ID: 1181744389

View in Genome Browser
Species Human (GRCh38)
Location 22:24945717-24945739
Sequence CTGGGGACAAGCACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 450}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181744383_1181744389 0 Left 1181744383 22:24945694-24945716 CCATGAAAAAGCCTGGGGTGACA 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG 0: 1
1: 1
2: 6
3: 44
4: 450
1181744381_1181744389 5 Left 1181744381 22:24945689-24945711 CCACACCATGAAAAAGCCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 185
Right 1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG 0: 1
1: 1
2: 6
3: 44
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181744389 Original CRISPR CTGGGGACAAGCACAGAGGA AGG Intronic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
901027795 1:6288184-6288206 CAGGGGACCAGCACAGGGGAAGG - Intronic
901377255 1:8848244-8848266 CTGTGGCCAAGCAGAGAGGCAGG + Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901612448 1:10509560-10509582 CAGAAGACAAGCAGAGAGGAAGG - Intronic
902618438 1:17636666-17636688 CTGGTAACAAGCAAAGAGCATGG - Intronic
902729685 1:18361311-18361333 CTGGGGGCTAGGGCAGAGGAAGG + Intronic
903682783 1:25108280-25108302 CTGGGGACAGGGACAGTGGCTGG + Intergenic
903753678 1:25646188-25646210 GCGGGGACCAGCACGGAGGAAGG - Intronic
906187470 1:43872138-43872160 ATGGGGACTAACAAAGAGGATGG + Intronic
906644398 1:47463458-47463480 GTGGGCAAAAGCACAGAGGTAGG + Intergenic
907127121 1:52060727-52060749 CTGGGGATGAGCACAAGGGAAGG + Intronic
907489837 1:54801693-54801715 CTGAGGACCTGCAGAGAGGATGG - Intergenic
907649071 1:56276148-56276170 CTGGAGACGAACAGAGAGGAGGG - Intergenic
907731421 1:57070325-57070347 TTGGGAATAAGCACAGGGGAGGG + Intronic
908326494 1:63028725-63028747 CTGGTGGGAGGCACAGAGGAGGG - Intergenic
908748433 1:67397414-67397436 CTGAGGACAACCTCAGAGGTTGG - Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
910901302 1:92124032-92124054 TTGGGGACCATCAAAGAGGAGGG - Intronic
911580775 1:99630985-99631007 CTGGAGAGAAGCTCAGAGAAGGG - Intergenic
912309285 1:108603338-108603360 CTGGGGACAACCAAAGAGGAGGG + Intronic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
914756307 1:150563339-150563361 CTGGGGACAAGGGGAGAGCAAGG - Intergenic
915218220 1:154353870-154353892 GTGGGAAGAAGAACAGAGGAAGG - Intergenic
916028476 1:160855843-160855865 AAGGAGACAAGTACAGAGGATGG + Intronic
918407191 1:184222919-184222941 CTGGGGACATGGAAAGAGAAAGG - Intergenic
919610515 1:199740539-199740561 CTGGAGACAAGCTGAGGGGAAGG + Intergenic
919644567 1:200081351-200081373 CTGGGAAATACCACAGAGGAAGG - Intronic
919747078 1:201015550-201015572 CTGGGCACAAGCAGAGATCATGG - Intronic
920580623 1:207104127-207104149 ATGAGGACTAGCAAAGAGGAAGG + Intergenic
920839573 1:209542881-209542903 CTCTGGACAAGCAGAGAGGCAGG + Intergenic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
920957262 1:210630879-210630901 CGGGGGGCCAGCTCAGAGGAAGG + Intronic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922470031 1:225870877-225870899 CTGGGGTCAGGGGCAGAGGAAGG - Intronic
923372378 1:233327429-233327451 CTGGGGACTGGCACAGAAAAGGG + Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
1063407665 10:5812930-5812952 CTGGGGGCAAGCGCAGAGGCCGG + Intronic
1065815641 10:29480248-29480270 CTGGGGACAGGGGCAGGGGAGGG + Intronic
1065957290 10:30704956-30704978 CTGGGGACAGGGGCAGGGGAGGG - Intergenic
1066443867 10:35464179-35464201 CTGGGCTAAGGCACAGAGGAGGG - Intronic
1069793293 10:71036958-71036980 CTGGAGTAAAGCAGAGAGGATGG + Intergenic
1070163006 10:73876940-73876962 GTCAGAACAAGCACAGAGGAGGG + Intergenic
1070509434 10:77147012-77147034 AGGGGGCCAGGCACAGAGGAGGG + Intronic
1070665286 10:78338295-78338317 CTAGGGCCAAGCACAGGGCAGGG - Intergenic
1070727647 10:78803173-78803195 CTTGGGAGGAGAACAGAGGAGGG + Intergenic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1070938441 10:80320770-80320792 CTGGGGAAATGCACATAGAAGGG - Intergenic
1071822873 10:89296014-89296036 TTGGGGAGAAGCATAGAGAAAGG - Intronic
1072237883 10:93468854-93468876 CCTGGGACAAGGACAGAGGGTGG + Intronic
1072446407 10:95502556-95502578 CTGGGGCATAGAACAGAGGATGG - Intronic
1072709666 10:97707722-97707744 CTGGGAACAGGCCAAGAGGAGGG + Intergenic
