ID: 1181742478

View in Genome Browser
Species Human (GRCh38)
Location 22:24932503-24932525
Sequence ACTTTGGGGAACTATAACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181742468_1181742478 1 Left 1181742468 22:24932479-24932501 CCTTCTGGTACCAGCACCCCCTC No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data
1181742466_1181742478 5 Left 1181742466 22:24932475-24932497 CCCTCCTTCTGGTACCAGCACCC No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data
1181742463_1181742478 21 Left 1181742463 22:24932459-24932481 CCTGCTCAGCATCCTTCCCTCCT No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data
1181742467_1181742478 4 Left 1181742467 22:24932476-24932498 CCTCCTTCTGGTACCAGCACCCC No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data
1181742465_1181742478 9 Left 1181742465 22:24932471-24932493 CCTTCCCTCCTTCTGGTACCAGC No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data
1181742471_1181742478 -9 Left 1181742471 22:24932489-24932511 CCAGCACCCCCTCAACTTTGGGG No data
Right 1181742478 22:24932503-24932525 ACTTTGGGGAACTATAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181742478 Original CRISPR ACTTTGGGGAACTATAACGG TGG Intergenic
No off target data available for this crispr