGG + Intronic
1118175707 14:63437944-63437966 GAGTAGAGAGAGGTGAGGGTTGG - Intronic
1118920805 14:70148395-70148417 TAGTTGGCATGGGAGAGGGTTGG + Intronic
1119212191 14:72840426-72840448 GAGTAGCCATGTGGGAGGGTAGG - Intronic
1121602415 14:95215569-95215591 GAGCAGCCACAGAAGAGAGTGGG - Intronic
1123716537 15:23037377-23037399 GAGGAGCCAGAGGACAAGGTTGG - Intronic
1123795082 15:23763140-23763162 TAGCAGCCAAAGGGGAGGGTGGG + Intergenic
1128340909 15:66821955-66821977 GGGTTGCCATAGGGGAGGGGAGG - Intergenic
1128404848 15:67325159-67325181 GAGTAGGCAGAAGAAAGGGTAGG - Intronic
1130663759 15:85852288-85852310 CAATATACATAGGAGAGGGTGGG + Intergenic
1134383855 16:13753479-13753501 GAGGAGCGAAAGGAGAGGATCGG + Intergenic
1137518767 16:49173731-49173753 GAGTATCCAGAGGAGGGGCTTGG + Intergenic
1138206754 16:55130996-55131018 GGGAAGCTTTAGGAGAGGGTGGG - Intergenic
1138366389 16:56481396-56481418 GAGTAGACATGGGAGAGGAAAGG + Intronic
1138607500 16:58098408-58098430 GAGTGGCCAGAGGAGGGAGTGGG - Intergenic
1138629333 16:58281042-58281064 GAGAAGCCAGAAGAGAGGGAAGG - Exonic
1138694054 16:58795084-58795106 GAGCAGACATAGCACAGGGTTGG + Intergenic
1139515384 16:67449629-67449651 GAGAAGCCACTGGAGAGAGTAGG - Intronic
1141349844 16:83284268-83284290 GAGTAGTCAAAGCAGAGAGTTGG + Intronic
1141426275 16:83946605-83946627 GAGGAGCCATAGGAGGAGGGTGG - Intronic
1141675501 16:85515317-85515339 GAGGAGCCTCAGGAGAGCGTGGG - Intergenic
1141958257 16:87386859-87386881 TAGTAACCATAGAAGATGGTTGG + Intronic
1143491807 17:7289435-7289457 GAGGAGCCAAAGGATAGAGTAGG + Intronic
1144080149 17:11757090-11757112 CAGTTGCCAAAGGTGAGGGTTGG + Intronic
1144572364 17:16407805-16407827 GAGGAGGCAGAGGTGAGGGTGGG + Intergenic
1144841230 17:18187302-18187324 GAGTAGCCATAGGTAAGAGGGGG + Intronic
1147349979 17:39834917-39834939 GAGAAGCCATGGGAGGGGGTAGG + Intronic
1147993385 17:44348755-44348777 CAGTAGCCATGGGAGAGGACAGG - Intronic
1149024869 17:52016037-52016059 GAGTAGACATTGGAGAAGGGTGG + Intronic
1149084779 17:52702383-52702405 GAGAAGACAGACGAGAGGGTAGG - Intergenic
1149571318 17:57674258-57674280 GAGTAGCCAGTGGGGAGGGGCGG + Intronic
1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG + Intergenic
1153671263 18:7414713-7414735 GAGAAGCCAGAGAAGCGGGTGGG + Intergenic
1157684034 18:49628703-49628725 GTGGGGCTATAGGAGAGGGTAGG + Intergenic
1157799041 18:50603452-50603474 GTGTAGACATAGGAGAGTTTAGG - Intronic
1159070304 18:63615346-63615368 GAGTAACAATAGGAGAAAGTGGG + Intergenic
1161041068 19:2111040-2111062 GAGCAGCCATAGGAGGCGCTTGG - Intronic
1164649597 19:29882412-29882434 GGGTAGCCCCAGGCGAGGGTGGG + Intergenic
1165084137 19:33331073-33331095 CAGAAGTCAGAGGAGAGGGTAGG + Intergenic
1165720043 19:38072703-38072725 GGGTGGCCATTGGAGAGGGGAGG + Intronic
1165942676 19:39423113-39423135 CAGGAGTCACAGGAGAGGGTGGG - Exonic
1167575435 19:50315478-50315500 GAGCAGCCAGCGGAGAGGGCAGG + Intronic
928965114 2:36967996-36968018 AAGTAGCCATGGGAAAGGGGGGG - Intergenic
929461015 2:42101975-42101997 GAGTGGGCAGAGGAGAGGGCTGG + Intergenic
929707051 2:44224571-44224593 GAGTAGTAATAGGAGGGGGAAGG - Intronic