1073133764 10:101207831-101207853 CTGAGGACAGGGACAGAGGGAGG - Intergenic
1073136182 10:101221907-101221929 CTGGGGACCAGCACCCTGGAGGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073322851 10:102626135-102626157 CTGGGGACAAGGACAGGGAGGGG + Intronic
1074787249 10:116851815-116851837 AATGGGACAAGCAAAGAGGAGGG - Intronic
1074882224 10:117668003-117668025 CTGGGGTCCAGCAGAAAGGAAGG + Intergenic
1075222999 10:120600806-120600828 GTGGGCACCAGCACAGAGCAGGG - Intergenic
1075638068 10:124043902-124043924 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638071 10:124043920-124043942 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638074 10:124043938-124043960 CAGGGGAACAGCACAGAGCAGGG + Intronic
1076312130 10:129516043-129516065 CTGGGAACCAGCACAGAGTGAGG - Intronic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1076912811 10:133400365-133400387 CTGAGAACAGGCACAGAGGGAGG - Intronic
1077158215 11:1100903-1100925 CAGCAGATAAGCACAGAGGAAGG - Intergenic
1077229194 11:1451032-1451054 CTGGGGCCAGGCACACAGCAAGG + Intronic
1077930285 11:6724171-6724193 CTGAGGACAAGCAAAGACAAAGG + Intergenic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1078894811 11:15588671-15588693 CAGGGGACAAGTGAAGAGGAGGG + Intergenic
1079041873 11:17066920-17066942 CTGGGTACATGCACAGCGGTTGG - Intergenic
1079312245 11:19377397-19377419 CTGGGAACAGGAACAGAGCAGGG - Intronic
1079328233 11:19512448-19512470 CTGGGGAGAACCAGAGAGGGAGG + Intronic
1080771489 11:35346285-35346307 CTGGGGTCAAGCATAGAGCAGGG + Intronic
1080891973 11:36416964-36416986 CTGGAGAGCAGCACGGAGGAGGG - Intronic
1081750805 11:45509692-45509714 CTAGGGCTAAGCACAGAGTACGG + Intergenic
1082780903 11:57286876-57286898 CTGGGCAGAAGGGCAGAGGAGGG - Intergenic
1083221306 11:61254564-61254586 CTGGGGACAAGCAGAAAGGCAGG + Intergenic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1084451651 11:69242622-69242644 CTGGGGAGAGGAACAGAGGGAGG + Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1085079135 11:73619523-73619545 CTGGGGACATAATCAGAGGATGG - Intergenic
1085158778 11:74321867-74321889 CTGGGGCCAAGCACAGCAGCTGG - Intergenic
1085510955 11:77087977-77087999 CTGGGGAGATGCACGGAGAATGG + Intronic
1087934924 11:104021869-104021891 TTGGGTACAGGCATAGAGGAAGG + Intronic
1088789244 11:113209940-113209962 CTGGGCACAGGCACAGAGGCAGG + Intronic
1089610517 11:119666104-119666126 CAGGGCACAAGCACAGGGCAAGG + Intronic
1090032530 11:123219518-123219540 CGGGCCTCAAGCACAGAGGATGG - Intergenic
1090356108 11:126141348-126141370 GTGGGCACGAGCACAGGGGAGGG + Intergenic
1090776218 11:129968423-129968445 CTGAGGACAAAAACGGAGGAGGG + Intronic
1091601071 12:1918124-1918146 CTGGGGAAAAGCCCAGAGGGAGG + Intronic
1091831525 12:3553965-3553987 CTGGGGACAAGCAAAGGGTCTGG - Intronic
1092154949 12:6276085-6276107 CAGGTGAAAAGCTCAGAGGAGGG + Intergenic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1093297653 12:17410791-17410813 CTCAGGACCACCACAGAGGAAGG - Intergenic
1093342074 12:17989637-17989659 CTGGGGACTAGAACAGAGTAAGG - Intergenic
1093457886 12:19382447-19382469 TTGGGGAGGAGCACAGAGGCTGG + Intergenic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1095514961 12:42995338-42995360 ATGGAGACAAATACAGAGGAAGG + Intergenic
1095824528 12:46517158-46517180 CTGGGGAACAGCACAGAGCCAGG - Intergenic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096177844 12:49534862-49534884 CTGGGGACCTCCAGAGAGGAAGG + Intergenic
1096483697 12:51961124-51961146 GAGGGGAAAAGCAGAGAGGATGG - Intronic
1101814795 12:108137672-108137694 CTTGGGGCCAGCACAGAGGCTGG - Intronic
1102028861 12:109728571-109728593 CTGAGCAAAGGCACAGAGGAAGG - Intronic
1103124553 12:118410153-118410175 CTGGGGACAAACAGTGAGAAAGG - Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1103929344 12:124440966-124440988 CTGGGGAGGGGCAGAGAGGACGG + Intronic
1104441224 12:128794866-128794888 CTGGTGGCAAGAACACAGGAAGG - Intronic
1104715847 12:131015694-131015716 CTGGTCACATGCAGAGAGGAAGG - Intronic
1104860514 12:131921077-131921099 CTGGGGGCGAGGACAGAGGCTGG - Intronic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1105595166 13:21830632-21830654 CTGGGGACTACTAGAGAGGAGGG - Intergenic
1106117787 13:26831940-26831962 CTGGGGAGAAGCACATAGCTAGG - Intergenic
