ID: 1181754090

View in Genome Browser
Species Human (GRCh38)
Location 22:25010693-25010715
Sequence AACACGGAGCTTGGCACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181754090_1181754095 27 Left 1181754090 22:25010693-25010715 CCATTTGTGCCAAGCTCCGTGTT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1181754095 22:25010743-25010765 ATAGAAACCCAAACCAACAATGG No data
1181754090_1181754093 3 Left 1181754090 22:25010693-25010715 CCATTTGTGCCAAGCTCCGTGTT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1181754093 22:25010719-25010741 TAAGAATATTTTTGCCTGCATGG 0: 1
1: 0
2: 0
3: 22
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181754090 Original CRISPR AACACGGAGCTTGGCACAAA TGG (reversed) Intronic
900802198 1:4744280-4744302 ATCACAGAGCTTTACACAAACGG - Intronic
903693549 1:25191512-25191534 AACACAGTGCTTGGCGCAAGAGG - Intergenic
904074485 1:27829892-27829914 ATCACTGTGCTTGGCTCAAATGG - Intergenic
904081816 1:27877037-27877059 CACACGGAGCCTGGCACACATGG - Intronic
904273122 1:29363318-29363340 GACACAGAGCTGGGCCCAAATGG + Intergenic
905303033 1:36998585-36998607 AACACAGTGCTTGGCACATGGGG - Intronic
905788268 1:40775220-40775242 AGCACAGAGCCTGGCACCAAGGG + Intergenic
905867490 1:41383910-41383932 AACACAGAGCCTGGCACTAAAGG - Intergenic
906970159 1:50504873-50504895 AATTTGGAGCTTGTCACAAAAGG + Intronic
907317960 1:53584568-53584590 AGCACTGAACTTGGCACAAGGGG + Intronic
907677838 1:56535082-56535104 AACTCAGTGCTTGGCACATATGG - Intronic
908122505 1:60999570-60999592 ATCACAGAGCCTGGCACAAGAGG + Intronic
910523147 1:88146396-88146418 AACACGGTGCTTGCCACATAAGG + Intergenic
912527480 1:110294551-110294573 GACTCGGAGCTGGGCACAGAAGG - Intergenic
917488140 1:175474028-175474050 AACATGGATCTTTGCAAAAATGG - Intronic
917977085 1:180246886-180246908 AGCACGGTGCCTGGCACACAAGG - Intronic
924939757 1:248804821-248804843 AACACTGAGGTTAGCACACAAGG + Intergenic
1066465264 10:35644182-35644204 AACACAGAACTTGCCAAAAACGG - Intergenic
1069904109 10:71722361-71722383 AACAGGGAGCGAGGCACAGATGG + Intronic
1070718798 10:78742197-78742219 AGCACAGTGCTTGGCACACAGGG - Intergenic
1071231650 10:83594956-83594978 TACCCTGAGCTTTGCACAAAAGG + Intergenic
1072460770 10:95616693-95616715 AACACAGTGCTTAGCACAGAAGG - Intronic
1079177523 11:18156784-18156806 AACACTGAGATTGGAGCAAAGGG + Intronic
1079379158 11:19921845-19921867 AGCACTGTGCCTGGCACAAAGGG + Intronic
1080388473 11:31824003-31824025 AAGACGGAGCCTGGAAGAAAGGG + Intronic
1085273834 11:75285705-75285727 CACAAGGGGCCTGGCACAAAGGG + Intronic
1086174533 11:83874032-83874054 AGCACAGTGCTTGGCACATAAGG + Intronic
1088223989 11:107598971-107598993 AACACTGAGAAAGGCACAAAAGG + Intronic
1089883130 11:121794312-121794334 AAGACGGAGCTTGGTAGAAGAGG + Intergenic
1094066282 12:26363982-26364004 TGCACTGAGCTTGGAACAAATGG + Intronic
1097585477 12:61510657-61510679 AACACAGTGCTTGGCACATATGG + Intergenic
1100955371 12:99902298-99902320 AGAAAAGAGCTTGGCACAAAAGG + Intronic
1103025054 12:117567017-117567039 AGCACAGTGCTTGGCACACATGG - Intronic
1103118330 12:118357407-118357429 AACACGTGGCTTTCCACAAAAGG + Intronic
