ID: 1181741338

View in Genome Browser
Species Human (GRCh38)
Location 22:24924120-24924142
Sequence CTGGAATTGTACCCTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181741334_1181741338 -4 Left 1181741334 22:24924101-24924123 CCAGAGAAGCCTCCAGGGGCTGG 0: 1
1: 0
2: 0
3: 43
4: 358
Right 1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1181741327_1181741338 24 Left 1181741327 22:24924073-24924095 CCTGAGTCAATCTGTGATGGAGA 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1181741332_1181741338 -2 Left 1181741332 22:24924099-24924121 CCCCAGAGAAGCCTCCAGGGGCT 0: 1
1: 0
2: 2
3: 27
4: 346
Right 1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1181741333_1181741338 -3 Left 1181741333 22:24924100-24924122 CCCAGAGAAGCCTCCAGGGGCTG 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1181741331_1181741338 -1 Left 1181741331 22:24924098-24924120 CCCCCAGAGAAGCCTCCAGGGGC 0: 1
1: 0
2: 2
3: 27
4: 280
Right 1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181741338 Original CRISPR CTGGAATTGTACCCTAAGAC TGG Intronic
905291153 1:36922590-36922612 CTGGGATTGGTCCCCAAGACAGG + Intronic
906061138 1:42949422-42949444 CTGGCATTCTACCCTCTGACCGG + Intronic
918589530 1:186224629-186224651 CAGGAATTGTACCCTGAACCTGG - Intergenic
919505171 1:198389215-198389237 CTGGAAACCTACCTTAAGACTGG + Intergenic
923974602 1:239247926-239247948 CTGTAATTATACCATAAGCCTGG - Intergenic
1065807432 10:29407837-29407859 CAGGAATTGTACCCTGAACCTGG + Intergenic
1070004302 10:72408209-72408231 CTTGAATTCTACCCTGAGAAAGG + Intronic
1073649957 10:105347808-105347830 TTGGAATCTTACCATAAGACAGG - Intergenic
1092030291 12:5278214-5278236 GTGGAATTGAAGCCTAAGATGGG + Intergenic
1093005540 12:14047132-14047154 CTGGATTTTTACCTTAAGTCAGG - Intergenic
1107724524 13:43285210-43285232 CTGGAATTGTAACCAAAGTGTGG - Intronic
1108357838 13:49643325-49643347 CAGGATTTGTACCCTAATATTGG + Intergenic
1117434900 14:55706613-55706635 TTAGAAATGAACCCTAAGACAGG + Intergenic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1119213353 14:72849496-72849518 CAGGAATTGTACACAAAGACAGG - Intronic
1124892073 15:33742706-33742728 CTGGAGTTGTGCCCAAACACAGG + Intronic
1137872754 16:51966631-51966653 CAGGAATTGAAGCCTGAGACAGG + Intergenic
1155850778 18:30770813-30770835 CAGGAATTGAACCCTAAACCTGG - Intergenic
1163453191 19:17391040-17391062 CTGGAATTGGAACCTAAGGATGG - Intergenic
1163550252 19:17962511-17962533 CAGGACTTGTACTCTAAGGCAGG - Intronic
1164693686 19:30228133-30228155 CTGGATTTTTACTTTAAGACCGG + Intergenic
1168343501 19:55639568-55639590 CTGGAATTGTTCCATAAGGTAGG + Intronic
927683614 2:25155965-25155987 CTGAAATTGTACCCTAAAAAGGG - Exonic
933719905 2:85391213-85391235 CTGGAATTCAACCCGGAGACTGG - Exonic
934781419 2:96971968-96971990 CTGGACTTGGACCCGAAGAGGGG - Exonic
935867176 2:107402437-107402459 CTGGAACTGCACCTTAACACTGG + Intergenic
940097563 2:149994680-149994702 ATGCAATTGTAGCCTATGACTGG + Intergenic
940251264 2:151679258-151679280 CTGTAATAGAACCCAAAGACTGG + Intronic
941616928 2:167731131-167731153 CTGAAATTTTACCTTAAGGCTGG - Intergenic
944942265 2:204641726-204641748 CTGGAATAGTTCCCAAAGAATGG - Intronic