1106330573 13:28735619-28735641 CTGGAGACATGCGCAGAGGGAGG + Intergenic
1107300290 13:38958905-38958927 CTGGGAAAGAGCACAGAGGTGGG + Intergenic
1111466662 13:88622353-88622375 CTCGGGAGAAGGACAGAGAAGGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1112314547 13:98349941-98349963 CTGCGGCTAAGCACAGATGAAGG - Intronic
1112837791 13:103536976-103536998 CAGATGACAAGCACAGAGTATGG - Intergenic
1113301996 13:109032396-109032418 CTGGGAAGAAGCACAAAGGATGG - Intronic
1113379846 13:109794091-109794113 CAGGAGAGACGCACAGAGGAGGG - Intergenic
1113986084 13:114316923-114316945 CTGGGGACAAGAAGATAGGTGGG + Intronic
1114184029 14:20386624-20386646 CTGGGGATAAGCAGAGAGCTGGG + Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114536904 14:23428735-23428757 CTGGGCTCAGGCACAGTGGACGG - Intronic
1114577792 14:23729383-23729405 CCTGGGACAAACACAGAGGAAGG - Intergenic
1114617734 14:24077131-24077153 CTGAGGGCAAGCAGAGAGGGTGG - Intronic
1115884838 14:37959466-37959488 CTGGGGGCAAGCAGAGATCATGG + Intronic
1116386904 14:44342094-44342116 TTGAGGACTAGCACAGAGGCAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118320239 14:64748610-64748632 GGGGGGAGAAGCAGAGAGGAGGG + Exonic
1118384233 14:65242069-65242091 CTGGGGATATGCAGAGAGCAAGG - Intergenic
1118801899 14:69197586-69197608 CTGGGGACTACCAGAGGGGAGGG - Intronic
1118808254 14:69256201-69256223 CAGGGGAGAGGCACAGAGCAGGG - Intergenic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119175425 14:72564816-72564838 CTGGGGACATCCAGAGGGGAGGG + Intronic
1119694040 14:76698473-76698495 CTGTGGAGGAACACAGAGGAGGG + Intergenic
1120692175 14:87605133-87605155 TGGGGAACAAGCACAGAGGTGGG - Intergenic
1121095933 14:91218044-91218066 ATTGGGAAAAGCACAGAGAATGG - Intronic
1121636460 14:95457121-95457143 CTAGGGACAGTCACAGAGGGTGG - Intronic
1122200344 14:100118772-100118794 CTGGGGAGAAACACACAAGAGGG - Intronic
1122544417 14:102514339-102514361 TTGGGCACAGACACAGAGGAGGG + Intergenic
1123067817 14:105627159-105627181 CTGGGGCCGAGCAGAGGGGATGG - Intergenic
1123941701 15:25219721-25219743 TTGGGAACAAGCAAAGGGGAGGG + Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124713147 15:32031167-32031189 CTGGGGACAGACTCAGAGCATGG - Intronic
1125502818 15:40250059-40250081 CTGGGAACAAGGCCAGAGGGTGG + Intronic
1125768270 15:42149324-42149346 CTGCACACATGCACAGAGGAAGG + Intronic
1127027387 15:54821964-54821986 ATGGGGCAAAGCCCAGAGGAAGG + Intergenic
1128784018 15:70381534-70381556 CTGGGGACCATCTCAGAGGCCGG - Intergenic
1129137458 15:73567492-73567514 TTGGGGAGAAGCACATGGGAAGG + Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129515381 15:76154000-76154022 CTGGGGAAAAGCGCATGGGAAGG - Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1132670927 16:1102057-1102079 CTGGGGACAACCACGGTGGGTGG + Intergenic
1134625762 16:15721356-15721378 CTGGTGAATAGCACAGAGGGTGG + Intronic
1135213198 16:20541515-20541537 CTGACCAGAAGCACAGAGGAGGG - Intronic
1135425554 16:22332489-22332511 CTAGTGACAAGCAGAGAAGAGGG - Intronic
1136922539 16:34344582-34344604 CTGGACAAAAGCACAGAGGTGGG - Intergenic
1136982034 16:35067224-35067246 CTGGACAAAAGCACAGAGGTGGG + Intergenic
1137063935 16:35816907-35816929 CTGGGGATGTGCTCAGAGGATGG + Intergenic
1137252503 16:46750240-46750262 CTGGGGAGAGGCACAGGGGCTGG - Intronic
1137253371 16:46756480-46756502 CTGGGGACCAGGACAGGAGACGG + Intronic
1137268238 16:46885560-46885582 CTGGGGACAGTCACCGAGGTGGG + Intronic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1139383720 16:66550447-66550469 CTGAGGACAAGCTCGGAGAATGG - Intronic
1140057801 16:71540745-71540767 CTGGTGACAAGCATAGAGGATGG + Intronic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1140894947 16:79316746-79316768 CTGGAGATAGGGACAGAGGAAGG + Intergenic
1141395600 16:83701793-83701815 CTGGGCAGAGGCACAGAGAAGGG - Intronic
1141488169 16:84354903-84354925 CTGGGGATCAGGACAGATGAGGG - Intergenic
1142121556 16:88388960-88388982 CTGGTGTAAGGCACAGAGGATGG - Intergenic
1142153067 16:88521188-88521210 GTGGGAAACAGCACAGAGGAGGG - Intronic
1142181418 16:88672734-88672756 CAGAGAACAAGCACAGGGGAGGG + Intergenic
1142291202 16:89194352-89194374 GTGCAGACAGGCACAGAGGAGGG - Intronic
1142717660 17:1755759-1755781 CTGGGCTCTGGCACAGAGGAAGG - Intergenic
