ID: 1181737496

View in Genome Browser
Species Human (GRCh38)
Location 22:24893241-24893263
Sequence CTGAAGACACAAAGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181737496_1181737499 -5 Left 1181737496 22:24893241-24893263 CCTTGCTCCCTTTGTGTCTTCAG 0: 1
1: 0
2: 4
3: 46
4: 390
Right 1181737499 22:24893259-24893281 TTCAGAGCCTAACCAGTGCTAGG 0: 1
1: 0
2: 2
3: 13
4: 154
1181737496_1181737502 9 Left 1181737496 22:24893241-24893263 CCTTGCTCCCTTTGTGTCTTCAG 0: 1
1: 0
2: 4
3: 46
4: 390
Right 1181737502 22:24893273-24893295 AGTGCTAGGCATAGCATAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 76
1181737496_1181737503 30 Left 1181737496 22:24893241-24893263 CCTTGCTCCCTTTGTGTCTTCAG 0: 1
1: 0
2: 4
3: 46
4: 390
Right 1181737503 22:24893294-24893316 GGTGCTCAGTTAATATCTGCTGG 0: 1
1: 0
2: 13
3: 81
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181737496 Original CRISPR CTGAAGACACAAAGGGAGCA AGG (reversed) Intronic
900827371 1:4937580-4937602 CTAAGGACAGAAAGGGAACAAGG + Intergenic
902099560 1:13974701-13974723 CTGAGGAAGCAAAGGAAGCAAGG + Intergenic
902177686 1:14663331-14663353 CTGAAGACAGGAAGGGAACTTGG + Intronic
902433903 1:16384646-16384668 CTGAAGACATAAGGCTAGCATGG + Intronic
902452420 1:16505511-16505533 CTGAAGACACCCAGGCAGGAAGG - Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
903918880 1:26785456-26785478 TTGAAGACACACAGTGTGCAAGG + Intergenic
904982418 1:34517858-34517880 TTGGAGAAAGAAAGGGAGCAAGG - Intergenic
906552285 1:46674970-46674992 CTGAAGAAGCAAAGGCTGCAGGG - Intergenic
906792224 1:48669044-48669066 CAGAAGAAACACAGGGAACACGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
911160269 1:94676877-94676899 CTGAAGATATAAAAGGAGCTTGG - Intergenic
911439282 1:97905243-97905265 CTAAAGATGCAAAGGGAGCAAGG + Intronic
911632390 1:100197886-100197908 AAGATGACACAAAGGGAGAAAGG + Intronic
911809858 1:102262079-102262101 CTGAAGACCCAAAGGTGGTAAGG - Intergenic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914095714 1:144543091-144543113 CTGAAGACACCCAGGCAGGAAGG - Intergenic
915277917 1:154802392-154802414 TTGAAAAAACACAGGGAGCAGGG + Intronic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
916067314 1:161146621-161146643 CTGAAAACACAAGGAGAGCCTGG - Intergenic
916266889 1:162898948-162898970 CTAAAGACATAAAGGATGCATGG + Intergenic
916336322 1:163674727-163674749 CTTAAGACACGAACAGAGCAGGG - Intergenic
916652077 1:166842062-166842084 CTGATGAGACAAAGGCAGCGCGG - Intronic
917844525 1:179009396-179009418 CTGAAGCTAGAAAGGGAGGAGGG + Intergenic
920336373 1:205247938-205247960 CTCAAGCCCCAAAGGGAGCAGGG + Intronic
921318848 1:213917848-213917870 CTGAAGACAAAGTGGAAGCAAGG - Intergenic
921711170 1:218374798-218374820 TTGAACTCACAGAGGGAGCAGGG - Intronic
921962936 1:221055051-221055073 CTGAAGTCATACAGGGATCAAGG + Intergenic
924328035 1:242915000-242915022 ATGCAGACACCACGGGAGCAGGG + Intergenic
924603233 1:245509848-245509870 CTGAAGGCAGGAAGGGAGAAGGG - Intronic
1064101861 10:12471038-12471060 AAAAAGACACAAAGGGAGGAAGG - Intronic
1065815498 10:29479310-29479332 CTGAAGCCACACAGCTAGCAGGG - Intronic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066245537 10:33580231-33580253 CCGCAGACACAAAGAAAGCAGGG - Intergenic
1067155495 10:43777750-43777772 GTGTAGACACAAAGGGAACAAGG - Intergenic
1067995132 10:51263587-51263609 ATGAGGACATAAAGAGAGCAAGG - Intronic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1069754395 10:70764316-70764338 CTGAAGCCAGGTAGGGAGCAGGG - Intergenic
