ID: 1181742480

View in Genome Browser
Species Human (GRCh38)
Location 22:24932528-24932550
Sequence TTCTAGTGAGACTCCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181742471_1181742480 16 Left 1181742471 22:24932489-24932511 CCAGCACCCCCTCAACTTTGGGG No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742473_1181742480 10 Left 1181742473 22:24932495-24932517 CCCCCTCAACTTTGGGGAACTAT No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742466_1181742480 30 Left 1181742466 22:24932475-24932497 CCCTCCTTCTGGTACCAGCACCC No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742476_1181742480 7 Left 1181742476 22:24932498-24932520 CCTCAACTTTGGGGAACTATAAC No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742474_1181742480 9 Left 1181742474 22:24932496-24932518 CCCCTCAACTTTGGGGAACTATA No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742468_1181742480 26 Left 1181742468 22:24932479-24932501 CCTTCTGGTACCAGCACCCCCTC No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742475_1181742480 8 Left 1181742475 22:24932497-24932519 CCCTCAACTTTGGGGAACTATAA No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data
1181742467_1181742480 29 Left 1181742467 22:24932476-24932498 CCTCCTTCTGGTACCAGCACCCC No data
Right 1181742480 22:24932528-24932550 TTCTAGTGAGACTCCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181742480 Original CRISPR TTCTAGTGAGACTCCTGACA TGG Intergenic
No off target data available for this crispr