1142906247 17:3044197-3044219 GTGGGGACCAGCAGACAGGAAGG - Intergenic
1144634637 17:16897377-16897399 CGGGTGACAAGCACAGAGGATGG - Intergenic
1144832153 17:18137814-18137836 CTGGGGACCAGCCCATGGGAAGG + Intronic
1145168719 17:20636808-20636830 CGGGTGACAAGCACAGAGGATGG - Intergenic
1145200656 17:20941890-20941912 TGGGCGACAAGCACAGAGGATGG - Intergenic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1146164633 17:30578213-30578235 TGGGTGACAAGCACAGAGGATGG - Intergenic
1147160803 17:38568474-38568496 GTGGGAAAAGGCACAGAGGATGG + Intronic
1147185016 17:38708462-38708484 CTGGGCAGAGGCACAGAGGTGGG + Intronic
1147977578 17:44256589-44256611 TTGAGGACAAGCACAGGGGAGGG + Intronic
1148354787 17:46968558-46968580 CTCTCGACAAACACAGAGGATGG + Intronic
1149253037 17:54792162-54792184 CTGGGGCAAAGCACAAAGGCAGG + Intergenic
1150651701 17:67014590-67014612 TTGGGAACAAGCCCAGAGGAGGG + Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151313661 17:73309542-73309564 ATGGGGACAAGCACGGTGGGTGG + Intronic
1151537526 17:74747423-74747445 CTGAGGACAGACACTGAGGAAGG - Intergenic
1151539596 17:74758294-74758316 CTGGGGGAAAGGACAGATGAAGG + Intronic
1151571048 17:74925468-74925490 CTGAGGACAGGCCCTGAGGATGG - Intronic
1151585304 17:75004939-75004961 ATGGGGGCAAGCACAGAGACGGG - Exonic
1151660609 17:75516294-75516316 CTGGAGAGAAGCCCCGAGGAGGG + Intronic
1151899565 17:77002750-77002772 GTCGGGAGATGCACAGAGGAGGG + Intergenic
1152010106 17:77707728-77707750 AAGTGGGCAAGCACAGAGGAGGG + Intergenic
1152260195 17:79262654-79262676 CTGTGGACAAGCCCACAGGCAGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152729607 17:81962954-81962976 CTGGGGACATTCTCAGAGGGAGG + Intergenic
1152802974 17:82340255-82340277 CTGGGGAAGAACACAGGGGAGGG - Intergenic
1152904589 17:82963282-82963304 CTGGGGACGAGCCCTGGGGAAGG - Intronic
1153585047 18:6612349-6612371 TTGGAGAGAAGCAAAGAGGACGG - Intergenic
1153631520 18:7075283-7075305 CTGTGAACAAGAAAAGAGGAGGG + Intronic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153826018 18:8875588-8875610 CTTGGCACAAGCACAGAGACTGG + Intergenic
1155106124 18:22667948-22667970 CTGGGGAGAAGCACAAAGAGGGG + Intergenic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156537111 18:37874828-37874850 CTCGGGACATGCATAGATGATGG + Intergenic
1157306515 18:46521353-46521375 CTGGGAAGAAGCACTGAGGGAGG - Intronic
1157415981 18:47503452-47503474 CTGTGGCCAAGCACAGAGTGAGG + Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157848202 18:51023774-51023796 CTAGGGACAAGAAAAGAGGTCGG + Intronic
1158698799 18:59728016-59728038 CTTTGTACAACCACAGAGGAAGG - Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160238317 18:77103594-77103616 CTGGGAACAATCACACAGCATGG + Intronic
1161115244 19:2493091-2493113 CTGGAGACAGACACAGAGGTGGG + Intergenic
1161346156 19:3769792-3769814 CTGGGGACATGCACAGGGCCTGG + Exonic
1161469607 19:4449666-4449688 CTGGGTACATGCACAGACAAGGG + Intronic
1161474634 19:4477463-4477485 CTGGGGACAGGCACAGCGTGAGG - Intronic
1161719281 19:5894291-5894313 TTGGGGACAGGCCCAGAGAAAGG + Intronic
1161735586 19:5990476-5990498 CTGGGGAGTAGCAAAGAGGAAGG + Intergenic
1161950139 19:7463337-7463359 CTGTGGCCAGGCACAGAGGTGGG - Intronic
1161976071 19:7608226-7608248 CTGGGGACAATAGCAGTGGATGG - Exonic
1162028201 19:7905942-7905964 ATGGGGACACACACAGAGCATGG - Intronic
1162067211 19:8133107-8133129 CTGGGGACAACAGCAGAGGCTGG + Intronic
1163347375 19:16752071-16752093 CAGAGGACAAACTCAGAGGAGGG - Intronic
1163784804 19:19269551-19269573 CTGTGGACACGCAAAGAGGGAGG + Intronic
1164062568 19:21688499-21688521 CTGGGGACATGCTCAGTGGATGG - Intergenic
1164418347 19:28065212-28065234 AAGGGGAGAAGCACAGAGGCAGG - Intergenic
1164709506 19:30345269-30345291 CTGGGGACAGGAACAGAGAAAGG - Intronic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1164872808 19:31660447-31660469 CTGGATCCTAGCACAGAGGAAGG + Intergenic
1164930152 19:32169063-32169085 CTGGGAAACAGCACAAAGGATGG + Intergenic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165094475 19:33402789-33402811 CTGGGGGCCAGCAGAGAGGCAGG + Intronic
1165293797 19:34909731-34909753 TGGGGGAGAAGCACAGAGGGAGG - Intergenic
1165421026 19:35721969-35721991 CAGGGAACTAGCACAGAGAAGGG - Intronic
1165757723 19:38304126-38304148 CTGAGGACCAGGACAGAGGTTGG + Intronic
