ID: 1181752235

View in Genome Browser
Species Human (GRCh38)
Location 22:24996838-24996860
Sequence CTGTCATAGCAGCTGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181752228_1181752235 17 Left 1181752228 22:24996798-24996820 CCCTCCTGGAAAAGGGTGTAACT 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG 0: 1
1: 0
2: 1
3: 47
4: 397
1181752229_1181752235 16 Left 1181752229 22:24996799-24996821 CCTCCTGGAAAAGGGTGTAACTG 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG 0: 1
1: 0
2: 1
3: 47
4: 397
1181752230_1181752235 13 Left 1181752230 22:24996802-24996824 CCTGGAAAAGGGTGTAACTGTAA 0: 1
1: 0
2: 2
3: 5
4: 130
Right 1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG 0: 1
1: 0
2: 1
3: 47
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181752235 Original CRISPR CTGTCATAGCAGCTGGGGGA TGG Intronic
900098798 1:952261-952283 CGGTCCTTGCAGGTGGGGGAAGG - Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900897886 1:5496510-5496532 CTGGCAGAGCAGATGGGAGAGGG + Intergenic
901645498 1:10714906-10714928 CTGGCATGGCTGCTTGGGGAGGG - Intronic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
902047671 1:13538101-13538123 CTGACATAACAGCTTGGGCAAGG + Intergenic
904681785 1:32234478-32234500 CTGTCATTGGAGTTTGGGGAAGG - Intergenic
905871009 1:41404628-41404650 CTGTGCTGGGAGCTGGGGGAGGG + Intergenic
906219460 1:44067734-44067756 CTGTCACAGCAACTGGGGCAGGG + Intergenic
906296257 1:44650815-44650837 CTGTCACAGAGGCTGGGGGCAGG - Exonic
906322988 1:44828141-44828163 CTGCCCCAGGAGCTGGGGGACGG - Exonic
906509340 1:46401997-46402019 ATGTCAGAGCTGCTGGGGCATGG + Intronic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
908248978 1:62250282-62250304 CTTTAATAACAGCTGGGGGCTGG - Intronic
909299176 1:73989564-73989586 CATTCATAGCAACTGAGGGATGG - Intergenic
910331041 1:86072517-86072539 GGGTCAGAGCACCTGGGGGAAGG + Intronic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912579088 1:110704298-110704320 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
912696753 1:111847929-111847951 CTGTCATGGGAGCTCAGGGAGGG - Intronic
913018615 1:114764404-114764426 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
914675875 1:149906884-149906906 CAGTCATAGCAGATGGGAGAGGG + Intronic
915724253 1:158006689-158006711 CGCTCAGAGCAGCTGGGGGCTGG + Intronic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
915942980 1:160130540-160130562 CTGGCACAGCAGCCCGGGGAGGG - Exonic
916625550 1:166552026-166552048 GGGTCAGAGCACCTGGGGGAAGG - Intergenic
917489212 1:175483390-175483412 CTGTAAGAGCAGGTGGGGCAGGG + Intronic
917513876 1:175690798-175690820 TTGTGATGGCAGCTGAGGGAAGG + Intronic
918303116 1:183221874-183221896 AAATCATAGCAGCTGCGGGATGG + Intronic
918752416 1:188289674-188289696 CTGTGAAAGCAGCTGGGAGGAGG - Intergenic
919422310 1:197385141-197385163 TTGTGATATGAGCTGGGGGAGGG - Intronic
920277680 1:204819546-204819568 CACTCACAGCAGCTGGGGGATGG + Intergenic
920653069 1:207853030-207853052 CGGTCAGTGCAGCTGGTGGAAGG + Intergenic
921263557 1:213404303-213404325 TATTCACAGCAGCTGGGGGATGG + Intergenic
921976379 1:221207430-221207452 GGGTCAGAGCACCTGGGGGAAGG + Intergenic
922969683 1:229725603-229725625 TTGTCTTAGCAGGTGAGGGAGGG - Intergenic
923989321 1:239417434-239417456 TTGTCATAGAAGCTGAGGAACGG + Intronic
924638777 1:245813390-245813412 CTGTGCTTGCACCTGGGGGAAGG - Intronic
1062806341 10:422620-422642 CTGGAATTGCAGCTGTGGGAGGG + Intronic
1064913297 10:20427264-20427286 CTGGCAAAGCAGTTGGGGGGAGG + Intergenic
1065002935 10:21353573-21353595 CTGACATAGCACCTAGGGTAGGG + Intergenic
1065900018 10:30198014-30198036 CTCTCATAGCAGCAGGGAGAAGG - Intergenic
1066098760 10:32098284-32098306 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1067044862 10:42979854-42979876 TTGTCATAGCAACTGAGGCAGGG - Intergenic