1070688913 10:78510467-78510489 ATGAAGACACAAAGAGATGAGGG + Intergenic
1070997870 10:80802087-80802109 TGGAAGACAGAAAGTGAGCATGG - Intergenic
1071003957 10:80860686-80860708 TTCCGGACACAAAGGGAGCATGG + Intergenic
1071702532 10:87955554-87955576 CTGAAGGCAAAAGGGGAGCATGG + Intronic
1072861291 10:99007755-99007777 CAGATGACAAAATGGGAGCAGGG + Intronic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1073939119 10:108673506-108673528 CTGAAGGCATAAAGCCAGCAAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1076210361 10:128636717-128636739 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1076922615 10:133462658-133462680 CTGAAGGCACTAAGGGAGCCCGG - Intergenic
1077957417 11:7035723-7035745 AGGAGGACACAAAGGGAGAAGGG - Intronic
1078029016 11:7729656-7729678 CTAAAGACAGAAAGACAGCAAGG + Intergenic
1079781435 11:24610782-24610804 CTGAAAACACAAAATGAGCTGGG + Intronic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081164747 11:39793788-39793810 GTGAAGACACAAAGAGAAGAAGG + Intergenic
1081235564 11:40643470-40643492 CTGATGATACAAAGGGTGGAGGG - Intronic
1081692373 11:45087098-45087120 CTGAAGACAAAAGGTGACCAGGG - Intergenic
1082204134 11:49411032-49411054 ATGAAGATACAAAGGGATCATGG + Intergenic
1085192000 11:74634724-74634746 CTTAAGACACAAAGGATGCATGG - Intronic
1085849752 11:80106395-80106417 CTCAAGACACAACAGGAGCATGG + Intergenic
1086395967 11:86415297-86415319 CAGAGGACACAAAGAGAGTAAGG + Exonic
1087289653 11:96306430-96306452 TTCAAGTCACAAAGGGAGCTAGG - Intronic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1087905214 11:103688122-103688144 TTGAAGACACAAAGTTAGAAAGG + Intergenic
1088864184 11:113831138-113831160 CTGAAGACACAAAGACAAGAAGG + Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1090742263 11:129675212-129675234 CAGAAAACACAAAAAGAGCAGGG + Intergenic
1090776218 11:129968423-129968445 CTGAGGACAAAAACGGAGGAGGG + Intronic
1092517242 12:9227397-9227419 CAGAAGGCTAAAAGGGAGCAAGG + Intergenic
1093088319 12:14891516-14891538 GTGAAGACATGAAGGGAGTAGGG + Intronic
1096781226 12:53993384-53993406 CTGAAGACTCAAAGGCTGCTAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098217926 12:68239388-68239410 CTGAAGACACAAGGGATGCAAGG - Intergenic
1099679072 12:85801438-85801460 CTCAATTCAAAAAGGGAGCAGGG + Exonic
1100709760 12:97243217-97243239 TTGAAGACACCAACAGAGCAAGG - Intergenic
1100838985 12:98593402-98593424 GTGAAGGGACAAAGCGAGCAGGG + Intergenic
1101270862 12:103142983-103143005 ATGATCACACAAAGGGGGCAAGG + Intergenic
1102527200 12:113520464-113520486 CGGAACACACAAAGGGAGCCAGG - Intergenic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104538126 12:129637765-129637787 CTGAAGGTGCAAGGGGAGCAGGG + Intronic
1106077569 13:26474567-26474589 AGGAAGACAAAAAGGCAGCAGGG + Intergenic
1106563417 13:30865558-30865580 CAGCACACAGAAAGGGAGCAGGG + Intergenic
1106598786 13:31169817-31169839 ATGAAGAGAGAAAGGGAGGAAGG - Intergenic
1107680403 13:42842833-42842855 CAGAAGACACCAAAGGAGGACGG - Intergenic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1107940846 13:45379079-45379101 ATGAGGTCACAAAGGGGGCAGGG - Intergenic
1108146327 13:47481080-47481102 CTTAAAAGACAAAGGAAGCAGGG + Intergenic
1110126562 13:71950283-71950305 CTGAAGACACAATGCTAGCAGGG + Intergenic
1110158229 13:72343758-72343780 CTGAAGGAACAAAGCAAGCAGGG - Intergenic
1110483290 13:76008523-76008545 CTAAAGATACAAAAGGAGTAAGG - Intergenic