1165825383 19:38702793-38702815 CCGGGGACACACCCAGAGGAAGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166663970 19:44665997-44666019 CTGGGGAGAGGCCCAGATGAAGG + Intronic
1166782817 19:45351263-45351285 CTGGAGACAGGCACAGGGGATGG - Exonic
1166969720 19:46558026-46558048 CTGGGGGCAAGAACAGATTATGG - Intronic
1167009903 19:46800454-46800476 CTGGGGCCAGGCACACAGAAGGG + Intergenic
1167427918 19:49439022-49439044 CAGGGGACAAGGACAGAGAAGGG + Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167949422 19:53014534-53014556 CTGGGGAGAAGCTCATGGGATGG - Exonic
1167953990 19:53049695-53049717 CTGGGGAGAAGCTCATGGGATGG - Exonic
924969996 2:116986-117008 CTGGGAACAAGGGCAGAGCAGGG + Intergenic
925177464 2:1795471-1795493 CTGGGGAGGGGCACAGAGGCCGG + Intronic
925348365 2:3185553-3185575 CAGTGGAGAAGCACAGAGGGGGG - Intergenic
925771729 2:7288908-7288930 CTAGAGACACGCACACAGGAAGG - Intergenic
926094991 2:10075399-10075421 CAGGGGACAAGAAGAAAGGATGG - Intronic
926120724 2:10239988-10240010 CTGGGGTCTTGCACATAGGAGGG - Intergenic
926235522 2:11040291-11040313 GTGGGGACAAGCATAGGGCATGG + Intergenic
926472863 2:13282841-13282863 CTGGGGAGAAACAAATAGGAAGG + Intergenic
927307531 2:21590638-21590660 CTGGGGAGCAGAAGAGAGGAAGG - Intergenic
927511185 2:23644731-23644753 CTCAGGACCACCACAGAGGATGG - Intronic
927758424 2:25727653-25727675 CTGGGGACAAAAAAAGAGAAGGG + Intergenic
927881400 2:26692571-26692593 CTGGGGAGACGCGCCGAGGAGGG - Intergenic
928082733 2:28325341-28325363 CTGGGGGCAAGCACAGGAGGAGG - Intronic
928824658 2:35405527-35405549 CTGTGTGCAAGCACTGAGGAAGG - Intergenic
929537546 2:42792897-42792919 CTGGGGACAAGCGTCCAGGAAGG - Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
932068549 2:68592434-68592456 CAGGGGAAAAGCATAGAGAATGG + Intronic
932654866 2:73601658-73601680 CTGGGGACAAGGCCGCAGGAGGG + Intronic
932663013 2:73673272-73673294 CTGGAGACAAGGGCACAGGAGGG + Intergenic
932931853 2:76050631-76050653 CTGAGGACAGGCAGAGAGAAAGG - Intergenic
933846889 2:86334022-86334044 CTGGGGACAAGCAGAGTGGCTGG - Intronic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936480341 2:112879789-112879811 CTGGGGACAGGGTCACAGGATGG - Intergenic
937670031 2:124528746-124528768 TTGGTGAGAACCACAGAGGAAGG + Intronic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
938200567 2:129369273-129369295 ATGGGGCCAAGCACAGACGCGGG + Intergenic
938926125 2:136044112-136044134 CTGGGGACTACCACAGAGTAGGG + Intergenic
940597662 2:155815698-155815720 CTTGGGACATGCAAATAGGATGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
942985768 2:182139779-182139801 CTGGGCAGAAGCACAGCAGAAGG - Intergenic
943259751 2:185643926-185643948 CTGGAGACAAGAGTAGAGGATGG + Intergenic
943496140 2:188623080-188623102 CTGGGAACAAATACAGAGGCAGG - Intergenic
943701906 2:190996075-190996097 CCGGGGACAGGAAGAGAGGAAGG + Intronic
943718239 2:191175789-191175811 TTGTGGACAAACACAGATGAGGG + Intergenic
944112177 2:196144544-196144566 CTGGGGAACAGCACAAAAGAAGG + Intronic
946220017 2:218217728-218217750 GTGGGGAGAGGCTCAGAGGAGGG + Intronic
946540035 2:220674266-220674288 GTGAGGAAAAGCACAGAGGCAGG - Intergenic
946741397 2:222805915-222805937 TTGTGGACATGCACAGAGCAGGG - Intergenic
947626527 2:231622632-231622654 CTGAGGACAAGCAGAGAGAGTGG - Intergenic
947713323 2:232328072-232328094 GTGGGCACAAGCACAGATTAGGG + Intronic
948121071 2:235530873-235530895 CTCAGGAGAAACACAGAGGAAGG - Intronic
948240519 2:236429425-236429447 CTGGGAACAAGCACAGTGTGGGG + Intronic
948303248 2:236925019-236925041 CTAGGGACAGGCACAGTGGTGGG - Intergenic
948883933 2:240873739-240873761 CTGGGGACCAGCACAGCAGAGGG + Intronic
1169064724 20:2688495-2688517 CCTGGGACAAGCACAGAAAAAGG - Intergenic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1170370928 20:15647314-15647336 CTGGGCAAAAGCACAGGGGCAGG + Intronic
1171276078 20:23857574-23857596 CTGGGGAGAAGCACAGGAGAAGG + Intergenic
1173843985 20:46176707-46176729 CTGGGGACAGGCCCGGAGGGAGG + Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174188163 20:48721731-48721753 CAGAGGACAAGAACAGAGGCAGG + Intronic
1174607450 20:51771181-51771203 CTGGGGACATGGATATAGGATGG - Intergenic
