ID: 1181748752

View in Genome Browser
Species Human (GRCh38)
Location 22:24974246-24974268
Sequence GAGACCTGCCCAATGTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 1, 2: 14, 3: 143, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181748752_1181748758 15 Left 1181748752 22:24974246-24974268 CCTTGTGACATTGGGCAGGTCTC 0: 1
1: 1
2: 14
3: 143
4: 570
Right 1181748758 22:24974284-24974306 TTTAGTGTGTGATGTGATGATGG 0: 1
1: 1
2: 5
3: 40
4: 389
1181748752_1181748759 22 Left 1181748752 22:24974246-24974268 CCTTGTGACATTGGGCAGGTCTC 0: 1
1: 1
2: 14
3: 143
4: 570
Right 1181748759 22:24974291-24974313 TGTGATGTGATGATGGTGACAGG 0: 1
1: 0
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181748752 Original CRISPR GAGACCTGCCCAATGTCACA AGG (reversed) Intronic
900331625 1:2137651-2137673 GAGCCCTGGCCCATGTCACTGGG - Intronic
900687465 1:3957916-3957938 GAAACTTGCCCAAAGCCACATGG + Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
900942648 1:5810948-5810970 GTGACCTGCCCAGAGCCACAGGG - Intergenic
901104145 1:6742256-6742278 ATGACCTGCCCAAGGGCACATGG + Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901219546 1:7575557-7575579 GTGACTAGCCCAAAGTCACATGG - Intronic
901526188 1:9824426-9824448 GCGACCTGCCCGAAGTGACAAGG - Exonic
901646200 1:10718085-10718107 GAGGCTGGCCCAATGCCACAGGG + Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
902179873 1:14679753-14679775 GAAACATGCCCAAGGTCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903086717 1:20867467-20867489 GTGACTTGGCCAAAGTCACATGG - Intronic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903247413 1:22025971-22025993 GGGACTTGCCCAAAGCCACAAGG - Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903422385 1:23227293-23227315 GACACTTGCCCAAGGTCTCACGG + Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903794017 1:25914697-25914719 GACATTTGCCCAATGTCACATGG + Intergenic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903925913 1:26830321-26830343 GTAATCTGCCCAAGGTCACATGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904172292 1:28599776-28599798 GTGACCTGTCCAAGGTCACTAGG - Intronic
904208401 1:28869952-28869974 ATGACATGCCCAAGGTCACAAGG - Intergenic
904280431 1:29414891-29414913 ATGACTTGCCCAATGGCACAGGG + Intergenic
904357129 1:29947581-29947603 GTGACATGTCCAGTGTCACAGGG - Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904565811 1:31427732-31427754 GAGGCCTAGCCAAGGTCACATGG + Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904767881 1:32864337-32864359 AGCACCTGCCCAAGGTCACAAGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
905658681 1:39703010-39703032 GTGACCTGCCTGAAGTCACATGG - Intronic
905690626 1:39940260-39940282 GTGACCTGCCTAAAGTCACATGG + Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
905894426 1:41535792-41535814 GTGTCTTGCCCAAAGTCACAAGG + Intronic
906041164 1:42788755-42788777 GATACTTGCTCAAAGTCACATGG - Intronic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
906248538 1:44293895-44293917 GAGCCCAGCCCAGTGTTACATGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906805349 1:48775349-48775371 GAGACTTGCCCAGGGTCTCATGG - Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907307111 1:53519638-53519660 GAGACCTGCCCCGTGGCCCACGG + Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907393571 1:54174484-54174506 GACACTTGCCCAAGGTCACCTGG + Exonic
907560268 1:55381490-55381512 GTCACTTGCCCAAAGTCACATGG + Intergenic
907783355 1:57587758-57587780 GAGACTTGCCCAAGGCCACTAGG + Intronic
907785687 1:57610443-57610465 GGGACTTGCCCAATGTCACCTGG + Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
911046742 1:93635024-93635046 GAGACCAGCCCAAGCACACAGGG + Intronic
911143740 1:94532879-94532901 GGGCCCTGCCCAGAGTCACAGGG + Intronic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912931514 1:113967829-113967851 GAGCAGTGGCCAATGTCACATGG - Exonic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913205959 1:116538994-116539016 GTAACTTGCCCAATGTCAAATGG - Intronic
913681450 1:121189594-121189616 GAGGCTTGTCCAAGGTCACACGG + Intronic
914033281 1:143977231-143977253 GAGGCTTGTCCAAGGTCACACGG + Intergenic
914156165 1:145090736-145090758 GAGGCTTGTCCAAGGTCACACGG - Intronic
915146589 1:153799302-153799324 ATGACCTGCCCAAAGTCCCATGG - Intergenic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
916886847 1:169077867-169077889 GTGACTTGCCCAAAGTCATACGG + Intergenic
917476951 1:175377101-175377123 AAAACCTGCCCAAGTTCACAAGG - Intronic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917954509 1:180079998-180080020 GAAATTTGCCCAAAGTCACAGGG + Intronic
918478608 1:184952809-184952831 AAGACAAGCCCAAAGTCACATGG + Intronic
919679577 1:200420826-200420848 GAAAACTGCCCAAAGTCACAGGG - Intergenic
919777672 1:201204944-201204966 GTGACCTGTCCAAGGTAACATGG + Intronic
919855992 1:201706504-201706526 GGGGCCTGCCCAGTGTCACCAGG - Intronic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