930434844 2:51327849-51327871 GAGTAGCCCAAGGTGAGGTTAGG - Intergenic
930494268 2:52119627-52119649 GAGTAGATATAGGAGAGAATGGG - Intergenic
933761146 2:85673126-85673148 GAGTGGGGATAGGAGAGGGGAGG - Intergenic
934037436 2:88099981-88100003 GAGGAGCCAGAGGAGAAGGGAGG - Intronic
934568140 2:95351955-95351977 GAGTCACCAGAGAAGAGGGTGGG + Intronic
935356596 2:102207231-102207253 GCATAGCCACAGGGGAGGGTAGG - Intronic
936419990 2:112354294-112354316 TAGTAGCCATCTGAAAGGGTAGG - Intergenic
936665030 2:114585161-114585183 GAGTCTCCAAAGGAGAGTGTAGG - Intronic
942978133 2:182044029-182044051 GACTCGACATAGGTGAGGGTGGG - Intronic
943065878 2:183085605-183085627 GAGGAGCCATAGGTGAGGAGGGG + Intronic
943385787 2:187202448-187202470 GAGTAATGATAGGAGAGGCTAGG + Intergenic
946187581 2:217989725-217989747 GAGCTGCCACAGGAGAGGGCTGG + Intronic
947534056 2:230929841-230929863 GGGGAGCCATGGGACAGGGTGGG - Intronic
1170447359 20:16442103-16442125 GAGTGGTTGTAGGAGAGGGTTGG + Intronic
1170803148 20:19606998-19607020 ATGTAGGCATAGAAGAGGGTTGG + Intronic
1171083320 20:22211046-22211068 GAGTAGTCATAGCAGGGGTTAGG - Intergenic
1172195216 20:33086902-33086924 GAGAAGCCAAAGAAGAGGGCAGG - Intronic
1173091229 20:39974452-39974474 GAGATGCCACAGGAGAAGGTTGG + Intergenic
1173618867 20:44421220-44421242 CAAGAGCCACAGGAGAGGGTAGG - Intronic
1175415486 20:58797861-58797883 GAGGAGCCGCTGGAGAGGGTGGG + Intergenic
1181149762 22:20874854-20874876 TAATTGCCATAGGAGAAGGTAGG + Intronic
1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG + Intronic
1183072665 22:35407224-35407246 GAGCAGCCAGTGAAGAGGGTGGG - Intronic
1183862794 22:40681719-40681741 AAGTAGACAAAGGTGAGGGTCGG - Exonic
949599036 3:5578879-5578901 GCATAGCCAAAGGAGAGTGTGGG + Intergenic
952307783 3:32160779-32160801 GAGTGGCCTCAGGAGAGGCTGGG - Intronic
954440813 3:50521062-50521084 GAGTTGCAATGGGAGAGGCTGGG + Intergenic
956503582 3:69913223-69913245 GAGTAGAGATAAGAGAGAGTAGG + Intronic
957049934 3:75403721-75403743 GAGTGGCCATAGAAGGAGGTTGG + Intergenic
959060804 3:101614454-101614476 GAGTTGAGATAGGAGAGGGAGGG + Intergenic
962605098 3:137026276-137026298 GTGTAGCCATAGGAGAGAGCAGG + Intergenic
963098862 3:141578605-141578627 GAGTAGCCCCAGCAGAGAGTGGG + Intronic
969900854 4:10347986-10348008 GAGCAGCCATTAGAGGGGGTAGG + Intergenic
970115058 4:12685666-12685688 GTGTAGCCAGAGGGGAGGGGAGG - Intergenic
970833064 4:20366151-20366173 GAGGAGCAATAAGAGAGGGAGGG - Intronic
977622643 4:99154639-99154661 GAGTACCTATAGGAAAGAGTAGG - Intronic
977810507 4:101350117-101350139 GAATGGCAGTAGGAGAGGGTAGG - Intergenic
981681874 4:147408564-147408586 AAGTAGCCATAGGTGAGAGTAGG + Intergenic
984994147 4:185412026-185412048 GAGGAGGCAGAGGAGTGGGTAGG + Intronic
986212380 5:5686204-5686226 GTGGGGCCATAGGAGGGGGTTGG - Intergenic
988029356 5:25742235-25742257 GAGTAGACATAAGAGAATGTTGG - Intergenic
988494146 5:31730451-31730473 GATGGGCCACAGGAGAGGGTCGG + Intronic
989025205 5:37060097-37060119 TTGTTGCCAAAGGAGAGGGTAGG + Intronic
993620732 5:90164681-90164703 GAGAAGCCACAGGATAGGGGAGG + Intergenic