1110892170 13:80706679-80706701 ATGAGGTCACAAAGGGGGCAGGG + Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112431355 13:99353455-99353477 ATGAAGACACCAAGGCAGGATGG - Intronic
1113328439 13:109306314-109306336 CTGAAAACTCAAAGAGAGGAAGG + Intergenic
1113450601 13:110406924-110406946 CTGAAGGCATAAGGGGAACAAGG - Intronic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1113738538 13:112695367-112695389 CTGAAGACAAGAAGGGTGCTTGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114688921 14:24562268-24562290 CAGAAGGCAAACAGGGAGCAAGG - Intergenic
1114896484 14:26996935-26996957 CTGAAGATGAAAAGGTAGCAGGG + Intergenic
1115263066 14:31473172-31473194 CAGAAGACAAAAGGGAAGCAAGG + Intergenic
1115464442 14:33699480-33699502 TTGAAGACAGAAAGGGCGCCAGG + Intronic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1117234197 14:53754157-53754179 CAGAAGACAAAAGAGGAGCAAGG - Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1117481888 14:56154518-56154540 CTGAAGGCAAAAGGGAAGCAAGG - Intronic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1119171603 14:72540035-72540057 CTAAAGCCAGAAAGTGAGCAAGG + Exonic
1119754398 14:77104617-77104639 GTGAAGGCCCTAAGGGAGCAAGG - Intronic
1121649327 14:95545552-95545574 CAGAAGACATAAAGGTATCATGG - Intergenic
1121726264 14:96153156-96153178 CAAAAGACACAAAGGTAGGAAGG + Intergenic
1121802732 14:96788412-96788434 CTGAAGACACAAGGAGAAGACGG - Intergenic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122640939 14:103158896-103158918 CAGAACTCACAAAGGGAGGAGGG - Intergenic
1123942341 15:25222652-25222674 TGAAAGACACAAAGGGAGAATGG - Intergenic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1124943732 15:34243308-34243330 GTGAAGACAGAAAGGGAACAAGG + Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1125770087 15:42159440-42159462 CTGATGACACACAGGGAGAGTGG - Exonic
1126286106 15:47012911-47012933 ATGAAGAGACAAAGGAAGCAGGG - Intergenic
1126425615 15:48524222-48524244 CTTAGAACACAAAGGGAGCTCGG + Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129475646 15:75783083-75783105 CAGAAGACGCTACGGGAGCAGGG + Intergenic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1131007234 15:88987939-88987961 CAGAAGACAGAAGGGGAACACGG - Intergenic
1131358789 15:91770681-91770703 TTGAAGACACAAAAGATGCAAGG - Intergenic
1131510533 15:93047408-93047430 CTGAAGCCACGAAGGGAGGTGGG + Intronic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132514778 16:361224-361246 GGGAAGAGACAAAGGGAGCAGGG - Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132592839 16:733862-733884 CTGAAGACACTCAGCCAGCAGGG - Intronic
1132801641 16:1757630-1757652 CTGAAGTCACAATGGGAGCAAGG - Intronic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1134043446 16:11084900-11084922 CTGAAGGCAGAAAGGGCCCATGG + Intronic
1134054076 16:11158132-11158154 CTGAAGACAGCAAGTGTGCATGG - Intronic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1138103970 16:54277136-54277158 CTAAAGACAGGAAGGGAGGAAGG + Intergenic
1140703656 16:77605970-77605992 CTTATGACACAAAGGAAGAAAGG + Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1142066439 16:88065606-88065628 CTGAAGACACAACAGGAACGGGG + Intronic
1142500075 17:327400-327422 CTGAAGACAGGAGAGGAGCAGGG + Intronic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1146099621 17:29967790-29967812 ATGAAGACATAAAGGAAGCTGGG + Intronic
1147894047 17:43738738-43738760 GTGCAGACACAAGGGGAGTATGG + Intergenic
1149001240 17:51759819-51759841 CTTAAGGCACGAAGGGAGGATGG - Intronic