920118575 1:203638580-203638602 GAGACTTGCCCAAAGACACTGGG + Intronic
920262589 1:204699338-204699360 AAGACTTGCCCAAAGTCACGTGG - Intergenic
920346504 1:205309087-205309109 GAGATTTGCCCAAGGCCACAAGG - Intronic
920468764 1:206208112-206208134 GAGGCTTGTCCAAGGTCACACGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921213869 1:212921251-212921273 GTAACCTGCCCCAAGTCACACGG - Intergenic
921315129 1:213883191-213883213 AAGATCTGCCCAAGTTCACACGG - Intergenic
921374526 1:214460099-214460121 GTGACCTGCCCACAGTCACTGGG - Intronic
921771992 1:219051194-219051216 ATGACTTGTCCAATGTCACATGG - Intergenic
922223905 1:223628776-223628798 GTCACCTGCACAGTGTCACAGGG + Exonic
923202584 1:231726414-231726436 GAGTGCTGCCCAAGGTCACCTGG + Intronic
1063040017 10:2328707-2328729 AAGACCTGCTCGATGTCACAAGG + Intergenic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1065449638 10:25843423-25843445 GAGACCTGCTCGATGTCAGGTGG + Intergenic
1065782577 10:29183723-29183745 GAGAGCAGCCCAATGGCAAAGGG - Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1067167237 10:43875019-43875041 GTGAGCTGCCCCATATCACACGG - Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1067565032 10:47330331-47330353 GTGATCTTCTCAATGTCACATGG + Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1070779188 10:79127630-79127652 GAGACTTGACCAGGGTCACACGG + Intronic
1071336835 10:84607299-84607321 GAGATCTGCACATTGTCCCATGG - Intergenic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071942158 10:90601790-90601812 GAGACTTACTCACTGTCACAAGG - Intergenic
1072189243 10:93066855-93066877 GGGAACTGCCCAAGGTCATACGG - Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1072626210 10:97113909-97113931 AAGACATGCCCACGGTCACATGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073331469 10:102672757-102672779 CAGACCTGCCCAGTGTTACATGG - Intergenic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074548262 10:114419009-114419031 GAAATCTGGACAATGTCACAGGG - Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074878913 10:117636387-117636409 GAGACCTTCCCAAAGCCACAAGG - Intergenic
1075466724 10:122656995-122657017 GAGACTTACCCAAAGTCACAGGG - Intergenic
1075468782 10:122672393-122672415 GAGACTTTCCCAAAGTCACAGGG - Intergenic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1076150939 10:128161553-128161575 AATACCTGCCTAATGCCACAGGG - Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1077459810 11:2703340-2703362 GGGACCTGCCCTCTGTCACGTGG - Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1077911708 11:6577858-6577880 GTAAACTGCCCAAGGTCACACGG + Intronic
1078157656 11:8812667-8812689 GGGACTTGCCCAATGGCACATGG - Intronic
1078374313 11:10780639-10780661 GTAACTTGCCCAAAGTCACATGG - Intergenic
1078430209 11:11282487-11282509 GAGACTTGTCCAGGGTCACATGG + Intronic
1078521310 11:12066136-12066158 GAGGCCTGCCCACAGCCACATGG - Intergenic
1078721085 11:13883685-13883707 GGCACCTGCCCCATGTTACAAGG - Intergenic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1079129490 11:17738961-17738983 GGGACCTGCCCAAGGGCACTCGG + Intronic
1079149664 11:17886083-17886105 GAGATTTACCCAAAGTCACATGG - Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1080831069 11:35893877-35893899 GTGACTTGCCCATTGTCATACGG + Intergenic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081206254 11:40279092-40279114 CAGATGTTCCCAATGTCACAGGG - Intronic
1081399532 11:42626716-42626738 GTGACTTGCCAAGTGTCACAAGG - Intergenic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1083167155 11:60897619-60897641 GTAACCTGCCCAATGCCACAGGG + Intronic
1083260369 11:61519230-61519252 GAGACTTACCCACAGTCACAGGG + Intronic
1083302901 11:61748097-61748119 AAGACCTGCCCAAGGTCGCATGG + Intergenic
1083613381 11:64014940-64014962 CAGAGCTGCCCAAGGTCACAGGG + Intronic
1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083832479 11:65241652-65241674 GACACATGCCCAAGGTCACTTGG - Intergenic
1084337471 11:68468359-68468381 GAGACCTGTCCATTGTCCAAAGG - Intronic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085380567 11:76113724-76113746 GCATCCTGCCCAAAGTCACAGGG - Intronic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1088807721 11:113367291-113367313 GCAACTTGCCCAAAGTCACATGG - Intronic
1089145966 11:116329884-116329906 GAGACCTTCCCCTGGTCACATGG - Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089306214 11:117527942-117527964 AAAACTTGCCCAAGGTCACAGGG - Intronic
1089342752 11:117770498-117770520 GAGACCTGCCTAATGTCCCGTGG - Intronic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089994612 11:122893897-122893919 AAGACTTGCCCAAGCTCACATGG + Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090269910 11:125378671-125378693 CAGTCCTGGCCAAGGTCACAAGG + Intronic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091673016 12:2466721-2466743 CAGACCTGCCCAAGGTCTCCAGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1094297848 12:28927945-28927967 GAGAACACCCCATTGTCACACGG + Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1095176932 12:39103322-39103344 GAGACCTACCCCACGGCACAAGG + Intergenic