1106934849 13:34706403-34706425 ACCACAGAGCTTTGAACAAAAGG + Intergenic
1107613281 13:42138452-42138474 AACACAGTGCCTGGCACAGAGGG + Intronic
1111393972 13:87639106-87639128 AACACGTAACTTGTCAGAAATGG - Intergenic
1113371618 13:109730378-109730400 AAAACGGAGCTGGCCACCAAAGG + Intergenic
1114067191 14:19071367-19071389 AAGATGGAGCTTGGAGCAAATGG + Intergenic
1114095071 14:19328661-19328683 AAGATGGAGCTTGGAGCAAATGG - Intergenic
1117599300 14:57357811-57357833 AACACAGAATTTGGCAGAAAGGG + Intergenic
1117783436 14:59258127-59258149 AACACTGTGCTGGGCACTAAGGG - Intronic
1120849632 14:89158225-89158247 AACTCTGAGCTGGGCACAGAAGG + Exonic
1121420014 14:93806618-93806640 AAGACTGAGGTTGACACAAAAGG - Intergenic
1127539637 15:59924221-59924243 AACCCGGGGCTTGGCACAGGAGG - Intergenic
1128159377 15:65413438-65413460 AACACTGCCCTTGCCACAAAGGG + Intronic
1130049830 15:80474613-80474635 CACATAGTGCTTGGCACAAAAGG - Intronic
1130847654 15:87762213-87762235 ACCAGGGAGTTTGGCAAAAAGGG + Intergenic
1143018327 17:3903687-3903709 CACACAGAGCTTGGCACAGCAGG + Intronic
1147637920 17:41975196-41975218 AAGACTGAGCTGGGCACAGAAGG - Exonic
1148118227 17:45190578-45190600 AACACAGTGGCTGGCACAAATGG + Intergenic
1153041320 18:814992-815014 TCCACTGAGCTTGGCACAATAGG - Intergenic
1154129704 18:11726419-11726441 AGCACAGAGATTTGCACAAATGG - Intronic
1154231320 18:12558754-12558776 AACCCGGAGCTAGACACAGAGGG + Intronic
1155614476 18:27705102-27705124 AGCATGGAGCCTGGCACAGAGGG - Intergenic
1156039763 18:32807420-32807442 GACACTGTGCTAGGCACAAAAGG - Intergenic
1160713916 19:566436-566458 AAGACTGAGCGTGGAACAAAGGG + Intergenic
1163679486 19:18672430-18672452 AACACAGAGCCTGGCACCGACGG + Intergenic
1167526473 19:49987377-49987399 AGCAGGCAGCTGGGCACAAAAGG - Intronic
925129387 2:1483635-1483657 AGCACAGTGCTTGGCACCAATGG + Intronic
931016713 2:57990149-57990171 AACACAGAGCATAACACAAATGG + Intronic
931107278 2:59070223-59070245 AACATGGAGATTGGCACATGTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
935683080 2:105654712-105654734 AACACTAAGATTTGCACAAAAGG - Intergenic
936258718 2:110938448-110938470 AGCATGGTGCTTGGCACATATGG + Intronic
938484575 2:131691444-131691466 AAGATGGAGCTTGGAGCAAATGG + Intergenic
942061995 2:172235687-172235709 ATCACAAAGCTTTGCACAAACGG - Intergenic
943581010 2:189683575-189683597 AACACTAAGCTTGGAAGAAAGGG - Intronic
946226717 2:218267786-218267808 AATAGGGAGCTTGGCAAATATGG - Intronic
946917951 2:224545654-224545676 AACAGGGTGCTTGGCACTATGGG + Intronic
947523076 2:230863479-230863501 AACACAATGCTTGGCACACAGGG + Intergenic
1169396097 20:5230877-5230899 TGCATGGATCTTGGCACAAATGG + Intergenic
1173117093 20:40254864-40254886 AAAACGATGCTTGGCAGAAATGG - Intergenic
1173118689 20:40270135-40270157 AACACGGGACTTGCCACTAAGGG - Intergenic
1173163803 20:40671900-40671922 AACACAGTGCCTGGCACAGAGGG - Intergenic
1174365493 20:50053943-50053965 AGCACAGTGCCTGGCACAAAGGG - Intergenic
1177414576 21:20777260-20777282 AACAGGAAGCTTGGCTCAATCGG + Intergenic
1178230604 21:30780053-30780075 AACACAGAGACTGGCACTAAGGG + Intergenic