1070560398 10:77562183-77562205 GTGGCACAGCAGCTGGGGGCTGG - Intronic
1070804252 10:79261466-79261488 CTTCCAGAGCAGCTGGGGGAGGG - Intronic
1071035423 10:81238842-81238864 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1071738280 10:88326798-88326820 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1073225346 10:101913760-101913782 CAGTCATGGCAGCTCCGGGAAGG - Intronic
1074198126 10:111207280-111207302 CAGTGCTAGCAGCTGGGTGAAGG - Intergenic
1076630939 10:131851844-131851866 ATTTCATAGCAGCTGGGGACAGG + Intergenic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077058542 11:607707-607729 CTGCCATGGGAGCTGGGGGCTGG - Exonic
1077537439 11:3131199-3131221 CTGTCATTGGTGCTGGGAGAAGG - Intronic
1079517914 11:21290025-21290047 CGGACATAGCACCTGGGGGAAGG + Intronic
1079719043 11:23787427-23787449 CAGTCATAGCAGCTGGGATGGGG - Intergenic
1080047684 11:27826661-27826683 CTGTCACAGCAGCTGTGTGCCGG - Intergenic
1081421466 11:42877648-42877670 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1082955242 11:58863661-58863683 CTGGCCTAGAAGCTGGGGAATGG + Intronic
1083540418 11:63508270-63508292 GTGTCCTAGGAGCTGGGGAAAGG + Intronic
1083783062 11:64928055-64928077 CTCATATACCAGCTGGGGGAGGG - Exonic
1083961906 11:66019225-66019247 CTGTCCTTGAAGCTGGGGGGTGG - Intronic
1084082617 11:66838613-66838635 CTGTCCTAACATCTTGGGGAGGG - Intronic
1084211051 11:67622710-67622732 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1085041746 11:73330920-73330942 CTGGCACAGCAGGTGGGGGTGGG + Intronic
1085445691 11:76599283-76599305 GGTTCTTAGCAGCTGGGGGAGGG - Intergenic
1086669331 11:89527974-89527996 CTGTGAAAGCATCTGGGAGAGGG + Intergenic
1087908562 11:103726971-103726993 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1088307285 11:108423442-108423464 CTCACAGAGCACCTGGGGGAAGG + Intronic
1088694239 11:112353074-112353096 TGGTCATGGCAGCTGGGGAAGGG - Intergenic
1089299868 11:117492176-117492198 CTGTCATAGGAGGTAGAGGAGGG - Intronic
1089318305 11:117607089-117607111 GAGGCACAGCAGCTGGGGGAGGG + Intronic
1091203118 11:133797772-133797794 CTGGCGCAGCAGCTGCGGGAGGG + Intergenic
1091521471 12:1248386-1248408 CTGTGATAGATGATGGGGGAGGG + Intronic
1091710794 12:2738574-2738596 CTGCTATTGCAGCTGGGGGTGGG + Intergenic
1092358679 12:7817893-7817915 CTGCCATCGCAGCTGGGCGGGGG + Exonic
1092371818 12:7922883-7922905 CTGCCATCGCAGCTGGGCGGGGG + Exonic
1093333256 12:17868932-17868954 GTGACAGAGCACCTGGGGGAAGG + Intergenic
1093426495 12:19034247-19034269 CTTACATGGCAGCAGGGGGAAGG + Intergenic
1095406390 12:41871063-41871085 CGGACAGAGCACCTGGGGGAAGG + Intergenic
1095482370 12:42649789-42649811 CTGCCTTAGAAGCTGGGGCATGG + Intergenic
1097194059 12:57234164-57234186 CAGTGAGATCAGCTGGGGGAGGG - Intronic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1097445687 12:59668300-59668322 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1098772765 12:74575404-74575426 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1099543886 12:83951310-83951332 CTGTGATAGCATCTGGGGCAGGG - Intergenic
1101490218 12:105203173-105203195 CTGTCATGGAAGCTGGGGAGGGG + Intronic
1101593257 12:106140589-106140611 CTGTCATTGCTCCTGGGGAAGGG - Intergenic
1103264638 12:119618480-119618502 CTGTGAAAGCAGCTAGGGAAGGG + Intronic
1103437364 12:120937244-120937266 CACTCCTAGCAGCTGGGGAATGG - Intergenic
1103532943 12:121615043-121615065 CTGTCATAGCACCAAGAGGATGG + Intergenic
1103533725 12:121620429-121620451 GTGACATAGTAGCTGGGGAAAGG + Intergenic
1105022854 12:132828796-132828818 CTGCCAGAGCAGCAGGGTGAGGG - Intronic
1105737337 13:23285216-23285238 CTGGGACAGCACCTGGGGGAAGG - Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1108254547 13:48597960-48597982 CTATATTAGTAGCTGGGGGAGGG - Intergenic
1109218974 13:59621822-59621844 ATGTCAGAGCAAATGGGGGAAGG + Intergenic