1095464209 12:42473711-42473733 GAGACTTGTCCAAGGTCATATGG + Intronic
1095824894 12:46520708-46520730 GTGGCCTGTCCAATGTCACACGG + Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096123180 12:49101894-49101916 GTGACTTGCCCAAAGACACAGGG - Intronic
1096132851 12:49174290-49174312 GAAGCCTGCCCTATGTCTCAGGG + Intergenic
1096561619 12:52439667-52439689 GAAACCTCCCCAGTGTCACAGGG + Intergenic
1096577073 12:52559358-52559380 GAGACCTGCCCACAGTCACACGG - Intergenic
1097242159 12:57582920-57582942 ATGACTTGTCCAATGTCACAAGG - Intronic
1097396407 12:59080330-59080352 AAAACTTGCCCAATGTCACTTGG - Intergenic
1098885695 12:75958730-75958752 GAAACCTGCCCAAGTTCCCATGG + Intergenic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1099776769 12:87143308-87143330 GAAACTTGCCCAATTTCACAAGG + Intergenic
1100391755 12:94150138-94150160 GAGACCTGGTAAATGTCACCCGG - Intronic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101613188 12:106310638-106310660 GTGACCTTCCCAAGGTCTCATGG + Intronic
1101752302 12:107591878-107591900 GAAACCTGCCCACGGTTACATGG + Intronic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1101914346 12:108884770-108884792 GAGACTTGGCCACAGTCACACGG - Intronic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102389787 12:112540228-112540250 AAGACTTGCCAAAGGTCACACGG + Intergenic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103191510 12:119005907-119005929 GAGCTTTGCCCAAGGTCACACGG - Intronic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103782796 12:123410429-123410451 GTGACTTGACCAATGTCACACGG - Intergenic
1106374522 13:29172187-29172209 GAGACCTGTCCAATGTCACATGG - Intronic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1106698231 13:32201253-32201275 GTGACCTGGCTAATGTCACCTGG + Intronic
1107729757 13:43336828-43336850 AAGACTTTCCCAAAGTCACAAGG + Intronic
1108117379 13:47144414-47144436 GAGAAGAGCCCAAAGTCACAAGG - Intergenic
1108241772 13:48471900-48471922 GAGACCTGCCCAAGGTGAGGTGG - Intronic
1110356556 13:74574194-74574216 GTGACTTGGCCAATGTCACTAGG - Intergenic
1111897484 13:94159176-94159198 GTGATATGCCCAATGTCTCAGGG - Intronic
1112485087 13:99812496-99812518 AAGTCCTGCCCAAGGCCACAGGG - Intronic
1112985947 13:105450043-105450065 GTGACATACCCCATGTCACAGGG + Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113978527 13:114251306-114251328 AAAACTTGCCCAACGTCACATGG - Intronic
1114539920 14:23447470-23447492 GAGATCTGCCCCATCTCACTGGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1116057305 14:39879665-39879687 AAGACTTGCCCAAGGTCACAGGG + Intergenic
1117386322 14:55216765-55216787 CAGAGCTGCCCAATGTCACTAGG - Intergenic
1117432246 14:55679029-55679051 AAGATCTGCCCAAATTCACATGG - Intronic
1118412561 14:65496932-65496954 GTAACTTGCCCAATGTCACAGGG - Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119481800 14:74962652-74962674 AAGACTTGCCCAAGGTCACACGG - Intergenic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1119916003 14:78402703-78402725 GTAACCTGTCCAAAGTCACATGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120108629 14:80526278-80526300 GAGAGCTGCCCAAGGTCAAATGG + Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1121346924 14:93143116-93143138 GGAACCTGCCCGAGGTCACAGGG - Intergenic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1122089981 14:99331479-99331501 GTGACATGTCCAAGGTCACATGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1122220332 14:100234692-100234714 GAGATGTGCTCAACGTCACATGG - Intergenic
1123154941 14:106215633-106215655 GAGACCTGACTAATGTAACTTGG + Intergenic
1124577317 15:30921298-30921320 GGGACCTGCCAAGTCTCACAAGG - Intronic
1124827879 15:33116818-33116840 AGGACCTGCCCAAAGTCAGATGG - Intronic
1125890883 15:43266508-43266530 GTGACTTGTCCAATGTCAAAGGG + Intronic
1126351509 15:47749518-47749540 GTAACATGCCCAAAGTCACATGG + Intronic
1126351841 15:47752050-47752072 GAGTCCTGCCCCCTCTCACAAGG - Intronic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1127253517 15:57267835-57267857 AAGACTTGCCCAAAGTCACTCGG - Intronic
1127342235 15:58059478-58059500 GATACCTTCCCACTGTCAAAAGG + Intronic
1127583126 15:60355619-60355641 GTGACCTTCCCTAAGTCACACGG + Intronic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128260227 15:66228030-66228052 GTGACCTGCCCATAGTCACAAGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1129199364 15:73989732-73989754 GAAACCTGTTCAAGGTCACATGG + Intronic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129698774 15:77755645-77755667 AACACCTTCCCAAGGTCACAAGG + Intronic
1129700015 15:77762500-77762522 GATACCTGCCCAAGGCCACTTGG + Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1132670954 16:1102161-1102183 CAGCCATGCCCAATGTCACCTGG + Intergenic
1133232043 16:4371622-4371644 GAAACCTGCCCAGTGTCATCCGG + Intronic