1149414239 17:56442329-56442351 ATGCAGACACAAAAAGAGCAAGG + Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1151409537 17:73912686-73912708 CTGAAGACAGGAAGGAAGGAAGG - Intergenic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1152273749 17:79341715-79341737 CAGAACTCAGAAAGGGAGCAAGG - Intronic
1152734564 17:81991123-81991145 CTGAAGACCGTGAGGGAGCAGGG + Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1203163005 17_GL000205v2_random:68924-68946 CTGAAGACAGAAAGTGAGCGTGG + Intergenic
1154165632 18:12012265-12012287 CTGAAGCCAGAAAGGAAGGATGG - Intronic
1156073769 18:33246776-33246798 CTAAAGACACATAGAGAGCAAGG + Intronic
1156227939 18:35127513-35127535 CTGAAGAAAGAAAGGAAGAAGGG - Intronic
1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG + Intergenic
1156914832 18:42453612-42453634 GTGAAGACAGAAATGGAGCTGGG + Intergenic
1156935559 18:42702011-42702033 CAGAAGAGACAAAGTCAGCATGG + Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158170794 18:54596908-54596930 CTGATGACACAAAGACAGCAGGG - Intronic
1159467547 18:68804174-68804196 ATGAAGAGACAAAGGAATCAAGG + Intronic
1159469162 18:68826996-68827018 CTGAAGCCACAAAGGCTACAAGG + Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160544498 18:79643625-79643647 CTGATCACACAAATGGATCAAGG + Intergenic
1161003668 19:1924061-1924083 CAGAAGACAGAAAATGAGCATGG - Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1163519284 19:17782363-17782385 CTAAAGACACAAAATCAGCAGGG - Intronic
1163935688 19:20441117-20441139 CTGGAGAGAGAAAGAGAGCATGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166713787 19:44953708-44953730 GTGATGACACAAAGTGAGCAGGG + Intronic
1166896656 19:46026955-46026977 CTGAAGTCCCCAAGGGAACAGGG - Intergenic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1167933391 19:52886772-52886794 CTAAAAACACAAAGTGAGCTGGG + Intronic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
924973219 2:150430-150452 AGGAAGACTCAAAGGGAGGAAGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928380521 2:30813958-30813980 CTGAAGACACAAAAAGAGACTGG + Intronic
928437561 2:31265430-31265452 CAGAAGACAATAAGGGAGCTGGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930338271 2:50078595-50078617 CTGAAGGGACAAAGGAAACATGG - Intronic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
930906505 2:56574771-56574793 ATGAAGACAAACTGGGAGCAGGG - Intergenic
930989584 2:57636573-57636595 CTAAAGAGACAAAGAGAGAAAGG + Intergenic
932267841 2:70383550-70383572 CGGAAGGCAAAAAGGAAGCAAGG - Intergenic
932895440 2:75635017-75635039 CTGAAGTCACTAAGGAACCATGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935083424 2:99821902-99821924 ATGAAGAAACAAAGGCAGCCAGG + Intronic
937016003 2:118606343-118606365 CTCAAAACACAAAGGTAGCCAGG - Intergenic
937024485 2:118686700-118686722 CTGAAGGCAAAAAGGGCTCATGG - Intergenic
937342191 2:121098428-121098450 TTGAAGTCACACAGGGAGAAGGG - Intergenic
938408887 2:131047631-131047653 CAGAAGCCAGAAGGGGAGCATGG + Intergenic
939508807 2:143081497-143081519 CTGATGACCCAAAGGAAGAAAGG - Intergenic
940065476 2:149622874-149622896 ATGATGACAGAAAGGGAGAAAGG - Intergenic
940805134 2:158178903-158178925 ATGAAGACAAAGAGAGAGCACGG - Exonic
941361071 2:164551979-164552001 CAGAAGACAAAGCGGGAGCAGGG + Intronic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
943127298 2:183810469-183810491 CTGAAGGAACAACGGTAGCAGGG + Intergenic
944941392 2:204632219-204632241 CAGAAGGCAAAAGGGGAGCAAGG - Intronic
945562981 2:211361191-211361213 CTGAAGACCCAAAGATAGAAGGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