1109954508 13:69548270-69548292 CTGTCACAGCAGGTGTGTGAAGG + Intergenic
1110826359 13:79975584-79975606 GGGTCAGAGCACCTGGGGGAAGG + Intergenic
1111635116 13:90893184-90893206 CCATCAGAGCACCTGGGGGAAGG + Intergenic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1116767714 14:49092432-49092454 CCAGCACAGCAGCTGGGGGATGG + Intergenic
1117172436 14:53114251-53114273 CGGACACAGCACCTGGGGGAAGG + Intronic
1117386900 14:55224196-55224218 AACTCATAGCAGCTGGGGGTTGG + Intergenic
1117643624 14:57827342-57827364 CTTTCACGGGAGCTGGGGGAGGG + Intronic
1117983397 14:61363866-61363888 GTGTCACAGAAGCTGGGGCAGGG + Intronic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118753557 14:68822899-68822921 CTGTGACAGCAGCAGGGGGTGGG - Intergenic
1119726485 14:76924716-76924738 CTGCCTTAGAGGCTGGGGGATGG + Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120591003 14:86373067-86373089 CTGTGAAAGCAGCTTGGAGAGGG + Intergenic
1120813712 14:88831179-88831201 CTGTCATGGCAGCTGGTGGGAGG - Intronic
1121411726 14:93753008-93753030 TGGTCATCGCAGCTGGGGGAGGG - Intronic
1122365571 14:101193117-101193139 CTTTCCTAGCAGATGGGGAAAGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1124368757 15:29091415-29091437 CTGTCTGAGCAGGTGAGGGAGGG + Intronic
1124483873 15:30099694-30099716 GTGCCACAGCAGCTGTGGGAGGG + Intergenic
1124490245 15:30151013-30151035 GTGCCACAGCAGCTGTGGGAGGG + Intergenic
1124519706 15:30397530-30397552 GTGCCACAGCAGCTGTGGGAGGG - Intergenic
1124538947 15:30568691-30568713 GTGCCACAGCAGCTGTGGGAGGG + Intergenic
1124721262 15:32112844-32112866 CTGTCTTTGCATCTGGGGGCCGG + Intronic
1124753288 15:32387316-32387338 GTGCCACAGCAGCTGTGGGAGGG - Intergenic
1124759702 15:32438881-32438903 GTGCCACAGCAGCTGTGGGAGGG - Intergenic
1124975028 15:34523016-34523038 GTGCCACAGCAGCTGTGGGAGGG - Intergenic
1126315143 15:47362129-47362151 CTCTCATAGAAGTTGGGGGTTGG + Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127289727 15:57559643-57559665 CTGACAATGCAGCTGGGGGTAGG - Intergenic
1127328638 15:57918233-57918255 TTGTCATGGCAGCTGGGAGGAGG - Intergenic
1127774724 15:62255833-62255855 CTGTCAAAGCAGCAGGTTGAAGG + Intergenic
1127856617 15:62958795-62958817 CACTCACAGCAGCTGGGGGCAGG + Intergenic
1129840233 15:78739275-78739297 ATGTCGCAGCAGCTGTGGGAGGG + Intergenic
1129955475 15:79632778-79632800 ATGTAATGGCATCTGGGGGAGGG + Intergenic
1130282636 15:82531796-82531818 GTGACACAGCAGCTGTGGGAGGG + Intergenic
1130964742 15:88688703-88688725 GTGTAAGAGCAGCTAGGGGACGG + Intergenic
1132185308 15:99798262-99798284 GTGCCACAGCAGCTGTGGGAGGG + Intergenic
1132431679 15:101766269-101766291 ATGCCACAGCAGCTGTGGGAGGG - Intergenic
1132811259 16:1798947-1798969 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1133712634 16:8415987-8416009 CTGTTGTCGCAGCTGGTGGATGG - Intergenic
1133730674 16:8576171-8576193 CAGTCATATGAGCTGGGAGAAGG - Intronic
1134212813 16:12292039-12292061 CTGTCAGATCTGCTGGTGGAGGG + Intronic
1134300648 16:12987588-12987610 CTGTCAGGGAAGCTGGGGGAGGG + Intronic
1136227251 16:28867176-28867198 CTGTGTTAGCAGCTGCGGGCAGG + Intronic
1138879317 16:60991522-60991544 CTGTCATGGGGGTTGGGGGAAGG - Intergenic
1140036588 16:71375985-71376007 ACTTCATAGCAGCTGAGGGATGG + Intronic
1140066812 16:71618453-71618475 GTGTCATCGTGGCTGGGGGATGG - Intergenic
1140404874 16:74702255-74702277 CACTCATAGCAGCTGCAGGATGG + Intergenic
1141306044 16:82865138-82865160 CTGTGAAAGCAGCTGGGAGTGGG - Intronic
1141513032 16:84524953-84524975 CTGTTATTGGAGCTGGGGTAAGG - Intronic
1142103239 16:88286583-88286605 TTGTCAGTGCAGGTGGGGGAGGG + Intergenic
1143566821 17:7727133-7727155 CTGTCAGCGCAGCTCGGGAAAGG - Exonic
1143635116 17:8159970-8159992 CTTACATACCAGCTGGGGGAGGG + Exonic
1143890196 17:10096960-10096982 CTGGCATAGCTGCAGGGTGAGGG - Intronic