1175143397 20:56877693-56877715 CTGGTGACAACCACAGATGCTGG - Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175517604 20:59578854-59578876 CTGAGCTCAGGCACAGAGGATGG + Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1178582552 21:33848742-33848764 CTGGGGGCAGGTGCAGAGGAGGG - Intronic
1178944708 21:36937166-36937188 CTGGGGACAGTGACAGGGGAGGG - Exonic
1179674001 21:42969518-42969540 CTGGGGATGAGCACGGTGGATGG + Intergenic
1179801172 21:43812118-43812140 CTGGGAAAGAGAACAGAGGAAGG - Intergenic
1180071644 21:45439765-45439787 CTGGCGCCAAGCACAGAGCCTGG + Intronic
1180903763 22:19394024-19394046 GTGGGGACAAGCACAGTGCTTGG + Intronic
1181046664 22:20217862-20217884 GGGGGGACAAGCAGAGAGGTCGG - Intergenic
1181273756 22:21675898-21675920 CTGGCCACAAGAACAGCGGAAGG - Intronic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181884650 22:26010663-26010685 CTGGGATGAAGGACAGAGGATGG - Intronic
1182526418 22:30923149-30923171 GAGGGGACAAGAAAAGAGGAGGG + Intergenic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183193200 22:36335114-36335136 CCAGAGACTAGCACAGAGGAGGG - Intronic
1183913032 22:41092764-41092786 CTGGGCCCAAGCCCGGAGGAGGG - Exonic
1185367618 22:50444095-50444117 CTGGGGACAGTGACAAAGGACGG + Exonic
949931394 3:9081212-9081234 CAGGGGACCAGCACTGGGGAGGG - Intronic
950087500 3:10270641-10270663 CTGGAGCCAAGCCTAGAGGAGGG + Exonic
953083738 3:39646542-39646564 TTAGGGGCAAGCACACAGGAAGG + Intergenic
953104916 3:39868138-39868160 CTGAGGTCCATCACAGAGGATGG + Intronic
953863274 3:46563425-46563447 GGGTGGATAAGCACAGAGGAGGG - Intronic
954373882 3:50184273-50184295 CTAGGAACAACCAGAGAGGAAGG + Intronic
954420507 3:50416578-50416600 CTGGGGCCCAGGACAGAGCAGGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954438642 3:50509544-50509566 CTGGGAGCAGGTACAGAGGACGG - Intergenic
955267818 3:57464199-57464221 CTGTGGACAAGCAGAGACAAAGG + Intronic
955554595 3:60122528-60122550 CTAGCCACAAGAACAGAGGAGGG + Intronic
956264434 3:67380999-67381021 GTGGGGACACGCAGAGAAGAGGG + Intronic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
960029420 3:113042371-113042393 CTGGGGACAAATAAAGATGAAGG - Intergenic
960333276 3:116388814-116388836 CTGGGCACAAGCACATTTGAAGG + Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
967054403 3:185816320-185816342 CTGTGGGCAAGCACAGAGATGGG + Intronic
967117718 3:186356827-186356849 CTGAGGAGAAGCACAGACTATGG + Intronic
967979898 3:195059459-195059481 CTGGGCACAAGCGCAGAGCCTGG + Intergenic
968457677 4:707234-707256 CTGGGAAGAATCACGGAGGAGGG + Intronic
969042929 4:4315051-4315073 CTGGGGATATTCACAGTGGAGGG + Intronic
969298206 4:6281720-6281742 CTGGGGACAGGCACAGCAGGAGG + Intronic
969477431 4:7429602-7429624 CCGGGTGCATGCACAGAGGAAGG - Intronic
969525824 4:7703580-7703602 CGGGAGACAGGCACAGAGGGAGG + Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969839199 4:9868235-9868257 ATGGGGCCATGCCCAGAGGAGGG + Intronic
970535506 4:17026390-17026412 CTGGGGAAAAGCTAAGAGGCAGG + Intergenic
972403123 4:38723522-38723544 CTGGGGAGAATCACCAAGGAGGG + Intergenic
974061176 4:57037569-57037591 CTGAGGACAAGCACTCAGGGAGG + Intronic
974611701 4:64226900-64226922 CTAGGGAGAAGGACAGAGAAAGG - Intergenic
974722732 4:65763273-65763295 CTGGGGCCTACCAGAGAGGAGGG - Intergenic
978350740 4:107818246-107818268 CTGGGCATAAGCACAGAGAATGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978941154 4:114437272-114437294 CTGATGACAAAAACAGAGGAAGG + Intergenic
979863073 4:125718596-125718618 ATGGAGAGATGCACAGAGGAAGG - Intergenic
981562989 4:146067287-146067309 CTGAGGATAAGCTCAGAAGAGGG - Intergenic
982158548 4:152544371-152544393 CTGGGGTCAAGCACTGAGTCTGG - Intergenic
982629063 4:157808596-157808618 TTGGGGAGAAAGACAGAGGAGGG + Intergenic
983839277 4:172436413-172436435 CTGGGGAGAACCACAGTGCAAGG - Intronic
984065100 4:175037922-175037944 CTCGGGAGAAGGACAGAGAAAGG + Intergenic
984874664 4:184356593-184356615 CTGGGGACATGCCCGTAGGATGG - Intergenic
985196591 4:187436904-187436926 CTGGTGCCCATCACAGAGGAAGG - Intergenic
985704594 5:1393047-1393069 CTGGGGAGGGACACAGAGGACGG - Exonic
990659366 5:57995889-57995911 CTGCTAAGAAGCACAGAGGAGGG + Intergenic
991173445 5:63656302-63656324 TAGGAGACAAGCAAAGAGGAGGG - Intergenic
991343550 5:65638685-65638707 CTGGGGACAATCATGGCGGAAGG + Intronic
