ID: 1181747002

View in Genome Browser
Species Human (GRCh38)
Location 22:24962443-24962465
Sequence TGCAATATTCCCAAGGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181747002_1181747010 2 Left 1181747002 22:24962443-24962465 CCCATTCCCTTGGGAATATTGCA 0: 1
1: 1
2: 1
3: 5
4: 140
Right 1181747010 22:24962468-24962490 GAACCTGGAGCCGGACTGCTTGG No data
1181747002_1181747009 -7 Left 1181747002 22:24962443-24962465 CCCATTCCCTTGGGAATATTGCA 0: 1
1: 1
2: 1
3: 5
4: 140
Right 1181747009 22:24962459-24962481 TATTGCAGGGAACCTGGAGCCGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181747002 Original CRISPR TGCAATATTCCCAAGGGAAT GGG (reversed) Intronic
904942322 1:34172930-34172952 AGCATTATTCGCATGGGAATGGG + Intronic
907913515 1:58847855-58847877 TTCAATATTCCAAAAGGTATGGG - Intergenic
909613709 1:77582037-77582059 TTCAAAATTCCCAAGGCTATGGG + Exonic
912994433 1:114518770-114518792 TGCAAAAGGCCCAAGGGAAGAGG - Intergenic
913555182 1:119959333-119959355 TGCTATATTCCCAAAGTGATAGG + Intronic
915837000 1:159185170-159185192 TGAAATAGTCCCAAAGGTATAGG + Intronic
915971261 1:160356790-160356812 TCCAACTTTCCCAAGGGAAAGGG - Intronic
916485820 1:165257639-165257661 TGCCAGGCTCCCAAGGGAATGGG - Intronic
918149200 1:181783423-181783445 TGCCAAATTCCAAAGGGAAGGGG - Intronic
918525712 1:185462438-185462460 TGCCACATTCCCAAGGTTATGGG - Intergenic
920074472 1:203326398-203326420 TGCTATATTGCCAAAGGAAAAGG - Intergenic
920160886 1:203996889-203996911 AACAATATTCCCCAGGCAATAGG + Intergenic
924473316 1:244362752-244362774 TGCAAAATTCCTAAGGTAAATGG + Intronic
1063908500 10:10805403-10805425 TCAAATATTCCTAAGGGAAAAGG - Intergenic
1064462150 10:15545380-15545402 TGCAATAGTCCAGAGGGAAATGG - Intronic
1068060069 10:52056562-52056584 TGAAATATTGCCAAGGGAATTGG - Intronic
1068421789 10:56803971-56803993 TGCAGTATATGCAAGGGAATAGG - Intergenic
1070613645 10:77952050-77952072 TGCAAGTTTCCAAAGGGAAAGGG - Intergenic
1070718356 10:78739027-78739049 TGCAATGCTCTCAAAGGAATGGG + Intergenic
1072951704 10:99852615-99852637 TGAATTCTTCCTAAGGGAATTGG + Intergenic
1077999141 11:7479288-7479310 TGGCATTTTCCCAAGGGAAAAGG + Intergenic
1080679498 11:34460921-34460943 TGCAATACTTCCTTGGGAATAGG + Intronic
1085940433 11:81200694-81200716 TGGAGTAGTCCCAAGGAAATGGG - Intergenic
1091181622 11:133609777-133609799 TGCATTACTCCCAATGAAATGGG - Intergenic
1092995975 12:13951013-13951035 TGGAATGTTCACAAGGGAGTGGG - Intronic
1099118336 12:78655458-78655480 AACAATATTGCCAAGGTAATTGG + Intergenic
1100398913 12:94210531-94210553 TGCCATATTAACAAGGAAATGGG + Intronic
1100820576 12:98425834-98425856 TACAATATTCCCTAGGGTTTGGG + Intergenic
1102632797 12:114296482-114296504 TGGAAAATTCCCAGGGGAAGTGG - Intergenic
1104092089 12:125525891-125525913 TGCAATAATCACAAGGGAAGGGG - Intronic