1144281815 17:13734039-13734061 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
1147041710 17:37724361-37724383 CTGTCAGAACAGCTGGGGAGTGG - Intronic
1147834359 17:43319496-43319518 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1147951708 17:44111259-44111281 CTGAAATAGCAGTTGGGGGAGGG + Intronic
1147986119 17:44308649-44308671 CTGGCATCGCCGCCGGGGGAGGG + Exonic
1149029555 17:52067651-52067673 CTGTGAAAGCAGCTGGGAGGTGG + Intronic
1149578697 17:57732239-57732261 CTGGCAGATCAGCTGGGGGCTGG + Intergenic
1150174856 17:63042208-63042230 CAGTTATAGGATCTGGGGGAGGG + Intronic
1151301746 17:73232102-73232124 CGCTCATGGCAGCTGGCGGATGG + Exonic
1151358362 17:73573485-73573507 GGGTCCTAGCAGCTGGGTGAAGG - Intronic
1154055238 18:11006590-11006612 GTTTCATAGCAGATGCGGGAGGG - Intronic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155345548 18:24853324-24853346 CAGTGATGGCAGGTGGGGGAGGG + Intergenic
1155739140 18:29264811-29264833 CTGTCAGAGGAGGTAGGGGAGGG + Intergenic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1156166701 18:34429614-34429636 GGGACATAGCACCTGGGGGAAGG - Intergenic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158103085 18:53853032-53853054 CTATCCTGGCAGCTGGGGGATGG - Intergenic
1159891363 18:73956100-73956122 CTGGCATTGAAGATGGGGGAAGG - Intergenic
1160466607 18:79083012-79083034 GTGACAGAGCACCTGGGGGAAGG - Intronic
1160672804 19:374183-374205 ATGTGGTGGCAGCTGGGGGAGGG + Intronic
1160983603 19:1827614-1827636 CCGTCTTTGCAGCTGGGGGCAGG + Exonic
1161084800 19:2329939-2329961 CTGACAGAGCAGCTGGGGGTAGG - Intronic
1164265273 19:23610203-23610225 GGGTCAGAGCACCTGGGGGAGGG - Intronic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1164657045 19:29929638-29929660 CTATCCTAGCAGCTGTGAGATGG + Intronic
1165097503 19:33417585-33417607 CTGGCATAGCAGCCCTGGGAGGG - Intronic
1165393323 19:35550562-35550584 CTGCCACAGCAGGTGGGGGCAGG - Exonic
1165679925 19:37765383-37765405 TTGTCATATCAGATGGGAGAAGG + Intronic
1165848059 19:38831655-38831677 CTGTTATAGCAGATGTAGGACGG - Intronic
1168411620 19:56143806-56143828 ACGTCTTAGCAACTGGGGGAAGG + Intronic
925337803 2:3111436-3111458 GCGTCATGGCAGCTGGGGCAGGG - Intergenic
926526831 2:13991847-13991869 CTATGAAAGCAGCTGGGGGTCGG - Intergenic
926741485 2:16114953-16114975 ATGTCAGAGCAGCTGGAGGGGGG - Intergenic
926849109 2:17175222-17175244 CTAGCATAGCAGCTGGGACATGG - Intergenic
926958376 2:18327421-18327443 CTGTGATAGCTACTGGTGGACGG + Intronic
927341855 2:21992079-21992101 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
927405546 2:22762421-22762443 ATGTTATCCCAGCTGGGGGAAGG - Intergenic
927757486 2:25720592-25720614 TTCCCATAGAAGCTGGGGGAAGG + Intergenic
927875039 2:26649715-26649737 CAGTCAGGGCAGCTGGGAGAGGG - Intergenic
928625437 2:33134866-33134888 CTGTCAGAACAGCTGTGAGAAGG + Exonic
929666280 2:43836571-43836593 CGTTCTCAGCAGCTGGGGGATGG - Intronic
929824340 2:45298687-45298709 CTGTGAGAGCAGCTGTGAGAGGG + Intergenic
930095144 2:47561041-47561063 GTGTCATGGCTGCTGGGTGAAGG - Intronic
930176013 2:48302550-48302572 GTGACAGAGCAGCTGGGGGAAGG - Intergenic
930427796 2:51233925-51233947 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
932303657 2:70686383-70686405 AAGTGATAGCAGCTGAGGGAAGG + Intronic
933085160 2:78046391-78046413 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
933508069 2:83204004-83204026 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
936680100 2:114760167-114760189 TGCTCATAGCTGCTGGGGGATGG - Intronic
937792543 2:125977888-125977910 CAGCCACAGCAGCTGGGAGATGG - Intergenic
937888517 2:126916859-126916881 TCATCATAGCAGCTGGGGGTGGG - Intergenic
940565113 2:155351149-155351171 GGGTCAGAGCACCTGGGGGAAGG - Intergenic
940596127 2:155795470-155795492 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