1133247220 16:4457028-4457050 GAGAGCTGGCCAATGTCCCTGGG + Intergenic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134754654 16:16655962-16655984 CAGACCTTTCCAAAGTCACATGG + Intergenic
1134905086 16:17972878-17972900 GTGACTTGCCCAATGCCTCAGGG - Intergenic
1134991407 16:18703080-18703102 CAGACCTTTCCAAAGTCACATGG - Intergenic
1135051636 16:19197839-19197861 GTGACTTGTCCAATGTCACATGG + Intronic
1135484954 16:22856166-22856188 AAAACCTGCCCAGTTTCACATGG - Intronic
1135660323 16:24291041-24291063 GTGACATGCCCAAGGTCACCTGG - Intronic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136397677 16:30001892-30001914 GAGACCTGCTCAAGGCCACGTGG - Intronic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1137571144 16:49567140-49567162 GAGACTTGCCAAAGATCACAAGG + Intronic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138526230 16:57608972-57608994 GAGACTTGCCCAAGGTCACCCGG + Intergenic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139919451 16:70450307-70450329 AAGACCTCCCCAATACCACAGGG + Intergenic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140884075 16:79227432-79227454 CTGACCTGGCCAAAGTCACAGGG - Intergenic
1140897988 16:79342143-79342165 GGGACTTGCCCAAAGTCACCCGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1142119928 16:88382254-88382276 GGAACCTGCCCAAGGCCACACGG - Intergenic
1142127925 16:88419425-88419447 AGAACCTGCCCAAGGTCACATGG - Intergenic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142782965 17:2195786-2195808 ATGACCTGCCCAATAACACAAGG + Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1142989619 17:3721647-3721669 GAGACCTCACAAATGTCACCTGG + Intronic
1143100677 17:4503139-4503161 GACACTTACCCAAGGTCACACGG + Intronic
1143352048 17:6295929-6295951 GAGACTTGCCTGAGGTCACAAGG - Intergenic
1143509145 17:7385925-7385947 GTGACTTGCCTAAAGTCACATGG + Intronic
1143610971 17:8017161-8017183 GACACTTTCCCAAGGTCACATGG - Intronic
1143885236 17:10060274-10060296 GAAGCCTGCCCAGTGTCACTCGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146287529 17:31584314-31584336 ATGACCTGTCCAAGGTCACATGG + Intergenic
1146931519 17:36781363-36781385 GCAACTTGCCCAAAGTCACACGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147217853 17:38911388-38911410 GGGACCTGCCCAAGGTCATCTGG - Intronic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1147950492 17:44105013-44105035 GAGACTTGTCCAAGGTCACCTGG + Intronic
1148126354 17:45239190-45239212 GAGGCCTATCCAAGGTCACACGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148383066 17:47214098-47214120 GTGACTTGCCCAGTCTCACATGG + Intronic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1148987670 17:51637738-51637760 GTGGGCTGCCCAAGGTCACAGGG + Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150286885 17:63959680-63959702 GTGCCTTGCCCACTGTCACAAGG - Intronic
1150296457 17:64011047-64011069 CAGACCAGCCCAATGTCTCTTGG + Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1150805116 17:68312652-68312674 GCCACCTGGCCACTGTCACAAGG - Intronic
1150889694 17:69133338-69133360 GAGAATTGCCCAATGTGAGATGG - Intronic
1151355055 17:73553433-73553455 AAGTCCTGCCCAAAGTCACTGGG + Intronic
1151904152 17:77036688-77036710 GAGAGATGCTCAAAGTCACATGG + Intergenic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157309300 18:46540166-46540188 GTAACTTGCCCAAAGTCACATGG + Intronic
1157323053 18:46648850-46648872 GAGACTGGGCCAAAGTCACACGG + Intronic
1157740958 18:50092384-50092406 GGGACAGGCCCAAGGTCACATGG + Intronic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1159052567 18:63435073-63435095 GTGACCTTCCCAAAGTCAAAAGG - Intergenic
1160340950 18:78088239-78088261 GTGACCTAACCTATGTCACAGGG - Intergenic
1160707345 19:535772-535794 AAGACCTGCCCCAGCTCACAAGG - Intronic
1161113433 19:2482699-2482721 GTGACTTGTCCAAAGTCACAAGG + Intergenic
1161479300 19:4502695-4502717 GGAACCTGTCCAAAGTCACACGG - Exonic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1162042618 19:7979760-7979782 CAGACCTGCCCCATGCCGCATGG - Intronic
1162477314 19:10908272-10908294 GAAACCTGCCCAAGGCTACATGG - Intronic
1162921729 19:13906851-13906873 GACATCTGCCCAAGGTCATAGGG + Intronic
1163559260 19:18009285-18009307 GACACTTGCCCAGAGTCACACGG - Intronic
1163703047 19:18796035-18796057 GGCACCTGCCAAAGGTCACACGG - Intergenic
1164847367 19:31445063-31445085 GAGAAATGCCTACTGTCACAGGG - Intergenic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166369818 19:42294466-42294488 GGGTCCTGCCCACAGTCACAGGG - Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1166889370 19:45981116-45981138 ATGACTTGCCCAAAGTCACAGGG - Intergenic
1166942343 19:46374471-46374493 GTCACTTGCCCAAAGTCACATGG + Intronic
1166997827 19:46728176-46728198 GTGACCTGCCCACTGCCCCACGG - Intronic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167126957 19:47556072-47556094 GTGACTTGCCCAAAGCCACATGG - Intergenic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
926001816 2:9339352-9339374 GGAACCTGCCCAGTGTCACAGGG - Intronic