1104232540 12:126898968-126898990 TGCAGCACTTCCAAGGGAATAGG + Intergenic
1104499468 12:129271091-129271113 TGCATTTTTCCCAAAGCAATAGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1108172555 13:47757248-47757270 TGTAGTATTCCAAAGGGAAAGGG + Intergenic
1111194453 13:84855068-84855090 TGCTAAATTCCCAAGAAAATTGG + Intergenic
1111206626 13:85019849-85019871 TCCTATATTCCCTTGGGAATGGG - Intergenic
1111287371 13:86112499-86112521 TGCAAAAATGCCAAGGGACTGGG - Intergenic
1111428119 13:88116782-88116804 TACAATATACCCAGGGGAAAGGG + Intergenic
1112881027 13:104106874-104106896 TGAAATATTCCAAAAGGAAATGG - Intergenic
1116992207 14:51288323-51288345 TGAAATATTCCCAAAGACATGGG - Intergenic
1117836023 14:59806997-59807019 TTCCATATTCCGAAGGAAATGGG + Intronic
1118997520 14:70850191-70850213 TGCAATATTGAGAAGGGAGTTGG - Intergenic
1119929409 14:78530402-78530424 TGCAATTTTTCCAAGGGAAAGGG - Intronic
1120336769 14:83167533-83167555 AGCAATATTCCCCATGGCATAGG + Intergenic
1122825708 14:104369474-104369496 TGCAATCTTCTCCAGGGAACGGG + Intergenic
1123179323 14:106453686-106453708 TGCAATAGTGCCACAGGAATTGG + Intergenic
1125249211 15:37680067-37680089 TTGAATTTTCCCAAGTGAATGGG - Intergenic
1129206803 15:74042108-74042130 TGAGATTTTCCCAAGGGACTGGG - Intronic
1129573818 15:76719047-76719069 GGCAATATACCCAAAGGAAATGG + Intronic
1133012183 16:2919798-2919820 TGTAATTTTACCAAGGCAATAGG + Intronic
1141105788 16:81232526-81232548 TGCCATATTGCCCAGGCAATTGG - Intergenic
1143243351 17:5462660-5462682 TGCATGCTTCCCAAGGGAGTGGG - Intronic
1143566066 17:7721510-7721532 AGCAGTTTTCCCAAGGGAGTTGG + Intronic
1145122056 17:20269066-20269088 TCCAAAATTCCCAAGGAATTGGG - Intronic
1149220844 17:54414012-54414034 TGCTTTATTTCCAAAGGAATCGG + Intergenic
1151272108 17:73004823-73004845 TCCAATATTCCCAAGGGAATGGG - Intronic
1153505267 18:5790360-5790382 GGCAATATTCACAGGGGATTAGG - Intergenic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1157539380 18:48488853-48488875 TGCAACCTTCCAAAGGGAAAGGG - Intergenic
1159899315 18:74028990-74029012 TGCAATATTTTCAAGGTATTCGG - Intergenic
1160091186 18:75827995-75828017 TGGAATATTCCCAAGGATTTGGG - Intergenic
1160380086 18:78447935-78447957 TACAATATGCCCAAGAAAATGGG + Intergenic
1163567634 19:18060881-18060903 GGAAAAAATCCCAAGGGAATGGG - Intronic
1167725046 19:51205801-51205823 TGGGATATACCCAAAGGAATTGG + Intergenic
1168261433 19:55197253-55197275 GGCAAGATCCCCAAGCGAATTGG - Exonic
925608111 2:5679626-5679648 TGCAAAATACACCAGGGAATGGG + Intergenic
926700165 2:15798176-15798198 TGTAATATTGCCCAGGGATTTGG - Intergenic
927596029 2:24398602-24398624 TGCAAAATTCTTAAGTGAATAGG + Intergenic
931197701 2:60068414-60068436 TGCAATGTTTCCAAGGCAGTGGG + Intergenic