946637902 2:221750676-221750698 CTGAAGGCACAAAGGACCCATGG - Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948130651 2:235598116-235598138 CGGAAGACCCAAAGGAAACATGG - Intronic
1169423537 20:5478386-5478408 CATGAGACACAAAGAGAGCAGGG - Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1170877435 20:20263750-20263772 TTAAAGACACAAAGGTAGCCAGG - Intronic
1171303514 20:24084741-24084763 CTCAAGACAGAAAGGGAGAGAGG - Intergenic
1172009504 20:31838151-31838173 CTGAGGGCACACAAGGAGCAGGG + Intergenic
1172189561 20:33053839-33053861 CTGAGGACACAAAGGGGCCACGG - Intergenic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1173266225 20:41484839-41484861 CAGAAGATAAAAAGGGAGAAAGG + Intronic
1173576199 20:44114279-44114301 GGGAAGAGAGAAAGGGAGCACGG + Intronic
1174127395 20:48317053-48317075 CTGAAGCCACGGAGGAAGCATGG + Intergenic
1175008716 20:55712648-55712670 GAGAAGACAGAAATGGAGCAGGG + Intergenic
1175391857 20:58632494-58632516 CAGAAGACACATAGGGAAGAGGG + Intergenic
1175467937 20:59205230-59205252 GTGCAGAGACAAAGGGAGGAAGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175998129 20:62820404-62820426 CAGAAGCCACAAGGGGAGAAAGG - Intronic
1177300438 21:19237437-19237459 CTGAAGAAACTAAAGGAACATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178564152 21:33667948-33667970 TAGAAGACAGATAGGGAGCAAGG + Intronic
1178739596 21:35185957-35185979 CTGCAGTCACAAAGGCAGGATGG - Intronic
1179088497 21:38242000-38242022 CAGAGGGCAAAAAGGGAGCAAGG - Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1179525808 21:41975083-41975105 GTGAAGACTCAAGGGAAGCAAGG - Intergenic
1180234615 21:46450305-46450327 CAGAAGACAAAGGGGGAGCAAGG - Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181101579 22:20544020-20544042 CTAAAGAAACAAAGGAAACAAGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182803714 22:33052921-33052943 CAGAACCTACAAAGGGAGCATGG + Intronic
1182985776 22:34714770-34714792 CTGGAGCCTCGAAGGGAGCATGG + Intergenic
1183264601 22:36817478-36817500 GTGGAGAGAGAAAGGGAGCAGGG - Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184583783 22:45434274-45434296 CTGAAGGCAAAAGGGGAGCTTGG + Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
950239987 3:11360635-11360657 CTGAAGAAACCAAAGCAGCAAGG + Exonic
950845758 3:16014691-16014713 CAGAAGACAGCAAGAGAGCAAGG - Intergenic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
952070180 3:29625109-29625131 GTGAAGGCAAAAAGGAAGCAAGG - Intronic
952156449 3:30648690-30648712 CGAAAGACACAAGAGGAGCAAGG - Intronic
952283616 3:31947018-31947040 CAGAAGAGACAAAGGCAGGAGGG + Intronic
952609644 3:35192658-35192680 CTGCAGATACACAGAGAGCATGG - Intergenic
952657819 3:35807643-35807665 TTAAAGACCCAAAGGGTGCAGGG - Intergenic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953463580 3:43101035-43101057 TTGAAGACACCATGGGTGCAGGG - Intronic
953806830 3:46077747-46077769 TTAAAGACAAAAAGTGAGCAAGG - Intergenic
954493495 3:50930598-50930620 CTGGAGCCACCAAGGGAGCCTGG - Intronic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954749591 3:52806080-52806102 CTGCAGATACAAAGGGAGAGAGG - Intronic
955647840 3:61159490-61159512 GTGAAGACACCAAGTGGGCAAGG - Intronic
956718385 3:72098156-72098178 CTGAAGGGACAAGGGGAGCAGGG + Intergenic
957484927 3:80848086-80848108 ATGAAGACAGAAAGAGAGAAAGG - Intergenic
957679464 3:83414193-83414215 CTGAAGCTAAAAAGGCAGCATGG - Intergenic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
959105277 3:102058448-102058470 CCAAAGACCCAAAGGAAGCAAGG + Intergenic