994352531 5:98763397-98763419 GTAGGGACTAGCAGAGAGGATGG - Intergenic
994438463 5:99769224-99769246 CTTGGGAGAAGGACAGAGAAGGG + Intergenic
996018529 5:118567632-118567654 CTGGGGTCCAGAACAGAAGAAGG + Intergenic
996518652 5:124401552-124401574 CAGGGTGCAAGGACAGAGGAAGG + Intergenic
996750117 5:126879796-126879818 GTGGGGTCAAACACAGACGATGG + Intronic
997671511 5:135678872-135678894 CTGGGGACAAGGACATAGGGTGG + Intergenic
997874073 5:137532745-137532767 CTGGGGACAAGGTCAGTGGTAGG - Intronic
999087060 5:148902271-148902293 CTGGGGACAAGCAAGAAAGAGGG - Intergenic
1000161106 5:158598537-158598559 CTGGGGACACTCAGAGGGGAGGG - Intergenic
1000303252 5:159973661-159973683 CTGGAAAAAAGCACTGAGGAAGG + Intergenic
1000662440 5:163952262-163952284 ATGGGGAAAAGCACTGAGGGAGG + Intergenic
1001213404 5:169832419-169832441 GTGGGGAGAAGCAGAGATGATGG + Intronic
1002444683 5:179282567-179282589 TTGAGGAGAAGAACAGAGGAAGG - Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1003091146 6:3104633-3104655 CAGGGTACAAGCAGAGAGGCTGG + Intronic
1003760113 6:9170319-9170341 TTGGGGACTAACACAGAGAATGG - Intergenic
1003785946 6:9487177-9487199 TTGGGGACAATGACAGAGCAGGG - Intergenic
1005885895 6:30097487-30097509 CTGAGGACAAGCTAAGAAGAAGG + Intergenic
1006163209 6:32049834-32049856 CAGGGGTCAACCACATAGGAAGG + Intronic
1006516243 6:34547166-34547188 CTGAGGCCAAGCAAACAGGAGGG - Intronic
1006613415 6:35309580-35309602 GTGAGGACAAGCAGAGAGGTGGG + Intronic
1007852985 6:44823520-44823542 CCTGTGACAATCACAGAGGAAGG - Intronic
1010291462 6:74142698-74142720 CTAGGAATAAGCACAGAAGAGGG + Intergenic
1011529438 6:88304124-88304146 CTTGCTACAAGCACAGGGGATGG - Intergenic
1013173533 6:107658438-107658460 CTGGGGAGAAGCAGAGATGGTGG - Exonic
1015759016 6:136637350-136637372 AAGGGGAGAAGCACAGAGGAAGG - Exonic
1016620515 6:146104048-146104070 CTGGGGAGAAGCAAAGAGCTAGG + Intronic
1017230708 6:152070307-152070329 CTGGGAACAAGGACAGAGGGAGG - Intronic
1017764216 6:157593550-157593572 CTGGGGACAGGAAAAGAGGCAGG + Intronic
1018058681 6:160072922-160072944 CTGAGGACAACCCCAGAGGACGG - Intronic
1018174115 6:161164276-161164298 ACGGGGACAGGCACAGATGAGGG - Intronic
1018225205 6:161621964-161621986 CTGGGGAGAAAAACAGAGGGTGG - Intronic
1018470302 6:164090604-164090626 CTGGGAAAGAGCACAGATGAGGG + Intergenic
1018582806 6:165322218-165322240 CTGGGGCCCAGCACATGGGATGG - Intergenic
1019447016 7:1076572-1076594 CAGGGCACAAGCACCGGGGAGGG + Intronic
1019484890 7:1284916-1284938 CAGGGGACAAGCAGGGAGAAGGG + Intergenic
1019579223 7:1751738-1751760 CTGGGGGCAGCCACAGAGGAGGG + Intergenic
1020992406 7:15216282-15216304 CTGTGGACAAGAACAGAGACAGG - Intronic
1021243239 7:18231049-18231071 CTGGGGACAAGCTTAGAGCGAGG + Intronic
1021550792 7:21869018-21869040 CTGGGCATAAACACAGAGGAGGG + Intronic
1021856827 7:24865236-24865258 ATGTGGACAAGCATAGGGGAAGG + Intronic
1021984791 7:26087936-26087958 CTGGGAACAAGAACAGAGAGAGG + Intergenic
1022359689 7:29646185-29646207 CTGGGGACGTGCTCAGTGGATGG - Intergenic
1023020964 7:36011383-36011405 CTGGGGTAAATCACAGAGGCAGG + Intergenic
1023271452 7:38467538-38467560 CTGGGTACATGCACAGTGGTAGG + Intronic
1023290722 7:38666192-38666214 CTGGGGACTACTATAGAGGACGG + Intergenic
1023662835 7:42488355-42488377 CAGGAGACATGCACAAAGGAAGG - Intergenic
1024309016 7:47952242-47952264 CTGGGAACCAGCTCAAAGGATGG - Intronic
1024874740 7:54009048-54009070 CTGGGGCAGGGCACAGAGGATGG - Intergenic
1025849978 7:65237459-65237481 CAGGGGCCCAGGACAGAGGAGGG + Intergenic
1026973183 7:74480298-74480320 GTGGGGACAATCACAGGGGTGGG - Intronic
1027151743 7:75738587-75738609 CTGGGGAGAAGGGCAGAGGCGGG - Intronic
1027958907 7:84918932-84918954 ATGGTGAAAAGCAAAGAGGAAGG + Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028610928 7:92710776-92710798 GTGGGGAAAAGCAGAGATGAGGG + Intronic
1028985231 7:97004102-97004124 TGGGGGCCAGGCACAGAGGAGGG - Intergenic
1029144767 7:98438017-98438039 CTGATGACAAGCTGAGAGGAAGG + Intergenic
1029344298 7:99967262-99967284 CTGGTGACCACCACAGAGGGAGG + Exonic
1029347195 7:99987260-99987282 CTGGTGACCACCACAGAGGGAGG - Intergenic
1029648559 7:101874463-101874485 CAGGACACACGCACAGAGGAAGG + Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030273528 7:107695259-107695281 CTGGGGAAAAGCACAGACACAGG + Intronic