1176204271 20:63879571-63879593 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204287 20:63879651-63879673 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204296 20:63879691-63879713 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204312 20:63879771-63879793 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204320 20:63879811-63879833 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204329 20:63879851-63879873 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204338 20:63879891-63879913 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204363 20:63880011-63880033 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204387 20:63880131-63880153 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204404 20:63880211-63880233 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204413 20:63880251-63880273 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204430 20:63880331-63880353 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1176204447 20:63880411-63880433 CTGCATTTGTGCCCTAAGAGTGG - Intronic
1181682167 22:24502935-24502957 CTGTGATTGTACTCTAAGCCTGG - Intronic
1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG + Intronic
1183924384 22:41195796-41195818 CAAGAATTGTGCCCTAAGCCAGG + Intergenic
950392355 3:12706614-12706636 CTGGAACTGCACCCAAAGAGTGG + Intergenic
953628992 3:44595775-44595797 CTGGGATTGCACCCTGACACTGG + Exonic
960226106 3:115170797-115170819 ATTGAATTGTACACTAAGAATGG - Intergenic
961723437 3:128910590-128910612 CTGGAATTAGAACCCAAGACGGG + Intronic
962144854 3:132830039-132830061 TTGGAATTTTACCCTAAGGATGG + Intergenic
966044833 3:175535202-175535224 CTGCTTTTGTAACCTAAGACAGG - Intronic
966830510 3:184004062-184004084 CTGGAATAGGACCCCAACACTGG + Intronic
967252194 3:187551809-187551831 CAGGAATTTTACCCAAAGATGGG + Intergenic
970634419 4:17991743-17991765 CTGGTCTTGTGCCCTAAGAAAGG - Intronic
981764009 4:148227337-148227359 CTGGAATTGTGCACTGAGAAGGG - Intronic
993939508 5:94041403-94041425 CAGGAATTGGACCCTAAACCTGG - Intronic
998596306 5:143534099-143534121 CTGGTATTCTGCCCTCAGACAGG + Intergenic
999426744 5:151494152-151494174 CTGAATTTGGACCCTAAGCCTGG + Intergenic
999925506 5:156371563-156371585 CTGGAATTGTTCCATCAGAGAGG + Intronic
1000043067 5:157499614-157499636 CTCTAATTGTACCCTGAGGCCGG - Exonic
1000150440 5:158495494-158495516 CTGGATTTGTTCCCTCAGGCTGG + Intergenic
1000168267 5:158676714-158676736 CTGGAGTTGCACCCAAAGAGTGG - Intergenic
1000275801 5:159733689-159733711 CTGGAATTGTACCATAGAGCGGG - Intergenic
1000642811 5:163723522-163723544 CTGGGATGGTCCCCTAGGACTGG - Intergenic
1004382125 6:15141502-15141524 CAGCCATTGTACCATAAGACAGG + Intergenic
1009337236 6:62506684-62506706 CTGCAGTTGTACCCTAACAGAGG + Intergenic
1010711370 6:79178976-79178998 ATGGAATTGTACACTTAAACAGG - Intergenic
1011275825 6:85630496-85630518 CTGGAATTGGAGCCCAAGGCTGG - Intronic
1017947060 6:159104390-159104412 CTGGAATTGTGCCCTGGGAGTGG + Intergenic
1018848561 6:167571959-167571981 GTGACATTGTACCCTAAGATCGG - Intergenic
1028848194 7:95506519-95506541 CTAGAATTCTACTCTAAGTCGGG - Intronic
1029134102 7:98356330-98356352 TTGGAATTTTACTCTAAGATTGG + Intronic
1036567755 8:9952048-9952070 CTGGAATGGGACCCCAAGAAAGG - Intergenic
1037075858 8:14717300-14717322 CTGGTATTGTACCTTAACACAGG - Intronic
1038632043 8:29255196-29255218 CTGGAATTGTATACTAATAATGG + Intronic
1038808368 8:30814642-30814664 CTGTAATTGTTCCCTAGGAGGGG - Intergenic
1043645795 8:82517060-82517082 CAGGAATTTTACCCAAAGATGGG - Intergenic
1045428252 8:102088224-102088246 CAGGAATTGAACCCTGAAACTGG - Intronic
1059504704 9:114787911-114787933 CTGGAAATTTATCCCAAGACAGG - Exonic
1185791374 X:2929955-2929977 CTGGACTTGTACTCTAAGTCTGG + Intergenic
1193146526 X:78081976-78081998 CTGGAAATGTAACCGAACACAGG - Intronic
1193363840 X:80607200-80607222 CAGGAATTGAACCCTAAACCTGG - Intergenic
1201282453 Y:12353403-12353425 CTGGACTTGTACTCTAAGTTTGG - Intergenic