932082405 2:68726938-68726960 TTCCATATACCCAAGGGAATGGG + Intronic
935913752 2:107926305-107926327 TGGAATATTCCTTAGGGAAATGG - Intergenic
936475040 2:112832393-112832415 TGCACTATGCCCAAGAGACTTGG + Intronic
938329598 2:130440553-130440575 TGGAGTCTTCCCATGGGAATAGG - Intergenic
939419890 2:141952953-141952975 TTAAATATTTCCAAGTGAATAGG - Intronic
941037133 2:160580825-160580847 TCCATCATTCCCAAGGGAAGAGG + Intergenic
941285150 2:163602382-163602404 TGCAGTGTTCCCAAAGGAAAAGG - Intronic
943853917 2:192763780-192763802 TTCAAAATAGCCAAGGGAATTGG + Intergenic
945013514 2:205490081-205490103 TTCAAAATTGCCAAGGGAAGTGG + Intronic
948268580 2:236656775-236656797 TCCAATCTTCCCATGGGATTCGG - Intergenic
1168879079 20:1191259-1191281 TGCAATATTCCAAAAGGTAGTGG + Intergenic
1177807715 21:25890382-25890404 TCCACTATCCCCAAGGAAATGGG - Intronic
1178052099 21:28759201-28759223 TGCACTGTGCCCAAGGGCATGGG + Intergenic
1178474356 21:32923336-32923358 TCCAAGATTCCCCAGGGAAACGG + Intergenic
1178701243 21:34835307-34835329 TCCAATATTCCCAGCAGAATAGG + Intronic
1179119805 21:38532669-38532691 TGCAATATTTTCAAGAGAATGGG + Intronic
1181747002 22:24962443-24962465 TGCAATATTCCCAAGGGAATGGG - Intronic
1183901954 22:41012439-41012461 TGTAATATTTCCAAAGGAAAGGG - Intergenic
1184433977 22:44458866-44458888 TGCTCTATTCCCAAGGGATGAGG + Intergenic
950790986 3:15471825-15471847 TTCAACATTCTCTAGGGAATGGG + Intronic
951134570 3:19089561-19089583 AGCCATATCCCCAAGGAAATAGG + Intergenic
952701827 3:36336578-36336600 TGCAATTTTGCCATGGGACTGGG + Intergenic
953085883 3:39666575-39666597 AGCAATACTCACAAGGCAATTGG - Intergenic
953099634 3:39811305-39811327 TTCAATCTTCCCAAGGAACTTGG + Intronic
953312780 3:41896063-41896085 AGTAATATTCCCAGGGGAAGAGG + Intronic
958693197 3:97494643-97494665 GGAACTGTTCCCAAGGGAATGGG - Intronic
959747528 3:109794764-109794786 TGCAGTCTTCGCAAGGGACTTGG + Intergenic
963275316 3:143324235-143324257 TGCAATGTTCCCCAGGCAGTGGG + Intronic
964219842 3:154330717-154330739 TGTAATATTCACAAAGGCATGGG + Intergenic
965747870 3:171944368-171944390 TCCAATATAGCCAAGGGAAAAGG + Intergenic
967204385 3:187106360-187106382 TCCAATATTCTCCATGGAATCGG - Intergenic
969171617 4:5368580-5368602 TGCAATGTGCCCAAGGTCATAGG + Intronic
970387616 4:15571680-15571702 TGCAATCTTCCCTAGGCAAAAGG + Intronic
972204115 4:36750341-36750363 TAAAATATTGCCAAAGGAATAGG + Intergenic
978174576 4:105714157-105714179 GGCAAGATTCCCAAGCAAATTGG + Intronic
980576842 4:134693989-134694011 TGAAATATTTACAAGGGTATGGG - Intergenic
981406161 4:144372200-144372222 TCACATTTTCCCAAGGGAATAGG - Intergenic
981876989 4:149558838-149558860 TCCAAAATTCAGAAGGGAATTGG - Intergenic
982138707 4:152297052-152297074 TACCATATCCCCAAGGCAATGGG - Intergenic
985985261 5:3510572-3510594 TGCAACAATTGCAAGGGAATAGG + Intergenic