943094920 2:183417134-183417156 GTGACAGAGCACCTGGGGGAAGG + Intergenic
943609424 2:190015000-190015022 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
943702656 2:191003616-191003638 CAGTCATAGCAGCAGGTGAAGGG - Intronic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
944853613 2:203744848-203744870 CAGTCATGGCAGAAGGGGGAAGG - Intergenic
944904213 2:204246211-204246233 CTGCCATAGTTGTTGGGGGAAGG + Intergenic
945344195 2:208693560-208693582 CTGACATACCAGCTGGGGGTAGG - Intronic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
948255296 2:236563960-236563982 CTGTGACAGCAGCTGGGGTGAGG + Intergenic
948401589 2:237689597-237689619 CTGCCACAACAGCTGTGGGAAGG - Intronic
1168956851 20:1840529-1840551 CTGTCACAGCATCCAGGGGAAGG + Intergenic
1169395299 20:5223812-5223834 CACTCACAGCAGCTGGGAGATGG - Intergenic
1169942477 20:10951997-10952019 CACTCACAGCAGCTGGGGAATGG + Intergenic
1170047543 20:12101219-12101241 CTCTCATAGCAGCTGGGGAATGG + Intergenic
1170797154 20:19558047-19558069 CTGCAATAGAAGATGGGGGAGGG + Intronic
1171078129 20:22149731-22149753 CTGTCATAGCATCTGGTGTCTGG - Intergenic
1172340681 20:34155098-34155120 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1173322922 20:42005426-42005448 GACTCACAGCAGCTGGGGGATGG + Intergenic
1173503787 20:43571622-43571644 ATGTTCTAGCAGCAGGGGGATGG + Intronic
1174523959 20:51156564-51156586 CTGTTGGACCAGCTGGGGGAAGG - Intergenic
1175802170 20:61807121-61807143 CTGGCCTTGCAGCTGGGGGCTGG - Intronic
1176934037 21:14845964-14845986 CTGTACTAGCAGCTGGGAGGGGG - Intergenic
1177284962 21:19037867-19037889 CTCTTACAGCAGCTGGGAGATGG - Intergenic
1177305066 21:19304762-19304784 CTGTAATAAAAGCTGGGGAAAGG + Intergenic
1179000436 21:37452635-37452657 CTGTCATAGGAGATGGGGAGGGG + Intronic
1179129425 21:38621445-38621467 CTCTCATGGCAGCGGGGAGATGG - Intronic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1182046229 22:27276255-27276277 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1182939437 22:34261023-34261045 GTGTCATGACAGCTGGGGGCTGG - Intergenic
1183335626 22:37244337-37244359 CTGGCAGAGCAGCTGGTGGGAGG + Intronic
1183857148 22:40642454-40642476 CACTCACAGCAGCTGGGGCATGG + Intergenic
1184300095 22:43553682-43553704 TTGCCATGGCAGCTGTGGGAGGG - Intronic
1184458756 22:44625623-44625645 CTGCCATAGGAGCTGGGGGTTGG - Intergenic
1185370983 22:50460790-50460812 CTGTCATGGCTGCGAGGGGAAGG - Intronic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950525221 3:13519206-13519228 GTGTCATAGGACCTGGGGGCAGG - Intergenic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
950924956 3:16731216-16731238 CGGACAGAGCACCTGGGGGAAGG + Intergenic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951538416 3:23760638-23760660 CTGCCAGAGCTGCTGGGGGAGGG - Intergenic
952212099 3:31238329-31238351 ATTTCATAGAAGCTTGGGGATGG + Intergenic
952504476 3:33995582-33995604 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
952790544 3:37197171-37197193 CATTCACAGCAGCTGGGGGATGG - Intergenic
954108799 3:48423025-48423047 CTACCAGAGCGGCTGGGGGAGGG - Intronic
954302651 3:49708383-49708405 CTGTCAGGGAAGCTGGGGAAGGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955189306 3:56745437-56745459 CTATCATAGGAGCTGAGGCAAGG + Exonic
956043993 3:65175700-65175722 TTTTCATAGCAGGTGAGGGAGGG + Intergenic
956823287 3:72973195-72973217 GTGTTCTACCAGCTGGGGGAGGG + Intronic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
958177995 3:90021606-90021628 CAATCCTAGCAGCTGGGGGATGG + Intergenic
958782548 3:98560102-98560124 GTGTCATGGGAGCAGGGGGAGGG + Intronic
960063715 3:113349194-113349216 CTCCCATAGCAGCTTGAGGAAGG - Intronic
960491592 3:118322219-118322241 GGGACATAGCACCTGGGGGAAGG - Intergenic
961865276 3:129949262-129949284 CACTCACAGCAGCTGGGGAATGG + Intergenic
