ID: 1181746783

View in Genome Browser
Species Human (GRCh38)
Location 22:24960761-24960783
Sequence ATGTGGAACTTTAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181746783 Original CRISPR ATGTGGAACTTTAGGGAGGA AGG Intronic
900107416 1:989789-989811 ATGTGGAAGTGTTGGGAGGTGGG - Intergenic
900763049 1:4485784-4485806 ATGTGGAACTGGGTGGAGGATGG - Intergenic
903604417 1:24565109-24565131 ATTTGGCATTTTAGGCAGGAGGG + Intronic
903789854 1:25885374-25885396 AAGTGGGACCTTAGGAAGGAAGG - Intronic
906688956 1:47780154-47780176 AAGTGAAACTTCAGGGAGGCAGG - Intronic
907473531 1:54690177-54690199 AGTTGAAACTTTTGGGAGGAGGG - Intronic
908275161 1:62463156-62463178 ATATGTAACTTTACAGAGGAGGG + Intronic
910350075 1:86286717-86286739 ATGGGGAAGTTTAGGGAGAGTGG - Intergenic
910506874 1:87959407-87959429 GTGTGCAACTGAAGGGAGGAGGG + Intergenic
912392050 1:109310002-109310024 GTTTGGACCTCTAGGGAGGAGGG - Exonic
913356980 1:117932761-117932783 ATTTGGAACTTGAGGAATGAGGG + Intronic
913492351 1:119392710-119392732 ATTTGGAACTTAAAGCAGGATGG + Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915687262 1:157645889-157645911 ATGTGGAATTTCACGGAGGCAGG + Intergenic
916961002 1:169889717-169889739 ATGAGGAACTTTTGGGAGGATGG + Intronic
917243513 1:172974904-172974926 ATGTGGGCCTGTAGGCAGGAGGG - Intergenic
920061176 1:203228033-203228055 ATGTGGAGCTTGAGAGAGGCAGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921213361 1:212918099-212918121 GTGTGGCACATTAGTGAGGACGG + Intergenic
921309451 1:213828283-213828305 ATGTGGCACTGTGGGGAGAAGGG - Intergenic
921804414 1:219437510-219437532 ATATGGAAATGTAGGGAGGGAGG - Intergenic
922016337 1:221651804-221651826 ATGTGGAATTTGAGGCACGAGGG + Intergenic
922652757 1:227355406-227355428 AGGTGGATCTTGAGGGAGGTGGG - Intergenic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1064024386 10:11835284-11835306 ATGTGCAACTTTAGTGTGGTGGG + Intronic
1064526842 10:16266034-16266056 ATATGGAATTTTAGGTATGATGG - Intergenic
1064720491 10:18224455-18224477 ATGAGGAACTTTAAGGAGCCGGG - Intronic
1068158972 10:53238977-53238999 ATATGGAACTTTAGGAGAGATGG - Intergenic
1068350459 10:55837673-55837695 ATATGGCACTTAAGGGAGGGTGG - Intergenic
1069027647 10:63561315-63561337 ATTTAGAAGTTTATGGAGGAAGG + Intronic
1071144967 10:82557994-82558016 ACGTGGAGCTCTAGGGAGGAAGG + Intronic
1071472240 10:85991851-85991873 ATGTGGAAAATGTGGGAGGAGGG + Intronic
1071737324 10:88316457-88316479 ATGTGGTACTGTATGGAAGAGGG - Intronic
1073025441 10:100484027-100484049 AAGTGAGGCTTTAGGGAGGATGG - Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1077554572 11:3219704-3219726 ATGTGGATCCTGGGGGAGGAGGG - Intergenic
1078396494 11:10986339-10986361 ATGTAGACCTTTGGGGAGAATGG - Intergenic
1078921999 11:15839407-15839429 ATGAAGAATTTTAGGGAAGATGG + Intergenic
1081550460 11:44107059-44107081 ATGTGGGACTCTGGGAAGGAGGG - Intronic
1086079849 11:82891625-82891647 GGGAGGAACTGTAGGGAGGATGG - Intronic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1090958098 11:131531500-131531522 AAGTGGAACTTAAGGAGGGAAGG + Intronic
1091025606 11:132138207-132138229 ATGTGGAACTCTGGGAAGGCAGG - Intronic
1093714213 12:22362984-22363006 CTCTGGAACTTCAGGAAGGAAGG + Intronic
1095158571 12:38888740-38888762 TTGTAGAACTGTAGGTAGGATGG - Intronic
1095719185 12:45381780-45381802 ATGTTCAAATTCAGGGAGGAGGG + Intronic
1097121221 12:56734039-56734061 ATCTGTAAATTTTGGGAGGAGGG + Intronic
1099078265 12:78140072-78140094 CTGAGGTACTTTAGGGAGTATGG + Intronic
1099726601 12:86438032-86438054 ATGATTAACTTTAGTGAGGAAGG + Intronic
1100198751 12:92276415-92276437 ATATGGAACCTGAGAGAGGATGG - Intergenic
1100204640 12:92334942-92334964 ATGAGGAAGATTAGGGAAGATGG + Intergenic
1100951930 12:99860397-99860419 ATTTAGTAGTTTAGGGAGGAAGG + Intronic
1101730488 12:107423121-107423143 ATGCACAACTTTAGGGGGGAAGG - Intronic
1102926372 12:116829344-116829366 CTCTGGAACTTTTGGGAAGATGG - Intronic
1103179654 12:118899053-118899075 ATGTGGAAATCTGGGGAGGTGGG + Intergenic
1104129934 12:125883761-125883783 ATGTGGAGCTTTAAGCTGGAAGG + Intergenic
1104522789 12:129490871-129490893 ATGTGAAGCTACAGGGAGGATGG - Intronic
1105050903 12:133049852-133049874 AAGCGGAAGTTGAGGGAGGAAGG - Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1106978109 13:35246813-35246835 AGGTGGTAGTATAGGGAGGATGG + Intronic
1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG + Intergenic
1110466896 13:75812687-75812709 AAGAGGAACTTTAAGGAAGAAGG - Intronic
1110999205 13:82156626-82156648 ATGTTGTAATTTTGGGAGGAAGG + Intergenic
1113398748 13:109972689-109972711 ATGTGGAGCTTTGTGCAGGAGGG - Intergenic
1113577583 13:111405022-111405044 ACGTGGAGCTTTTGGGAGGCGGG - Intergenic
1113607792 13:111622627-111622649 ATGTGTGAATTTAAGGAGGATGG - Intronic
1113973522 13:114209032-114209054 AAATGAAAATTTAGGGAGGAAGG + Intergenic
1114884567 14:26832443-26832465 ATCAGGAATTTTAGGAAGGATGG + Intergenic
1116789462 14:49325107-49325129 GTGTGGAAATTTGGGAAGGATGG + Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1121733355 14:96201758-96201780 ATCTGGAACATTGGGGTGGAGGG + Intergenic
1122966574 14:105130896-105130918 ATTTGTATCTTTAGTGAGGATGG - Intergenic
1123913010 15:24988701-24988723 ATGTGTAACTCTAGTGAGCATGG + Intergenic
1125364609 15:38900571-38900593 ATGTGGAATCTGAGGGAGAAAGG + Intergenic
1126269706 15:46800223-46800245 ATCTGGAACTTTGGGGAAGCTGG + Intergenic
1127463725 15:59224109-59224131 ATGTAGAACTTTCTGGAGGTAGG - Intronic
1128411210 15:67400222-67400244 TTGTAGCACTTTAGGTAGGAAGG - Exonic
1129156805 15:73723134-73723156 ATGGAGAAATTTTGGGAGGAAGG + Intergenic
1129671066 15:77607895-77607917 TTGTGGAAGTTGGGGGAGGAGGG - Intergenic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1130062100 15:80577608-80577630 ATGAGGAACTTTAGGGTGTCTGG - Intronic
1130982178 15:88820329-88820351 ATGGGGGACTTCATGGAGGAAGG + Intronic
1131534973 15:93229411-93229433 ATGTGGAATTTCTGGAAGGAAGG - Intergenic
1135517989 16:23151094-23151116 AGGTGGGACTTTAAGGATGAGGG - Intergenic
1135753162 16:25073355-25073377 ATGGGGAACTTTTTGGATGATGG - Intergenic
1138976899 16:62218639-62218661 AAGTGGAAAATGAGGGAGGAAGG - Intergenic
1139261622 16:65599760-65599782 ATTTGAAGGTTTAGGGAGGATGG - Intergenic
1140901864 16:79375323-79375345 ATGTGGAACTTTAGGAGGAGAGG - Intergenic
1141711816 16:85704115-85704137 ATGTGAAACTCTAAGGAGGACGG + Intronic
1142998165 17:3773598-3773620 ATGTGGAAGTTTCTGGAGGGTGG - Intronic
1143854400 17:9838078-9838100 ATGTGAGATTTTAGGGAGGGTGG + Intronic
1145867983 17:28253026-28253048 AAGTGGAACTTTAGCGGGAAAGG - Intergenic
1148533903 17:48421846-48421868 ATGAGAAACTTTATGGAGGAAGG - Intronic
1149588050 17:57806769-57806791 ATGTGGGACTTAAGGGTGGGTGG + Intergenic
1153155578 18:2145579-2145601 ATGAGGAACTTGAGGGAGCAGGG - Intergenic
1153750507 18:8224991-8225013 ATGTGGAACTTTAAAATGGATGG - Intronic
1154027340 18:10720995-10721017 ATGTGGGACCTGAGGGAGAAAGG - Intronic
1155408177 18:25513056-25513078 ATGGGAAACTTAAGGGAGGGAGG - Intergenic
1155724510 18:29062828-29062850 ATGTGGAGCTTTAGGGGAAAAGG - Intergenic
1156259561 18:35432305-35432327 ATCTGAAACTTTAGAGAGGTTGG + Intergenic
1157337961 18:46755314-46755336 ATGGGGAAGTTTAGAGAAGAAGG + Intronic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159997300 18:74978604-74978626 ATGAGGCTCTTTAGCGAGGAGGG + Intronic
1162182043 19:8876559-8876581 ATGTTGAACTTGAGGGAGCCGGG + Exonic
1163605263 19:18271501-18271523 ATGTGGTACTTTAGGGCTGAGGG + Intronic
1165881272 19:39045727-39045749 TTGTGGAATGTGAGGGAGGATGG - Intergenic
1167275691 19:48537752-48537774 ATGTGGAAATTCAGGAACGAAGG + Intergenic
1167557351 19:50204535-50204557 ATGTGGAAACTGAGGCAGGAAGG - Intronic
925422064 2:3720377-3720399 ATGTGGCTCTTTAGGGAGGCAGG - Intronic
926347844 2:11965526-11965548 ATGTTGAACACTAGTGAGGATGG + Intergenic
927291553 2:21409368-21409390 AGCTGGATCTTGAGGGAGGAAGG - Intergenic
927375814 2:22412343-22412365 ATGTGTATCTATAGGGTGGAAGG - Intergenic
927933163 2:27058689-27058711 ATTTGGCACTTTGAGGAGGATGG - Intronic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928069352 2:28198948-28198970 ACTCTGAACTTTAGGGAGGAAGG + Intronic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
934990413 2:98916363-98916385 ATGAGGAATTTTGGGGAAGATGG + Intronic
936175335 2:110214800-110214822 ATGTGGAAGTTCCTGGAGGATGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
940681630 2:156792857-156792879 ACGTGGAATTTTAGGCTGGATGG - Intergenic
943680150 2:190759930-190759952 TTGTGGAACTCTTGGGAGGAGGG + Intergenic
943811269 2:192193121-192193143 GTATGTAACTTTAGAGAGGAGGG - Intronic
944517965 2:200531389-200531411 ATGGGAATTTTTAGGGAGGAGGG + Intronic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
944904002 2:204244430-204244452 ATGAGGGATTTTGGGGAGGATGG + Intergenic
945120098 2:206448749-206448771 ATGTGGAACTTCCTGGAGGGTGG + Intronic
945171299 2:206998611-206998633 ATTTGGATCTTTAGGAAGAAAGG + Intergenic
947569020 2:231216465-231216487 AGGGGGAAATTTAGGGTGGATGG + Intronic
948127659 2:235576664-235576686 AGGTGGAACTCTAGAGAGGAGGG + Intronic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1171442446 20:25176279-25176301 ATGTGGAGCCTGAGGCAGGAGGG - Intergenic
1171956056 20:31464680-31464702 ATGGGGAAATTTTGGGAGGAAGG - Intergenic
1173215047 20:41073294-41073316 AGGTGGAACTTAAAGGAAGATGG + Intronic
1173462187 20:43251904-43251926 ATGTAGCCCTTTAGGGATGAGGG + Intergenic
1175072259 20:56344388-56344410 TTGGGGAAGTTAAGGGAGGATGG - Intergenic
1175453542 20:59091788-59091810 ACATGGAACTTTGGGGTGGAGGG - Intergenic
1175590785 20:60190274-60190296 ATGAGGAACTTCAGGGGAGAAGG - Intergenic
1177096716 21:16844705-16844727 ATGTGGAACTTGATAGAGCAAGG - Intergenic
1178996687 21:37407946-37407968 ATGTGAAACTTCAGGGAGCCGGG - Intronic
1180973947 22:19834432-19834454 ATGTGGAACTTCAAGAAGGTAGG + Intronic
1181746783 22:24960761-24960783 ATGTGGAACTTTAGGGAGGAAGG + Intronic
1182048334 22:27294184-27294206 ATGTGCAGCTTTCGGGAGGGTGG - Intergenic
1185184236 22:49383074-49383096 ATATGAAAATTGAGGGAGGATGG + Intergenic
949188461 3:1221592-1221614 TTGTGGAATTCTAGGGAGAAAGG + Intronic
949475047 3:4435913-4435935 ACATGGAACTTTAGGAATGAAGG + Intronic
950877342 3:16288226-16288248 ATGTGGTACTTTGGAGAAGAGGG + Intronic
952675962 3:36030553-36030575 ATGTGGAACTTCTGGGAGGGTGG - Intergenic
954716036 3:52527441-52527463 AGGTGGGCCTTTACGGAGGAGGG - Intronic
955499567 3:59570512-59570534 ATGAGGAGCGTGAGGGAGGAGGG - Intergenic
955542260 3:59989750-59989772 ATGTGGAAATTTACAGGGGAAGG - Intronic
955973958 3:64463089-64463111 AATTGGATCTTTAGGAAGGAGGG + Intergenic
956321641 3:68004212-68004234 ATGTGATACTTTAGAGCGGAGGG + Exonic
956726126 3:72157923-72157945 ATGTTGAACTTCAGGGGGAAAGG - Intergenic
956830607 3:73043917-73043939 GTCTGGAACTGTGGGGAGGAAGG - Intronic
961255335 3:125545791-125545813 ATGTGGAAACTAAGGGAGTAAGG + Intronic
961906910 3:130272390-130272412 AGGAGGAACTGTGGGGAGGATGG + Intergenic
963197193 3:142545444-142545466 ATGTTGAAATATAGGGAGAAAGG + Intronic
963670778 3:148249162-148249184 ATGTGGATCTTTAGGGTGACAGG + Intergenic
964476386 3:157101368-157101390 AGGTGGAAGGCTAGGGAGGAAGG - Intergenic
964604586 3:158546461-158546483 ATGTTGAAAACTAGGGAGGAAGG - Intergenic
965611919 3:170553416-170553438 ACGTGTAATTTTAGGGAGTAAGG + Intronic
966331881 3:178823783-178823805 AAGTGGAACTTTGCGGGGGAGGG - Intronic
966343189 3:178948254-178948276 AAGTGAAGCCTTAGGGAGGAAGG - Intergenic
967356219 3:188574833-188574855 ATGTGTAAATTTCAGGAGGAGGG - Intronic
970877840 4:20893323-20893345 ATTTGGAACTTTAGGGTTCAGGG + Intronic
974232722 4:59137486-59137508 ATGTGGATATTTTGGGGGGAGGG + Intergenic
976609904 4:87019625-87019647 ATGTGGAGGTTTAGGGAGAGTGG + Intronic
980277250 4:130669832-130669854 AAGAAGGACTTTAGGGAGGATGG - Intergenic
980476192 4:133320573-133320595 ATGTAGAACATTAAGGAAGAAGG - Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG + Intergenic
980920185 4:139076857-139076879 ATGTTGAATTTTAGGGGGGAAGG - Intronic
983274275 4:165598701-165598723 ATGGGGAAATTGAGGAAGGAAGG - Intergenic
984455163 4:179957370-179957392 ATGAGGAACCTGAGGGAAGAGGG + Intergenic
984806808 4:183758646-183758668 CTATGGAATGTTAGGGAGGAAGG - Intergenic
989349020 5:40463388-40463410 GTGTGGCAGTTTAGGGAGGTGGG + Intergenic
989701027 5:44265100-44265122 ATTTGGAACTTTGGGAATGAAGG + Intergenic
990193983 5:53292355-53292377 AGGAAGAACTTTAGGGAGTATGG - Intergenic
993475935 5:88364042-88364064 TTGTGGTACTTTAAGGAAGATGG - Intergenic
993632539 5:90303436-90303458 ATGTGGAACTTTATAGTGGATGG + Intergenic
995445044 5:112233362-112233384 ATGTGGCACTTTTGGGATGCAGG + Intronic
995493623 5:112719100-112719122 AAGTGGGACTGTATGGAGGAGGG + Intronic
996417822 5:123229178-123229200 ATGTTGAAGGTTAGGGAAGATGG - Intergenic
996423726 5:123290486-123290508 ATGTGGATCTTTATTGAGGATGG + Intergenic
997713458 5:136025400-136025422 ACCAGGAACTTTAGGGAGTAAGG + Intergenic
999204909 5:149840848-149840870 ATGTGGCACTTCAGGGAGGAGGG + Intronic
999649090 5:153748061-153748083 ATGTGTAACTTCAGCGAGGGCGG - Intronic
1002281758 5:178134453-178134475 ATGTGAGACCTTGGGGAGGAAGG + Intronic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003112589 6:3261978-3262000 ATGTGGGAGTTTAGGGAAGCTGG - Intronic
1005914347 6:30339817-30339839 CTGTGGAACTTTGGGGAGGAGGG + Intronic
1006412481 6:33882463-33882485 TTGCAGAACTTTGGGGAGGAGGG + Intergenic
1008561560 6:52729653-52729675 ATGTGAAACTTTAAGGAGTTTGG + Intergenic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009698970 6:67149772-67149794 ATCTGAAACTTTATGGAGAATGG + Intergenic
1010125042 6:72421658-72421680 ATGTGGAAGTGTTGGGAGGTGGG - Intergenic
1010262417 6:73831760-73831782 ATGTGTAACTTTGGGTAGGAAGG + Intergenic
1011404191 6:87000200-87000222 ATGTGGAATTTTAAGGAGTCAGG - Intronic
1011823570 6:91280585-91280607 ATGTGGTTCTTCAGGGAGGCTGG + Intergenic
1013365130 6:109431754-109431776 TTGTTGAACTATAGGGTGGATGG - Intronic
1014290469 6:119552177-119552199 CTGAGGAACTTGGGGGAGGAAGG + Intergenic
1018586354 6:165364217-165364239 AGGTGGGACTTTTGGAAGGAAGG + Intronic
1019115300 6:169755799-169755821 ATGGGGAACTGAAGGGAGTATGG + Intronic
1019125154 6:169833866-169833888 ATCTGGAACTTCAGGAATGAAGG + Intergenic
1020034052 7:4953143-4953165 ATGGGGAACTGTAGGGATGGAGG - Intronic
1024322568 7:48085663-48085685 GTGTTGAACTATAGGGTGGATGG - Intergenic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1030479111 7:110080021-110080043 ATGATGAAATTTAGTGAGGAAGG - Intergenic
1030559768 7:111069946-111069968 ATGTGAAACTTTAGGGATGCCGG - Intronic
1030728357 7:112953834-112953856 ATGCTGAAATTTAGGCAGGATGG + Intergenic
1033427831 7:141261449-141261471 AGGTGGAACTTTTGGGTGGTTGG + Intronic
1033793691 7:144822370-144822392 ATGTGGAACTTTTGTGGGGGTGG + Intronic
1034207300 7:149329085-149329107 ATGTGGTCCTTAAGGGAGCAAGG - Intergenic
1036788260 8:11702059-11702081 GGGTTGAAGTTTAGGGAGGATGG + Intronic
1043422603 8:80114266-80114288 AGGTGGAGGTTTAGGGAGAAAGG - Intronic
1045834185 8:106501065-106501087 ATGTGAAATTTTAGGGAAGATGG + Intronic
1047163069 8:122403635-122403657 ATAGGGAACTTTAGGGATTAAGG - Intergenic
1047917004 8:129593430-129593452 ATCTGGAACTCTAGGAAAGAGGG + Intergenic
1049737227 8:144215514-144215536 AAGTGGTCCTCTAGGGAGGAGGG - Intronic
1050192170 9:3038067-3038089 ATGTGTATCTTTAGAAAGGAGGG + Intergenic
1052018605 9:23498953-23498975 ATGTGGAGGTTTTGGGAGGTGGG + Intergenic
1052721349 9:32174773-32174795 ATCTGGATGATTAGGGAGGAAGG - Intergenic
1053414253 9:37936871-37936893 AGTTGGGACCTTAGGGAGGAAGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057171217 9:92964407-92964429 TTGTGGAACTTTGGGGTGGTAGG + Intronic
1057997969 9:99837293-99837315 ATGTAAAACTTTAAGAAGGAAGG - Intronic
1058170778 9:101678620-101678642 AGGTGAAACTGTAGGGTGGAAGG + Intronic
1059260562 9:112972071-112972093 AGGTGGTACCTTTGGGAGGAAGG + Intergenic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1186277570 X:7956659-7956681 ATGTGGAATTTGATGGAGGTGGG - Intergenic
1187699371 X:21950272-21950294 ATGTGGAATTTTGAGGAAGATGG + Intronic
1187989612 X:24855238-24855260 ATGTGTTACTTTTGGGGGGAGGG + Intronic
1189478167 X:41373156-41373178 ATGTGGAACTTTAGGGATAAAGG - Intergenic
1190488951 X:50961671-50961693 ATGTGGAACATTGGGGATGAAGG - Intergenic
1190992343 X:55565468-55565490 ATGAGATACTTAAGGGAGGAGGG + Intergenic
1191871365 X:65748477-65748499 ATATGGTACATTAGTGAGGAGGG - Intergenic
1192417933 X:71001037-71001059 ATGTGCAGCGTTAGGGAGAAGGG - Intergenic
1194388388 X:93286294-93286316 ATGGGATACTTTAGGGAGAATGG + Intergenic
1195278661 X:103309533-103309555 ATGTGTAAGTTTAGGAAGCAGGG + Exonic
1196392647 X:115224740-115224762 TTGTGAAACTTTAGGGACCAAGG - Intronic
1197378950 X:125714714-125714736 ATGTGGAACTTCTGGGAAGATGG + Intergenic
1198262085 X:134973962-134973984 ATGTAGAGCTTTAGGTAGGTGGG + Intergenic