926097832 2:10093982-10094004 GATACTTGCCCACAGTCACACGG + Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
926729862 2:16028394-16028416 GAGTACTGCCCAAGGCCACAAGG + Intergenic
926863156 2:17330249-17330271 GAGACTTGCCCAAAGTCACGAGG + Intergenic
927684336 2:25160444-25160466 GAGACTTGCCTAAGGTCCCATGG + Intergenic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928949340 2:36800509-36800531 GAGACCTGCGCAGTCACACAGGG - Intronic
929490048 2:42388020-42388042 GTGGCTTGCCCAATGTCACATGG - Intronic
929580055 2:43076317-43076339 GTGACCTGTCCAAAGCCACATGG - Intergenic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
929599912 2:43198522-43198544 AAGACCCGCCCAAGGTCACCCGG - Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930101952 2:47610359-47610381 GAGGCCTGCCCAATTTCAAGGGG + Intergenic
930333332 2:50014690-50014712 ATAACTTGCCCAATGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
931666313 2:64611900-64611922 GAAACCTGCCCAAAGCTACAGGG - Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932108246 2:68968922-68968944 TTGACCTGTCCAAGGTCACATGG - Intergenic
933150975 2:78914898-78914920 GAAACCTGTCCAAAGTCATATGG - Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933773842 2:85760018-85760040 TGGACCTGCCTAAGGTCACATGG + Intronic
934476432 2:94596541-94596563 GAGACCTGCCCAAGGCCAACTGG - Intronic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
935375176 2:102388343-102388365 GAAACTTGCCCAGGGTCACACGG + Intronic
935470217 2:103450414-103450436 GAGACCTTCCCAAAGACACATGG - Intergenic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
937442569 2:121929482-121929504 GTGACCTGCCCATTATCATATGG + Intergenic
938125501 2:128667975-128667997 GAGACCTGCCTTATGTCCTAAGG + Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938596787 2:132795226-132795248 GAGCTCTGCTCATTGTCACAGGG - Intronic
939272369 2:139956638-139956660 CTGACTTGCCCAAAGTCACACGG + Intergenic
939919688 2:148094045-148094067 GAGACATGCCCATGATCACATGG + Intronic
940006787 2:149015747-149015769 GTAACTTGCCCAATGTCACATGG - Intronic
940108000 2:150119811-150119833 GAGACCTGACAAATATCACAGGG - Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941653731 2:168121219-168121241 AGGACCTGCCCAAAGTCACATGG - Intronic
942276060 2:174325031-174325053 AAGGCCCGCCCAAGGTCACAGGG + Intergenic
942427015 2:175870875-175870897 GAGAACTGACTAAGGTCACATGG + Intergenic
942868593 2:180707400-180707422 GAAACCTGCCCAAGGTTACATGG + Intergenic
944104738 2:196068305-196068327 GAGATTTGTCCAAAGTCACATGG + Intronic
945622492 2:212158179-212158201 GCAACTTGCCCAAAGTCACATGG + Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
946567073 2:220978199-220978221 GAAACTTGCCCAAAGCCACATGG - Intergenic
947977569 2:234380262-234380284 TAGACCTGCTCACTGTCACCTGG + Intergenic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
948603661 2:239121468-239121490 GAGACCTCCCCACTGTTCCAAGG + Intronic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169304356 20:4475477-4475499 GTGAGCTGCCCAAGGTCACTAGG - Intergenic
1169794792 20:9450327-9450349 GAGACTTGACCAGAGTCACATGG + Intronic
1171086480 20:22242688-22242710 GTGACTTGTCCAAAGTCACATGG - Intergenic
1171092117 20:22295078-22295100 GAGACCTGGCTTATGTCACCAGG - Intergenic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172131755 20:32660611-32660633 GTGACTTGTCCAAAGTCACATGG + Intergenic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1172852017 20:37973230-37973252 GAGACTTTCCCAAGGCCACATGG + Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172906995 20:38377813-38377835 GTGACCTTCCCAAGGCCACATGG - Intergenic
1172973502 20:38890042-38890064 GTGACCTGCCTGAGGTCACATGG + Intronic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173432223 20:42998809-42998831 GTGACTTGCCCACTGTCATATGG + Intronic
1174039033 20:47686212-47686234 GGGACCTGCCCGCTGTCTCACGG - Intronic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174377822 20:50138265-50138287 AAGAACTCCCCAAGGTCACACGG + Intronic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174458215 20:50664586-50664608 GTGATTTGCCCAATGTCACACGG - Intronic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175692773 20:61077491-61077513 GAGGCTTGCCCAATGTCCCGTGG + Intergenic
1176168355 20:63686083-63686105 GTGACCTGCCCAGAGTCACCTGG + Intronic
1178465972 21:32847927-32847949 GAGACCTGCCCATGGTCACTGGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1180927480 22:19566365-19566387 GTAAACTGCCCAAGGTCACAGGG + Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181556858 22:23676125-23676147 GGGACCTGCCCAAAGCCACTCGG + Intergenic
1181697528 22:24601459-24601481 GGGACCTGCCCAAAGCCACTCGG - Intronic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1181920344 22:26315614-26315636 GAGCCCAGCCCAAAGTCACATGG - Intronic
1181935546 22:26435870-26435892 GTGACCTGCTCAAAGTCTCACGG - Intronic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182038449 22:27217545-27217567 AAGACTTGCCCAAGGTCACACGG - Intergenic
1182094846 22:27619200-27619222 GTAACTTGCCCAAAGTCACAAGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182145728 22:27995736-27995758 GTGACTTGCCCAAAGCCACATGG + Intronic
1182149797 22:28020033-28020055 GAGACCTGCACAAAGCCACCAGG + Intronic
1182442974 22:30374858-30374880 GTGAGCTGTCCAAGGTCACACGG - Exonic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183215814 22:36479234-36479256 GTGGCCTGCCCAAGGCCACAGGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1184101965 22:42345464-42345486 GTGACCTTGCCAAGGTCACAAGG + Intergenic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184499198 22:44861702-44861724 GAGACTTGCCCAAGGTCATGTGG - Intronic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
1184996899 22:48213910-48213932 GAGAGCTGCCCATCATCACAGGG - Intergenic
1185057102 22:48586859-48586881 GAGGCCTGCCCCATGTCCCCTGG + Intronic
1185078105 22:48694096-48694118 GAAGTCTGCCCAAGGTCACACGG - Intronic
1185109017 22:48890502-48890524 GAGATTTGCCCAGTGTCGCAGGG + Intergenic
1185138617 22:49088053-49088075 GCAAGCTGCCCAATGTCAAATGG - Intergenic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949951204 3:9230250-9230272 AACACTTGCCCAAAGTCACACGG + Intronic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950016049 3:9755876-9755898 GTGACCTGGCCAAAGTCACATGG - Intronic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950441678 3:13014380-13014402 GACATCTGTCCCATGTCACATGG + Intronic
950453979 3:13081781-13081803 AAGACCCGCCCAAGGTCACTGGG - Intergenic
950489384 3:13294405-13294427 GAGAGCTGCACACAGTCACAGGG + Intergenic
950523676 3:13510863-13510885 GTCACCTGTCCAAGGTCACATGG - Intergenic
950549387 3:13656935-13656957 GGGACTTGCCCAAAGCCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
951993612 3:28702872-28702894 GAAACTTGCCCAAAGTCACATGG - Intergenic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
952323757 3:32301854-32301876 GTGATTTACCCAATGTCACATGG - Intronic
952499214 3:33944020-33944042 GTAACTTGCCCAGTGTCACAAGG - Intergenic
952989834 3:38822026-38822048 GAGAGCAGCCCAATATCACTGGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953658888 3:44875978-44876000 GTAACCTGCCCAAAGCCACAGGG - Intronic
953788779 3:45930625-45930647 GAGACAACCCCAATGTCACTTGG - Intronic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
954805838 3:53219933-53219955 GAGCCCTGCCTAGTCTCACAGGG + Intergenic
954811045 3:53248220-53248242 GTGACTTGCCTAAAGTCACACGG + Intronic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955215441 3:56981707-56981729 AAGACCTGGCCAAGCTCACATGG + Intronic
955523026 3:59793470-59793492 CAGCCTTGCCCAAGGTCACATGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
955938534 3:64126555-64126577 GAAACCTGCCCACAGTCACATGG - Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956498472 3:69854820-69854842 TAGACCTGTCAAATGTCCCATGG + Intronic
957359819 3:79140395-79140417 GTAACTTGCCCAAAGTCACAGGG - Intronic
959995247 3:112673705-112673727 GTGATTTGCCCAATGTCATATGG + Intergenic
960360993 3:116710942-116710964 GAGTGCTTCCCAAGGTCACATGG + Intronic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
962062260 3:131942581-131942603 AAGAGCTGCCCAATGTCATGGGG - Intronic
962687766 3:137863636-137863658 GGGAACTGCCCCATCTCACAAGG + Intergenic
962963551 3:140333314-140333336 GTGACCGGCCAAAAGTCACAGGG - Intronic
963371254 3:144403399-144403421 GAGACCTGCCCTAGATCTCAGGG + Intergenic
966731063 3:183151803-183151825 GTTGCCTGCCCAGTGTCACAAGG + Intronic
967932051 3:194696998-194697020 GAAGCCTGCCCAAGGTCAAAGGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968044479 3:195616370-195616392 GAGACTTGGCCAGGGTCACAGGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968060268 3:195722421-195722443 GAGACTTGGCCAGGGTCACAGGG + Intronic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968116205 3:196091976-196091998 GTAACTTGCCCCATGTCACATGG + Intergenic
969166429 4:5319814-5319836 GAGCTCTGCCCAAAGTCACAGGG + Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969320690 4:6410660-6410682 TACACCTGCCTAATATCACAGGG + Intronic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969869088 4:10093654-10093676 GTGACCTGGCCCAGGTCACATGG - Intronic
970082435 4:12302433-12302455 GATTCCTATCCAATGTCACAGGG - Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
973207384 4:47575674-47575696 GAAACTTGCCCAAAGCCACATGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976092603 4:81473305-81473327 GTGACTGGCCCAATGTCATATGG - Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
978884928 4:113757545-113757567 GAAACTTGCCCAAAGTCACAAGG + Intronic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
981037603 4:140188442-140188464 AATATCTCCCCAATGTCACATGG - Intergenic
982050883 4:151500491-151500513 GACCCCTGCCCCATGTCACTTGG + Intronic
984508446 4:180650714-180650736 GAGACATACGCAATGTCACTGGG + Intergenic