996909510 5:128639358-128639380 GACTAGCCATAGGAGATACTTGG - Intronic
997374271 5:133385591-133385613 GAGGAGCCAGTGGACAGGGTGGG - Intronic
999550936 5:152686727-152686749 GAATAGCCATAGAAGAGTGTAGG + Intergenic
1001186961 5:169583641-169583663 CAGTAGCTGTAGGAGGGGGTGGG + Exonic
1002366836 5:178719608-178719630 GACTAGCTATAGGATAAGGTGGG - Intronic
1002847627 6:961968-961990 GTGGAGGCATAGGAGAGGGATGG - Intergenic
1004694827 6:18023919-18023941 GAGTGGTCATAGAAGAGAGTGGG + Intergenic
1005862390 6:29911548-29911570 GAGGAGACATAGAAGAGGGGAGG + Intergenic
1008133111 6:47740485-47740507 GTGGATCCAAAGGAGAGGGTGGG + Intergenic
1008184561 6:48372841-48372863 TAGATGCCATAGGTGAGGGTTGG + Intergenic
1013212430 6:107999081-107999103 GAGTAAGCATAGGGGAGGGAGGG + Intergenic
1015693521 6:135954571-135954593 GAGTACTCCTAGCAGAGGGTTGG - Intronic
1017814304 6:158005709-158005731 GAGTTGCCATCTGGGAGGGTGGG - Intronic
1018842356 6:167526521-167526543 CAGTTGCCATAGGACAGGGTGGG - Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1020947583 7:14632666-14632688 GAGAAGTCATAGGAGTGGGTGGG + Intronic
1021826530 7:24558370-24558392 GAGTATGCTTAGGCGAGGGTGGG - Intergenic
1022800788 7:33775417-33775439 GAGGAGTCCCAGGAGAGGGTTGG + Intergenic
1023731637 7:43197484-43197506 CAGTGGCCCAAGGAGAGGGTGGG + Intronic
1024630701 7:51244578-51244600 GAGTGGCCGTAGGAGAGGCTGGG - Intronic
1027294166 7:76749913-76749935 GAGATGCCAGAGGAGAGGGAGGG - Intergenic
1027411303 7:77921558-77921580 CAGTAGCCATAGAAGAGCATGGG + Intronic
1028308252 7:89293990-89294012 GAGTTGCCATAGAAATGGGTAGG - Intronic
1029515582 7:101021158-101021180 GAGGAGACAGAGGTGAGGGTTGG - Intronic
1030087122 7:105825919-105825941 GAGAAGCCATAGGGAAGGGATGG + Intronic
1031586295 7:123534961-123534983 GAGGAGCCAGAGGAGGGGGATGG + Intronic
1036427451 8:8658215-8658237 GAGTTGCCAGAGGAGAGGAGAGG + Intergenic
1037753440 8:21697040-21697062 GAGGAGACAGAGGAGAGGGAAGG + Intronic
1041558649 8:59188408-59188430 GAGTAGCCTTGGCAGAGGTTTGG - Intergenic
1041952549 8:63520135-63520157 GTGAGACCATAGGAGAGGGTGGG + Intergenic
1042217334 8:66439375-66439397 GAGAAGCCAGAGGAGAGACTGGG + Intronic
1043110429 8:76172921-76172943 GTGTAGCCACAGGAGAGGCAGGG - Intergenic
1045935249 8:107671369-107671391 GAGGAGCCAAAAGTGAGGGTTGG + Intergenic
1045981783 8:108198064-108198086 GAGTAGGCTGAGGAGGGGGTTGG - Intergenic
1046710502 8:117505913-117505935 GAGTAGCTGTAGGAGATGGAGGG - Intergenic
1050206857 9:3205465-3205487 GAGCAGCCAGAGGAGTGGGATGG + Intergenic
1050445222 9:5714809-5714831 GAGTAGCTATGGGACAGGTTTGG + Intronic
1052084050 9:24241885-24241907 AAGAAGCCACAGGAGAGTGTGGG - Intergenic
1052755813 9:32539703-32539725 GATTAGACAAAGGACAGGGTGGG - Intergenic
1060184053 9:121553067-121553089 GAGTAGACAGAGGAGAGGAGAGG - Intergenic
1061599996 9:131662270-131662292 GAGTAGCTGGAGGAGAAGGTGGG - Intronic
1185681764 X:1894180-1894202 GAGAAGCAGTAGGAGAGGGGAGG - Intergenic
1186887766 X:13931785-13931807 GAGTAGGTATGGGAGAGAGTAGG - Intronic
1195095721 X:101499320-101499342 GAGTTGCCATAGAAGATGGCGGG + Intronic
1195740787 X:108062767-108062789 GGCTAGCCATAGGATAGGGAAGG - Intronic