959678161 3:109060826-109060848 CAGAAGGCAAAAAGGAAGCAAGG + Intronic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
961272135 3:125697214-125697236 ATGAGGTCACAAAGGGGGCAGGG + Intergenic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961466562 3:127085321-127085343 CTGAGGACACACAGCCAGCAAGG - Intergenic
962616778 3:137134585-137134607 CTGATTAAACAAAGGGAGCCGGG - Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
965917815 3:173872405-173872427 CTGAAGAAAAACAGGGAACATGG - Intronic
966522070 3:180884491-180884513 CTAAAGAAACCATGGGAGCAGGG - Intronic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
967805284 3:193710332-193710354 ATGAGGAAAAAAAGGGAGCAAGG - Intergenic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
968264426 3:197351699-197351721 CTGAAGACACACTGTGAACAAGG + Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
969213667 4:5707278-5707300 CTAAAGACAGAAAGGGAGCAGGG + Intronic
969327699 4:6453300-6453322 CTGAAGATGTAAAGGCAGCAGGG + Intronic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
969788933 4:9478672-9478694 ATGAGGTCACAAAGGGAGCGGGG + Intergenic
969995673 4:11309982-11310004 ATGAAGACAGAAAGAGACCAAGG - Intergenic
973308628 4:48682052-48682074 ATGAAAACACAAAGGTAACAGGG + Intronic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
976551702 4:86403640-86403662 CAGAAGACAAAGGGGGAGCAAGG + Intronic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
979328029 4:119401525-119401547 ATTAGGACACAAAGGGAACACGG + Intergenic
981061197 4:140427280-140427302 CTGAAGACACAAAGGGTCCCAGG + Intronic
981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG + Intergenic
981598046 4:146449434-146449456 CTGAAGGAACAAGAGGAGCAGGG + Intronic
982231122 4:153209123-153209145 CTGAAGGCACGTAAGGAGCAGGG + Intronic
982448164 4:155519122-155519144 GTAAAGAAACAAAGGGAGGAGGG + Intergenic
982593153 4:157342361-157342383 CTGAAGATACTATGGGAGAAAGG + Intronic
982988551 4:162242027-162242049 CTAAATTCACAAAGAGAGCAAGG - Intergenic
985309696 4:188583731-188583753 CTGAAAACACAAAATGAGCAGGG - Intergenic
986253650 5:6083588-6083610 AGGAAGTCAGAAAGGGAGCAGGG - Intergenic
986445285 5:7815971-7815993 GTGAAGACACAAGGAGAGGAAGG - Intronic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
986810563 5:11353880-11353902 TTGAAGACAGAAAGGGATTAGGG + Intronic
989323945 5:40167854-40167876 CCGAAGACAAAAAGAGAGAAGGG + Intergenic
991923533 5:71681330-71681352 CTGAAGCCACCAAGGGAGTCTGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
993025195 5:82637303-82637325 TGGAAGACACACAGGGAGAAGGG - Intergenic
993176608 5:84494521-84494543 AAGAAGAGACAAAGGGAGCCAGG - Intergenic
993781022 5:92065471-92065493 TGGAAGACAGAGAGGGAGCATGG - Intergenic
994750300 5:103728937-103728959 ATGAATACCAAAAGGGAGCAAGG - Intergenic
995020760 5:107364937-107364959 CTTAATTCACAAAGGAAGCATGG - Intergenic
996594731 5:125187202-125187224 CAGAAGAGAAAAAGGCAGCAGGG - Intergenic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
998558353 5:143147829-143147851 GTGAAGACACAAAGGGCTCCTGG - Intronic
998685511 5:144519728-144519750 CTGAATAAACAAAGTGGGCAAGG - Intergenic
1000101415 5:158020744-158020766 CTGAAAACACACAGATAGCAAGG - Intergenic
1001051488 5:168417908-168417930 CTGCAGACACAAAGACAGCTGGG - Intronic
1001545519 5:172568433-172568455 CTCAAGACACAAAGGCAACTCGG - Intergenic
1001803900 5:174567104-174567126 TTGAAGACACAAAGGCTGGAGGG + Intergenic
1002078837 5:176725956-176725978 CTAGAGACAAAAAGGGAGCATGG - Intergenic