1031182642 7:118436475-118436497 CTGGTGACAAGCACAGAGTGAGG - Intergenic
1031245776 7:119309560-119309582 CTGGGGACTACTAGAGAGGAAGG + Intergenic
1031253780 7:119421415-119421437 CTGGGCTCTAGCACAGAGGTTGG - Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032238250 7:130142181-130142203 CTGGGGACAACCACAGAAGTGGG + Intergenic
1032402213 7:131631243-131631265 GTGGGGACAGGCAGAGGGGATGG - Intergenic
1032432525 7:131873439-131873461 ATGGAGGCAAGCAGAGAGGAAGG - Intergenic
1034463296 7:151210396-151210418 CTGGGGACATGCACCTGGGAGGG + Intronic
1034978974 7:155463713-155463735 CTGGGGCCAAGCCAAAAGGAGGG - Exonic
1035097672 7:156368660-156368682 CTGGGGACAAGCAGTGAGCGAGG - Intergenic
1035581861 8:745118-745140 CTGGAGACAAGCACAGCGGCAGG + Intergenic
1038309976 8:26439029-26439051 GTGGGGACAAGCCCAGATGGTGG - Intronic
1039221664 8:35338605-35338627 CTGGCCAGTAGCACAGAGGAGGG + Intronic
1039338271 8:36619036-36619058 CTGGGGACTACCAGAGGGGAAGG + Intergenic
1039782292 8:40797381-40797403 CTGGGGCCCAGCACGCAGGATGG - Intronic
1040018673 8:42721082-42721104 CTGGGGACAGGCACAGACTTGGG - Intronic
1040967712 8:53101021-53101043 CTGGACACAGGCACAAAGGAAGG - Intergenic
1041291239 8:56310398-56310420 CTGGGGAAAAACAGAGAGGTAGG + Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1047329851 8:123876979-123877001 ATGCAGAGAAGCACAGAGGAGGG - Intronic
1048913258 8:139157102-139157124 ATGGGGACAATCACAGAAGGGGG - Intergenic
1049370944 8:142266638-142266660 CTGTGGAACAGCACAGAGAAAGG - Intronic
1049455069 8:142682514-142682536 CAGGGGACAGGCACTCAGGAGGG + Exonic
1049675216 8:143886182-143886204 CTGGGGCCCAGCACAGTGGTGGG - Intergenic
1050426398 9:5516662-5516684 GTGCTGACAAGCACAGAGGGAGG - Intronic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1053284455 9:36841354-36841376 GTGGGGAAAGGCACAGAGGCAGG - Intronic
1053360915 9:37486199-37486221 CTGGGGAGAAGCCCAACGGAGGG - Intronic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1056290282 9:85136209-85136231 CAAGGGACAAGAGCAGAGGAGGG - Intergenic
1056919270 9:90771905-90771927 CTGGCCACAAGCACAGATGAAGG + Intergenic
1057380077 9:94559577-94559599 CTGGGGACAGCCACAGTGGCTGG + Intronic
1057527099 9:95812508-95812530 CTGGGAAAAAGAAAAGAGGATGG - Intergenic
1059985246 9:119814771-119814793 ATGGAAACAAGCAAAGAGGAAGG - Intergenic
1060000184 9:119951598-119951620 CAGGGGACAGGTAGAGAGGAGGG - Intergenic
1060015577 9:120083514-120083536 CTTGGGCCAAGCAGACAGGATGG + Intergenic
1060297759 9:122354932-122354954 CTGGGGATAGACAGAGAGGAGGG - Intergenic
1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG + Intronic
1060797829 9:126524642-126524664 CTGGAGACAGGGACAGTGGAGGG - Intergenic
1060927781 9:127467332-127467354 CTGGGGACACGCGCAGTGGATGG - Intronic
1061146689 9:128803810-128803832 GAGGGGTCAAGGACAGAGGAAGG + Intronic
1061572254 9:131485035-131485057 CTGGAGGCACCCACAGAGGATGG - Exonic
1061707417 9:132463665-132463687 CTGGGGACCAGCAGAGATGGTGG + Intronic
1062014700 9:134285205-134285227 CTGGGGACACGCAGAGGTGAGGG - Intergenic
1062133509 9:134912893-134912915 ATGGGGACAATCATAGATGATGG - Intronic
1062289707 9:135789047-135789069 GTGGGGAAAAGCACAGAGCCGGG - Intronic
1062613783 9:137387054-137387076 CGGGGGCCAAGCACGGAGCAGGG - Intronic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1185648177 X:1629760-1629782 CTGGGGACGTGCCCAGAGCAAGG - Intronic
1186754710 X:12658366-12658388 CTGTGGACATGCATAGAGGCAGG + Intronic
1186797980 X:13065075-13065097 CTGGAGACAAGCACAGTGCCTGG + Intergenic
1187364106 X:18652224-18652246 CTGGGGACAAGCATAGGAAATGG + Intronic
1187662517 X:21565583-21565605 CAGAGGACCAGCACAGAGTAAGG + Intronic
1187798209 X:23028111-23028133 CAGAGGACAAGAACAGAGGGTGG - Intergenic
1189281749 X:39824029-39824051 CTGGGAGCAAGCCTAGAGGAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG + Intronic
1192709618 X:73566262-73566284 TTTGGCACAAGCACACAGGATGG - Intronic
1194615682 X:96100565-96100587 CTGGAGACAAGCAGAGTGGCTGG + Intergenic
1195094857 X:101493094-101493116 CTGGGGACCAGGCCAGTGGATGG + Exonic
1195701662 X:107710252-107710274 CTGGGGATGGCCACAGAGGAGGG - Intergenic
1198914213 X:141649477-141649499 CTGGGGACATGAACAGAGGGTGG - Intronic
1199954127 X:152728784-152728806 CTCTGCACATGCACAGAGGAAGG - Intronic