ID: 1181742471

View in Genome Browser
Species Human (GRCh38)
Location 22:24932489-24932511
Sequence CCCCAAAGTTGAGGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181742471_1181742480 16 Left 1181742471 22:24932489-24932511 CCAGCACCCCCTCAACTTTGGGG No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742471_1181742478 -9 Left 1181742471 22:24932489-24932511 CCAGCACCCCCTCAACTTTGGGG No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181742471 Original CRISPR CCCCAAAGTTGAGGGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr