ID: 1181746992

View in Genome Browser
Species Human (GRCh38)
Location 22:24962388-24962410
Sequence GGATTGGCATGGAGCTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181746986_1181746992 -6 Left 1181746986 22:24962371-24962393 CCAGATGGTGGCTGTGAGGATTG 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181746992 Original CRISPR GGATTGGCATGGAGCTGAGG GGG Intronic
No off target data available for this crispr