1003421410 6:5961526-5961548 CTGGAGAGACCATGGGAGCAAGG + Intergenic
1003635519 6:7828349-7828371 CTGAACACACAAACAGAACAGGG - Intronic
1007702803 6:43774318-43774340 CTGAGGACAGAAAGAGAGCAAGG - Intronic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1008871650 6:56279218-56279240 CAGAAGACAAAGGGGGAGCAAGG - Intronic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1010136824 6:72564716-72564738 CTTAAGACACTAAGGTAGAAGGG - Intergenic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1011488620 6:87868705-87868727 CTGTAGACTAAAAAGGAGCATGG + Intergenic
1011511310 6:88104204-88104226 ATGAAGTCAAAAAGGGATCATGG + Intergenic
1012363366 6:98409943-98409965 ATGAAGACACAATGGGAAGATGG - Intergenic
1012868381 6:104644814-104644836 CTGAGGACACGGAGGTAGCAAGG - Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1016051711 6:139536939-139536961 TTGAACACACAATGGAAGCAAGG - Intergenic
1016598274 6:145826136-145826158 TGGAAGACAAAGAGGGAGCAGGG - Intergenic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017694341 6:156999587-156999609 CTTAAGAAACACAGGCAGCAGGG + Intronic
1018156455 6:160989961-160989983 CTGAAGACAAAGTGGGGGCACGG + Intergenic
1020029152 7:4920717-4920739 CGGAAGAGAGAAAGGGAGGAAGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020944549 7:14585944-14585966 CTGAGGACACAAAGAGAGACAGG - Intronic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1023475304 7:40571718-40571740 CTGAAGACAGAAAAGTAGCTTGG - Intronic
1023694185 7:42827825-42827847 CTAAAGGCACAAAGAGAGGAGGG + Intergenic
1023830330 7:44035442-44035464 CAGAAGGGACTAAGGGAGCAAGG - Intergenic
1024777642 7:52806383-52806405 CTAAAGACACAAAATGAGCTTGG + Intergenic
1026358983 7:69585417-69585439 CAGAAGACACAGTGGGACCAGGG - Intergenic
1026831836 7:73615154-73615176 CTGAAGTCACACAGCCAGCAAGG + Intronic
1027121942 7:75528094-75528116 CTGAAGACTCACAGGAAGCGAGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029740653 7:102489729-102489751 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1029758647 7:102588901-102588923 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1030456538 7:109781745-109781767 TGGAAGTCACAAAGAGAGCAGGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034110737 7:148535439-148535461 CTGAAGACAGAAACTGAACAGGG + Intergenic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036100913 8:5783686-5783708 TGGAAGACACAAGAGGAGCAAGG - Intergenic
1036731079 8:11265355-11265377 CAGAAGGCAAAAGGGGAGCAAGG - Intergenic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037722306 8:21455290-21455312 CTGAACCCACAAAGGGACCTCGG + Intergenic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1037949279 8:23008118-23008140 CTGAGGACACAAAGGGGGGAAGG + Intronic
1038075242 8:24065921-24065943 CTTAAGACACAAAATGAGCATGG - Intergenic
1039300975 8:36208478-36208500 CTAAAGGCACCAAGGAAGCAGGG - Intergenic
1039392010 8:37189004-37189026 CTTAAGACAGAAGAGGAGCATGG - Intergenic
1040580821 8:48697367-48697389 CTGAAGAGAGACAGGGATCAGGG - Intergenic
1040981881 8:53252488-53252510 GGCAAGACACAAAGGGAGCAAGG + Intergenic
1041444520 8:57935625-57935647 TTGAAGAAATAAAGGCAGCAAGG - Intergenic
1041807258 8:61865544-61865566 CTGAAGACCAGAAGGGAGAAGGG + Intergenic
1042254732 8:66791181-66791203 CTGATGTCAGAAAGGGACCAGGG + Intronic
1042721610 8:71832786-71832808 CTGAAGACCCACAGTAAGCAGGG + Intronic
1042863025 8:73332833-73332855 CTGAAAACCCAAAGGGGGCCAGG + Intergenic