984557021 4:181226592-181226614 GAGACCTGCCCCTGGTCAGAGGG + Intergenic
985170476 4:187143591-187143613 GAGACTTGCTGAATGTCACATGG + Intergenic
985188669 4:187346765-187346787 GTGACCTGGCCAGTGTAACAGGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
988897769 5:35696812-35696834 GAGGCCTGCCCGATGTCATAAGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990488120 5:56278918-56278940 GAGACCTCCTGAAGGTCACATGG - Intergenic
992663251 5:78982579-78982601 GAAACTTGCCCAAGGTTACAGGG - Intronic
995756242 5:115507475-115507497 GAAACGTGACCAAAGTCACAAGG - Intergenic
996786155 5:127238578-127238600 GTAACTTGCCCAAAGTCACACGG + Intergenic
997297144 5:132775530-132775552 ATAACCTGCCCAAGGTCACATGG + Intronic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997623880 5:135318767-135318789 GGGACCTGCCCAAGTTCATATGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
997815121 5:137009769-137009791 TAGACCTGCCCAAGGTCACAGGG - Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
998393759 5:141805017-141805039 GAGCTTTGCCCAAGGTCACAGGG - Intergenic
998526292 5:142846259-142846281 GAGACCTTTCCAAGGTCACATGG + Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999039943 5:148397777-148397799 TAAACCTGCAAAATGTCACATGG - Intronic
999041360 5:148416744-148416766 GAGATCTGCCCAACAGCACATGG - Intronic
999182354 5:149678725-149678747 GTGACTTGCCTAATGTCCCATGG - Intergenic
999319769 5:150606675-150606697 GTGACCTGCCCACAGTCACAAGG + Intronic
999437239 5:151572401-151572423 GAGACTTGCCCAAAGTCACAGGG + Intergenic
999534589 5:152503154-152503176 GAGACTTGCCCTAAGACACATGG - Intergenic
1000302215 5:159966429-159966451 GAAACTGGCCCAAGGTCACATGG + Intronic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001405769 5:171476238-171476260 CAGGCTTGCCCAAGGTCACATGG + Intergenic
1001798497 5:174522883-174522905 TGGACCAGCCCAAGGTCACATGG + Intergenic
1001936415 5:175708961-175708983 GAGACGTGCCCAAGGTCATACGG - Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1002409250 5:179060980-179061002 GTGACCTGCCCAAAGTCATAAGG - Intronic
1003391162 6:5714264-5714286 CAGACCTGCCCACTGTCCCCTGG - Intronic
1003833675 6:10043496-10043518 GTTACCTGCCCCATGTCACCAGG + Intronic
1004113587 6:12745858-12745880 GTGACTTGCCCAGTGTCACTTGG + Intronic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1006698475 6:35952056-35952078 GAGAGCTGCCCATAGTCTCAAGG + Intronic
1006929607 6:37679845-37679867 GACACCTGCCCATCATCACATGG + Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007753434 6:44083625-44083647 GCCACCTGCCCAACGTCACCCGG - Intergenic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008589891 6:52983550-52983572 GTGACCTGTCCAAGGTAACATGG - Intronic
1008605339 6:53134090-53134112 GAGACCTGCCATCTGTGACAAGG - Exonic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1011408819 6:87044388-87044410 GACAACTGCCCCATGTGACAAGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1013281746 6:108644194-108644216 GAAACCTGCCCAAGACCACATGG - Intronic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1015272680 6:131353509-131353531 GTGACTTGCCCAAAGCCACATGG - Intergenic
1015833052 6:137390102-137390124 AAGGCCTGCCCAATGTGACCAGG + Intergenic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018102894 6:160457032-160457054 AATAACTGCCCAACGTCACATGG + Intergenic
1018110866 6:160535807-160535829 AATAACTGCCCAATGTCACATGG + Intronic
1018124555 6:160669313-160669335 AATAACTGCCCAATGTCACATGG + Intergenic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020704437 7:11526419-11526441 GAGACATGCTCAATGTGCCAAGG - Intronic
1021157392 7:17227899-17227921 GTAACTTGCCCAATGTCACATGG + Intergenic
1022377683 7:29829698-29829720 GTGACCTGACCAAGGCCACACGG + Intronic
1024291131 7:47805191-47805213 GAAACTTGCCCAATGGCACATGG + Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028655289 7:93198388-93198410 GAGTCTTGCCCAAGGTCACTTGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1033445222 7:141415431-141415453 GAGACCTGTTGAAAGTCACAGGG + Intronic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034731145 7:153388570-153388592 GTAACTTGCCCAATATCACATGG + Intergenic
1035708329 8:1694694-1694716 GAGAGCTGCCCCAGGCCACACGG + Intronic
1036452087 8:8877759-8877781 GAGCCCAGCCCAATGACAAAGGG + Intronic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1039202835 8:35115814-35115836 GTGAGTTGCCCAGTGTCACAAGG - Intergenic
1039787257 8:40844862-40844884 GTGACTTGCATAATGTCACATGG + Intronic
1042543795 8:69932869-69932891 GAGATCTGGCCAATGACAAAGGG - Intergenic
1042846435 8:73173728-73173750 GTTACTTGCCCAAAGTCACAGGG - Intergenic
1044145613 8:88710152-88710174 GAGGCATGCCTGATGTCACAGGG - Intergenic
1044526950 8:93263048-93263070 GAAAACTTACCAATGTCACATGG - Intergenic
1044808424 8:96032503-96032525 GTGACAAGCCCAAGGTCACATGG + Intergenic
1046530899 8:115443614-115443636 TCAACCTGCCCAAGGTCACATGG - Intronic
1046640253 8:116721638-116721660 CAGAGCTGCCCAAAGCCACAGGG + Intronic