994391812 5:99199553-99199575 TGTAATATTCAGAAGGGAAGAGG - Intergenic
994612378 5:102059632-102059654 TGCAATATTGGCAAGAGAAATGG + Intergenic
996483132 5:123998307-123998329 AGTCAGATTCCCAAGGGAATGGG - Intergenic
997016396 5:129939919-129939941 TACAATGTTCCCTAGTGAATGGG - Intronic
998139761 5:139693223-139693245 TGACACACTCCCAAGGGAATGGG + Intergenic
1005286191 6:24329581-24329603 TCCAATATTCCAAACAGAATGGG + Intronic
1005911264 6:30311615-30311637 TGCATTTTTCCCCAAGGAATTGG - Intergenic
1007854639 6:44842509-44842531 TGAAATAATCCCAAGACAATTGG - Intronic
1008305025 6:49890308-49890330 TGCAAGATTGGCAAGGCAATCGG - Intergenic
1009367385 6:62866099-62866121 TGTAATATTCCAAAGGGGAGAGG - Intergenic
1009527095 6:64761146-64761168 TGCAATATTCTCCAGGAAATTGG + Intronic
1010124909 6:72420527-72420549 TGCAAAAATCCCTAGGGAACGGG - Intergenic
1012789136 6:103671005-103671027 TGCAATATACCAAATGGCATAGG - Intergenic
1012945528 6:105461539-105461561 TGCAATTTCTCCAAGGGGATTGG + Intergenic
1014463919 6:121731230-121731252 TGCAATATTCCCGAGACTATTGG + Intergenic
1015670744 6:135687112-135687134 TGCAAGAAACCTAAGGGAATTGG + Intergenic
1018670622 6:166173833-166173855 TGCAATACCCTCAAGGGAACAGG + Intergenic
1018996043 6:168711305-168711327 TGCAATTCTCCCATGGAAATTGG - Intergenic
1019898162 7:3999234-3999256 TGCTCTGTACCCAAGGGAATGGG - Intronic
1020243435 7:6412803-6412825 TGCAATAAACCCAAGGTAAGCGG - Exonic
1024833522 7:53489441-53489463 TGGAATATTTTCAAGAGAATTGG + Intergenic
1028756424 7:94440246-94440268 TGCATTTTCCCCAAGGGACTTGG + Intergenic
1034096012 7:148408353-148408375 TGCCATATTTCCAAGAGAAGAGG + Intronic
1035983063 8:4394668-4394690 AGCAAGACGCCCAAGGGAATAGG - Intronic
1036118663 8:5989781-5989803 TGAATTATTCCCAAGCCAATAGG - Intergenic
1037539995 8:19861921-19861943 CGTAACATTCCCAAGGGGATGGG + Intergenic
1044208137 8:89516335-89516357 TGCAATTTTCTAAAGAGAATCGG - Intergenic
1044256334 8:90067299-90067321 TTCAAAATTCCCCAGGGAAGAGG + Intronic
1044337509 8:91004639-91004661 TGCCTTATTCCAAAGAGAATGGG + Intronic
1046360324 8:113145109-113145131 TGGAATAATCCCAAAGGAAAGGG + Intronic
1048602483 8:135932756-135932778 CATTATATTCCCAAGGGAATGGG - Intergenic
1048703102 8:137116686-137116708 TGCATTCTTCCCAAGGGCACAGG - Intergenic
1049314163 8:141951026-141951048 TGCCATTTTCCCAAGAGCATGGG + Intergenic
1053161038 9:35813604-35813626 TACAACATTCCTAAGGGGATAGG + Intronic
1053430104 9:38036503-38036525 TGCAACATTCCCAAGGGCTCTGG - Intronic
1185744291 X:2559584-2559606 TGCAATTCTCCCAATGAAATGGG + Intergenic
1190516562 X:51229782-51229804 AGCAATATTTCCAAGGGGAATGG - Intergenic
1198295607 X:135283603-135283625 TCCACTATTCCCAGAGGAATGGG - Intronic
1199421010 X:147644631-147644653 TGAATTCTTCCCAAGAGAATGGG - Intergenic