1043198909 8:77338296-77338318 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1044476162 8:92628836-92628858 CTGAAGTCACAAGAGGAGAAAGG - Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1045255392 8:100516031-100516053 CTGAAGACACAAAATTAGCTGGG - Intronic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1045893307 8:107183372-107183394 CTGAAGACAAAAGGGAATCATGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047385830 8:124408294-124408316 GTGAAGAGCAAAAGGGAGCATGG - Intergenic
1047629494 8:126691729-126691751 CTGAAGAAAGGTAGGGAGCAAGG - Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1048663700 8:136636030-136636052 CTGAAGACCCAAAAGGGGTAAGG - Intergenic
1050150921 9:2618787-2618809 CTAAAGACACATAGACAGCAGGG + Intergenic
1050169415 9:2799806-2799828 CAGCAGACATAAAGGGAGAATGG + Intronic
1050302400 9:4273168-4273190 ATGAAGACAGAAATGCAGCAAGG + Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051516834 9:17939143-17939165 CTGGAGACTGAAAGGAAGCAAGG - Intergenic
1051730636 9:20139286-20139308 CTGAGGACTCACAGGGAGTAAGG - Intergenic
1052348672 9:27435932-27435954 AGGAAGTCACAGAGGGAGCAGGG - Intronic
1053228980 9:36389310-36389332 TTGAAAACACAAAGGGAGTATGG + Intronic
1055667619 9:78568408-78568430 ATGAGGAAACACAGGGAGCAAGG + Intergenic
1055922614 9:81477321-81477343 ATGGAGACACAATGGGAACAAGG + Intergenic
1056194460 9:84215758-84215780 CTGAAGAAACAAACAAAGCAGGG - Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056917298 9:90756899-90756921 ATGAGGTCACAAAGGGGGCAGGG - Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1058570225 9:106333870-106333892 ATGAAGAAACAAATGTAGCAAGG - Intergenic
1059545372 9:115170704-115170726 CTGTAGCCACCAGGGGAGCAGGG - Intronic
1059906483 9:118992167-118992189 CTGAAGAAGCTCAGGGAGCAGGG + Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1186210499 X:7245458-7245480 CTGTAGACACCATGTGAGCAGGG - Intronic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190394063 X:49962041-49962063 CTGAAGACTTAAAGGGCACATGG - Intronic
1190503648 X:51103758-51103780 CTGATGATGCAAGGGGAGCAGGG + Intergenic
1190827140 X:54028102-54028124 ATAAAGACCCAAAGGGAGTAAGG + Intronic
1191012537 X:55775477-55775499 CTGAAGAAGTAAAGAGAGCATGG + Intergenic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1193398320 X:81012346-81012368 CAGAAGACAAAAGGGAAGCAAGG - Intergenic
1196970355 X:121101133-121101155 AGTAAGACAGAAAGGGAGCAGGG + Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1198118652 X:133569332-133569354 CTGGAGACAAAAAGAGGGCAGGG - Intronic
1198376983 X:136050156-136050178 CTGAAGACAGAAAGGGAATGGGG - Intergenic
1199287538 X:146070535-146070557 CAGAAGACACGAAGGGAAGAAGG - Intergenic
1199464031 X:148116063-148116085 CTGAAGAAAGAAAGGAAGGAAGG + Intergenic
1199498994 X:148488413-148488435 CTGAAGTCACAAAGTGGGCCGGG - Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1201225435 Y:11813961-11813983 ATGCAGACACCACGGGAGCAGGG + Intergenic
1201583862 Y:15538992-15539014 CTGTAGACACCATGTGAGCAGGG - Intergenic
1201628208 Y:16038933-16038955 CGGAAGAAAAAGAGGGAGCAGGG + Intergenic
1202270962 Y:23073645-23073667 CAGAAGACAGAAAGGGAAGAAGG + Intergenic
1202295064 Y:23347037-23347059 CAGAAGACAGAAAGGGAAGAAGG - Intergenic
1202382852 Y:24292490-24292512 CGGAAGACAAAGAGGAAGCAAGG - Intergenic
1202423957 Y:24707389-24707411 CAGAAGACAGAAAGGGAAGAAGG + Intergenic
1202446832 Y:24962696-24962718 CAGAAGACAGAAAGGGAAGAAGG - Intergenic
1202487932 Y:25377635-25377657 CGGAAGACAAAGAGGAAGCAAGG + Intergenic