1047199521 8:122753487-122753509 GTAACTTACCCAATGTCACACGG + Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1047785782 8:128152741-128152763 GAGACATGGCCAACATCACAGGG + Intergenic
1047904968 8:129463152-129463174 GTAACTTGCCCAAAGTCACAGGG + Intergenic
1047942409 8:129838168-129838190 GAGACTTGCTCAAAGTCATACGG + Intergenic
1048255735 8:132903789-132903811 GGGACCAGCCCAAGGTCACCTGG - Intronic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048717879 8:137287936-137287958 GAGGTCTCCCCAAGGTCACATGG - Intergenic
1048857116 8:138694917-138694939 GAGAACTGCCCCTCGTCACAGGG + Intronic
1048871334 8:138801900-138801922 GAAACCTGCCCAAGGTCACACGG + Intronic
1048889794 8:138936903-138936925 GAGAACTCCCCAATGCCACCTGG + Intergenic
1048959630 8:139565183-139565205 GAGACCAGCACAAGGTTACAAGG - Intergenic
1049002349 8:139834030-139834052 ATGACTTGCCCAGTGTCACATGG - Intronic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1050236662 9:3588352-3588374 GAAATCTACCCAATATCACATGG + Intergenic
1050328089 9:4517010-4517032 GAAACTTGTCCAAAGTCACATGG - Intronic
1051147773 9:14047153-14047175 ATGACTTGCCCAATATCACATGG + Intergenic
1051441111 9:17084162-17084184 GTGACTTGCCCAATATCATATGG - Intergenic
1051941760 9:22514744-22514766 GTGACTTGCCCAGTGTCACTTGG + Intergenic
1052318677 9:27143847-27143869 GAAACCTGCCAGATGCCACATGG - Intronic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1055404104 9:75956369-75956391 GAAATCTGCCCAAGGCCACAGGG + Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056070535 9:82982213-82982235 GTGACATGTCCAAGGTCACAAGG + Exonic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1057880114 9:98786891-98786913 GGGACCTGCCCAGAGTCACTGGG - Intronic
1058054411 9:100435188-100435210 TTGACTTGCCCAAAGTCACACGG + Intronic
1058419276 9:104819215-104819237 GTGACTTTCCCAATGTCTCAGGG + Intronic
1059291429 9:113228113-113228135 GTGATTTGCCTAATGTCACATGG + Intronic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1059882044 9:118702010-118702032 GAGAGCAGCCCAATGTCCCTGGG - Intergenic
1059911134 9:119045538-119045560 GTGACTTTCCCAAAGTCACACGG + Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060204717 9:121675691-121675713 GTCACCAGCCCAAGGTCACAGGG - Intronic
1060207861 9:121693189-121693211 GGGACCTGCCCAGCGTCACCAGG - Intronic
1060730867 9:126036185-126036207 GTGACCTGCCCACGGTCACCTGG + Intergenic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061249411 9:129417674-129417696 GTGATCTGCCCAAGGTCACCTGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1062161936 9:135085428-135085450 AAGACCTGTCCAAGGTCATATGG - Intronic
1203459950 Un_GL000220v1:25807-25829 GATACCCGCCCAATGCCAAATGG + Intergenic
1186791663 X:13005484-13005506 ATGACCTGTCCAAAGTCACATGG - Intergenic
1186838372 X:13460202-13460224 GATACCTCCCCAAGCTCACACGG + Intergenic
1186968740 X:14816864-14816886 GAAACTTGCCCAAAGTCACAGGG - Intergenic
1187260540 X:17681623-17681645 ACGACTTGCACAATGTCACATGG + Intronic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1189462553 X:41253965-41253987 GAGATCTGTTCAAGGTCACAGGG + Intergenic
1189588805 X:42489931-42489953 GAAACTTGCCCAAAGTCACACGG - Intergenic
1190142976 X:47864278-47864300 GACATCAGCCCATTGTCACATGG + Intronic
1190171863 X:48117338-48117360 AAGACTTGCCCCAAGTCACATGG - Intergenic
1190261570 X:48801039-48801061 GCAACTTGCCCAAAGTCACATGG + Intergenic
1190391216 X:49933607-49933629 ATAACCTGCCCAAAGTCACATGG - Intronic
1190666401 X:52700232-52700254 AAGACTTGCCCCAAGTCACATGG + Intronic
1190673017 X:52758178-52758200 AAGACTTGCCCCAAGTCACATGG - Intronic
1190809449 X:53869332-53869354 GAGCCCTGCCCAATGTGAGTAGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1192126440 X:68504796-68504818 GTAACCTGCTCAGTGTCACATGG + Intronic
1192154498 X:68733735-68733757 GAGACGTGCCCAAGGTCACTAGG + Intergenic
1192240083 X:69321693-69321715 GTGGCATGCCCAAAGTCACATGG - Intergenic
1192316181 X:70053471-70053493 GAGACTTGCCCAGTGCCATACGG - Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1192598001 X:72431921-72431943 GGCATTTGCCCAATGTCACACGG + Intronic
1192709439 X:73564201-73564223 GCAACCTGACCAAGGTCACAGGG - Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193185126 X:78502473-78502495 GAGACTTGCCCCATGTCCCATGG - Intergenic
1194949305 X:100105891-100105913 GAAACTTGCCCAAAGCCACATGG + Intergenic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1195707444 X:107748211-107748233 AAGTCTTGCCCAAGGTCACACGG - Intronic
1196022254 X:111002717-111002739 GACACGTGCCCAAGGTCACACGG + Intronic
1197286906 X:124606462-124606484 AAGTCTTGTCCAATGTCACATGG - Intronic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198577041 X:138021917-138021939 GTGACTTGCCCAAAGTCATATGG - Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1200069599 X:153521412-153521434 GAGACAAGTCCAAGGTCACATGG + Intronic
1200248865 X:154541707-154541729 GGGATCTGCCCAAGGACACAAGG + Intronic