962064427 3:131963768-131963790 GGGACAGAGCAGCTGGGGGAAGG + Intronic
962278529 3:134033219-134033241 CTGGCATGGCAGCAGTGGGATGG + Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
964425688 3:156551490-156551512 CTGGAATAGCAGCTGGTTGAGGG + Intronic
964718732 3:159750654-159750676 CACTCACAGCAGCTGGGGGTAGG + Intronic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
966621456 3:181968661-181968683 GTGTTATAGCTGCTGAGGGATGG + Intergenic
967874801 3:194260643-194260665 GGGTCACAGCAGCTGGGGAATGG - Intergenic
968690178 4:1986243-1986265 GTGCCACAGGAGCTGGGGGACGG + Intronic
969202668 4:5618217-5618239 CTGACACAGCTGCTGGTGGATGG + Intronic
969338831 4:6527902-6527924 CTGTCCCAGGAGCTGGGGAAGGG + Intronic
969623849 4:8292603-8292625 CTGTCAGGGGAGCTGGGGCAAGG + Intronic
970246541 4:14070398-14070420 CAGTAATAGCTGCTGGGAGAAGG + Intergenic
971172555 4:24248571-24248593 GTGTCATGGTCGCTGGGGGAGGG - Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972680849 4:41305634-41305656 CACTCACAGCAGCTGGGAGATGG - Intergenic
974269563 4:59633165-59633187 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
974943870 4:68503471-68503493 GGGACAGAGCAGCTGGGGGAAGG + Intergenic
975595814 4:76047491-76047513 CTCTCATAGCCGCTCGGGGAAGG + Intronic
975724258 4:77276678-77276700 GGGTCATAGTAGCTGGAGGATGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977723437 4:100267381-100267403 CGGACAGAGCACCTGGGGGAAGG - Intergenic
978083764 4:104624661-104624683 CACTCACAGCAGCTGTGGGATGG - Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
983949410 4:173622175-173622197 GGGACAGAGCAGCTGGGGGAAGG - Intergenic
985225072 4:187751316-187751338 CTGTGAAAGCAGCTGGGTGGGGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986798155 5:11232349-11232371 CTGTGAAAGCAGCTGGGAGTGGG + Intronic
987216531 5:15743534-15743556 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
988007727 5:25439244-25439266 CAGTCATTGCAGCTGGGTGTAGG - Intergenic
988738268 5:34044470-34044492 GAGTCAGAGCAGCTGGGGAAAGG + Intronic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
991223614 5:64243623-64243645 AGGACAGAGCAGCTGGGGGAAGG + Intronic
991510147 5:67367074-67367096 CTCTCATAGCACCTGGAGAAAGG - Intergenic
991963676 5:72070453-72070475 CTGTGCTTGCAGCTAGGGGAAGG - Intergenic
992676329 5:79109802-79109824 CTGCAACAGCAGCTGGGGAAAGG + Intronic
993911601 5:93690587-93690609 GGGACATAGCACCTGGGGGAAGG + Intronic
994005123 5:94828561-94828583 AGGTCAGAGCACCTGGGGGAAGG - Intronic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
995392356 5:111653173-111653195 CCGTGAAAGCAGCTGGGGGGAGG - Intergenic
996280687 5:121726316-121726338 GGGACAGAGCAGCTGGGGGAAGG - Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997526256 5:134555116-134555138 CTGGGGTGGCAGCTGGGGGAGGG - Intronic
998880197 5:146637723-146637745 CTAGAACAGCAGCTGGGGGAAGG - Intronic
998980602 5:147698025-147698047 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
999296266 5:150461367-150461389 CTGTAATTTCAGCTGGGGGCAGG + Intergenic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1000638074 5:163666391-163666413 CTGTCATGGCAGGTGGGGAGAGG - Intergenic
1003079185 6:3007232-3007254 TTGTCACAGCCGGTGGGGGAGGG - Intronic
1004785540 6:18963827-18963849 TACTCAGAGCAGCTGGGGGATGG - Intergenic
1005286298 6:24330710-24330732 CAGCCATAGCAACTGAGGGATGG + Intronic
1005499557 6:26418050-26418072 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1006806281 6:36791769-36791791 CTGGCATGGGAGCTAGGGGACGG + Intronic
1007337419 6:41163454-41163476 CGGGCATTGCAGCTGGTGGAGGG - Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1010835879 6:80586900-80586922 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1011001840 6:82598660-82598682 CTGTCATAGCAAGTGGGAAATGG + Intergenic
1011169411 6:84489372-84489394 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1011842642 6:91520734-91520756 TTGGCATAGCAAATGGGGGATGG + Intergenic
1013453042 6:110303698-110303720 GGGTCAGAGCACCTGGGGGAAGG + Intronic
1013910744 6:115272944-115272966 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1014143563 6:117971350-117971372 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1014193173 6:118521786-118521808 CTGTGGTAGCAGGTGGGGGCTGG - Intronic
1015203205 6:130605395-130605417 CTTTCATATCAGCTAGGGTAGGG - Intergenic
1015417793 6:132969407-132969429 CTGTCTTAGCATCTGGTGGTTGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016184042 6:141178844-141178866 CTTCCATAGCTGCTGGAGGAAGG - Intergenic
1016234201 6:141842814-141842836 CTCTTATAGCAGCTGTGGAAGGG + Intergenic
1018029171 6:159828420-159828442 CTGTGATGGAATCTGGGGGATGG + Intergenic
1018186483 6:161269519-161269541 CAGTCCCAGCTGCTGGGGGAGGG + Intronic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1018961549 6:168452947-168452969 CTGTCAGAGCCACTGGGAGAAGG - Intronic
1019286880 7:228091-228113 CCGTCAGAGCTGATGGGGGACGG + Exonic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020367189 7:7393561-7393583 CGGACAGAGCACCTGGGGGAAGG - Intronic
1020690277 7:11346484-11346506 CTTTCTTACCAGCTGGGGCAAGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022503020 7:30894341-30894363 CTGCCATAGCAGCAGTTGGAGGG - Intergenic
1023665605 7:42520034-42520056 CTTTCATAGCAGATGAGGAAGGG - Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029402670 7:100355541-100355563 CTGTCACTGCTGTTGGGGGAGGG + Intronic
1029405388 7:100371770-100371792 CTGTCACTGCTGTTGGGGGAGGG + Intronic
1030161922 7:106518141-106518163 GTGTCATAGAAGTTGTGGGAAGG - Intergenic
1030801383 7:113856803-113856825 GGGACAGAGCAGCTGGGGGAAGG + Intergenic
1031330074 7:120453265-120453287 CTCACACATCAGCTGGGGGAGGG - Intronic
1032326165 7:130930418-130930440 CTGTCAGTGCTGCTGGAGGAAGG - Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1033759242 7:144422244-144422266 CTCTCATAGCCGCTCGAGGAAGG + Intergenic
1034350060 7:150409652-150409674 ATGTGATAGGAGCTGGGGCAGGG + Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1034564736 7:151904253-151904275 CTGTCATAACATCTAGGGGTGGG - Intergenic
1035619185 8:1024524-1024546 CTGGCACAGCAGCTTGGGGGCGG + Intergenic
1036981533 8:13474584-13474606 CCGTGAAAGCAGCTGGGAGAGGG + Intronic
1037585884 8:20275654-20275676 CAGTCCTAGCAGCAGAGGGAGGG + Intronic
1037615700 8:20517215-20517237 CTGTCATGGGAGCAGGGGGAGGG + Intergenic
1037676500 8:21055676-21055698 TTGTCACAGCAGCTGCGGGAAGG - Intergenic
1038222521 8:25624269-25624291 GTGTCAAAGCAGCTGTGGGCTGG + Intergenic
1038638795 8:29307661-29307683 CTCTCATAGCTGCTCGAGGAAGG - Intergenic
1039107364 8:34003997-34004019 CTGTGAAAGCAACTGGGGTAAGG - Intergenic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041984782 8:63909129-63909151 CTGTGAAAGCAGCTGGGAGGTGG - Intergenic
1042407491 8:68422541-68422563 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
1042982402 8:74545070-74545092 CAGTTCTAGCAGCTGGGAGAAGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045394764 8:101749901-101749923 CTGGCATAGCAGCTGGATGGTGG + Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045611665 8:103849723-103849745 CACTTATAGCAGCTGCGGGAGGG + Intronic
1046106544 8:109673065-109673087 CGGACAGAGCACCTGGGGGAAGG + Intronic
1046718462 8:117592605-117592627 CTGTCAGATCAGCTGGGGCCTGG - Intergenic
1046738946 8:117808641-117808663 CTGTGATGGTAGCTGGGGGACGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1046972497 8:120238214-120238236 GTGACAGAGCACCTGGGGGAAGG - Intronic
1047160998 8:122379193-122379215 CTCTCATAGAAACTGGGAGATGG - Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048931033 8:139315505-139315527 CTGTCATAGCAGCAGGGGCCAGG + Intergenic
1049046563 8:140156764-140156786 CTGTCAGAGGAGCTGTGGAATGG + Intronic
1049312468 8:141940483-141940505 CTGTCAGAGCAGCTGGAGAGGGG - Intergenic
1049746206 8:144264355-144264377 AGGTCATAGAAGCTGGGGGTGGG + Exonic
1050575142 9:6987163-6987185 CTGAAATAGAAGCTGTGGGAAGG - Intronic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1052008909 9:23383092-23383114 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1052846355 9:33339955-33339977 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1053016132 9:34663314-34663336 CATTCAGAGAAGCTGGGGGAAGG + Intronic
1053515941 9:38730780-38730802 CTGAGATTGCAGCTGTGGGAGGG - Intergenic
1053545318 9:39017540-39017562 CTGTGACAGCATCTAGGGGAGGG + Intergenic
1053932622 9:43124100-43124122 CTGTAATACCAGCTGGGGTGGGG + Intergenic
1056879833 9:90380529-90380551 CTGTCCCATCAGCTGGGGGTGGG - Intergenic
1057035336 9:91807863-91807885 CTGTCAGATCAGCTTGGAGAGGG - Intronic
1057141550 9:92729544-92729566 GTGTGACAGCAGCTGGGGGCCGG + Intronic
1057207383 9:93181815-93181837 CCGTCTTAGCAGCAGGGAGATGG + Intergenic
1058916223 9:109568507-109568529 CTGGCAAAGCAGTTGGGGGGAGG - Intergenic
1058961507 9:109996653-109996675 CTGTCATAGCATCTGAGAGTGGG - Intronic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059799727 9:117738039-117738061 CTGACAGAGCAGCAGAGGGAAGG + Intergenic
1059928952 9:119241904-119241926 CAGTCAAAGCAGCTGGCAGAGGG + Intronic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1060583697 9:124772527-124772549 CTTTCGTAGCAGGTGAGGGACGG - Intergenic
1061631568 9:131875356-131875378 CTGTCATAGCAGCTGGGTCTTGG + Intronic
1061781487 9:132999056-132999078 CCTTCTTAGCAGCTGGGGCAGGG + Intergenic
1062128634 9:134880606-134880628 CTGTCATCCCTGCAGGGGGACGG - Intergenic
1186832555 X:13404785-13404807 CGGACAGAGCACCTGGGGGAAGG + Intergenic
1187200360 X:17128485-17128507 CACTCAGAGCAGCTGGGGGATGG + Intronic
1188947646 X:36326838-36326860 CTGACAATGCAACTGGGGGAAGG + Intronic
1189071253 X:37866373-37866395 CTGTGAAAGCAGCCGGGGGTTGG - Intronic
1189667514 X:43372772-43372794 CATTCATAGCAGCTGGAGAATGG - Intergenic
1191111971 X:56811361-56811383 GTGACAGAGCACCTGGGGGAAGG - Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193394521 X:80968136-80968158 GGGACAGAGCAGCTGGGGGAAGG + Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1194897535 X:99463342-99463364 CTGCAACAGCAGCTGGGGGTGGG + Intergenic
1195113045 X:101666281-101666303 CACTCACAGCAGCTAGGGGATGG + Intergenic
1195206990 X:102611102-102611124 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1197581950 X:128294572-128294594 CCGTGAAAGCAGCTGGGAGAAGG + Intergenic
1198274726 X:135089794-135089816 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1198320005 X:135511163-135511185 CATTCACAGCAGCTGTGGGATGG + Intergenic
1198441558 X:136668284-136668306 TTGTCATAGATGCTGAGGGAGGG - Intronic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1198882485 X:141296020-141296042 CAGTCAAAGCAGCTGGGAGCGGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199070361 X:143468840-143468862 CTGTGAAAGCAGCTGGGTGGGGG - Intergenic
1199258425 X:145744004-145744026 CTGCCACTGCTGCTGGGGGATGG - Intergenic
1199302076 X:146224424-146224446 CTGTCACAGTAGCTGGGTGCTGG + Intergenic
1199909700 X:152272210-152272232 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1200058559 X:153473986-153474008 CTATCCTTGCAGATGGGGGAAGG + Intronic
1200081578 X:153579367-153579389 CAGCCATGGGAGCTGGGGGATGG + Intronic
1200885639 Y:8266090-8266112 GTTTGATAGCAGCTGAGGGAAGG + Intergenic
1201059558 Y:10033882-10033904 TTCTCATAGCAGCTGGTGAAGGG - Intergenic
1201371435 Y:13269117-13269139 GGGACATAGCACCTGGGGGAAGG - Intronic
1201555734 Y:15263400-15263422 CTCTCATAGCCGCTTGAGGAAGG - Intergenic