1179105890 21:38400031-38400053 AACACCACGCTTGGCACTAATGG + Intronic
1180485667 22:15793934-15793956 AAGATGGAGCTTGGAGCAAATGG + Intergenic
1180885335 22:19239575-19239597 ACCACCAAGCATGGCACAAAGGG + Intronic
1181539254 22:23564639-23564661 AACTCTGAGCATGGCAGAAACGG - Intergenic
1181754090 22:25010693-25010715 AACACGGAGCTTGGCACAAATGG - Intronic
1184355622 22:43977589-43977611 AACACAGAGCTCAGCACAGACGG - Intronic
950930539 3:16784625-16784647 AACAAGGTGCTTGGCAGAATGGG + Intergenic
953929939 3:47000850-47000872 AACAGTGAGCCTGGCACTAAGGG - Intronic
957149523 3:76468054-76468076 AACACAGAACTTGGCACATTAGG - Intronic
957568855 3:81919987-81920009 TACACGGAGCCATGCACAAAGGG - Intergenic
959903197 3:111682984-111683006 AACACAGTACCTGGCACAAAAGG - Intronic
961841468 3:129716755-129716777 AAAAGGGAGCTTGGCATGAATGG - Intronic
961946177 3:130691219-130691241 ATCACACAGCTTGGCACAGAAGG + Intronic
962167027 3:133060091-133060113 CACACAGTGCCTGGCACAAAAGG - Intronic
965398535 3:168189713-168189735 GACACGGAGGTTAGCACAAGAGG + Intergenic
968423861 4:507848-507870 AACAGAGAGAGTGGCACAAAAGG - Intronic
968498040 4:929241-929263 AACACTGCGCATGGCACACAAGG + Intronic
968814234 4:2813408-2813430 AGCACAGAGCTTGGCCCACAGGG + Intronic
973638849 4:52884257-52884279 AACAGGGAGGATGTCACAAAAGG + Intronic
974186905 4:58457654-58457676 AACCCGGAGCTAGACACAGAGGG - Intergenic
977083117 4:92558764-92558786 AGCACTGAGCTTTGCACCAAGGG + Intronic
982730436 4:158950484-158950506 AACATGGTGCTTGGCATAAATGG - Intronic
984872426 4:184338477-184338499 AACAGTGAGGTTGGCACAAGTGG + Intergenic
989275107 5:39579766-39579788 AAGACTGAGCTTGGACCAAAGGG + Intergenic
993463420 5:88214715-88214737 AACATGTAACTTGGCATAAATGG + Intronic
1000113025 5:158127305-158127327 AACACGGAGCAGGGCACAGCAGG - Intergenic
1007114086 6:39331001-39331023 GACGTGGAGCTTGGCAAAAAGGG - Exonic
1007291910 6:40793949-40793971 AACACAGTGCCTGGCACACATGG - Intergenic
1012552980 6:100481288-100481310 AATGCGTAGCCTGGCACAAAAGG - Intergenic
1015458376 6:133457255-133457277 AACTCCCAGCTGGGCACAAAGGG + Intronic
1017759209 6:157555281-157555303 GACACGGAGCTGGTCACAAATGG + Intronic
1020108927 7:5437024-5437046 AACACAGGGTTTGGCAGAAAAGG + Intronic
1024788981 7:52940910-52940932 ACCATGGAGCTGGGCAGAAAAGG - Intergenic
1025255757 7:57383078-57383100 AGCACAGGGCTTGGCACGAAGGG - Intergenic
1036096145 8:5726425-5726447 AGCACGGTGCTCGGCACAGAGGG - Intergenic
1040589390 8:48776382-48776404 AACATGGAGCTTGGGAAAAGAGG - Intergenic
1043855860 8:85263868-85263890 ATCACGGAGCTGAGCACAAAGGG - Intronic
1046592773 8:116225693-116225715 AACATGGAGGTTGGCCCAAAGGG - Intergenic
1047101329 8:121679400-121679422 GCCACGGAGCCTGGCCCAAAGGG + Intergenic
1052901750 9:33799398-33799420 AATACGAAGCTTAGGACAAAAGG + Intergenic
1053409522 9:37906530-37906552 AACTCAGTGCTTGGCAAAAAGGG + Intronic
1060190557 9:121589660-121589682 AGCCCAGAGCCTGGCACAAAAGG + Intronic
1060195039 9:121618013-121618035 AGCACTGAGCTGGCCACAAAAGG - Intronic
1061619063 9:131799126-131799148 AACATGGTGCCTGGCACAGACGG + Intergenic
1191672231 X:63758898-63758920 GACACTGCGCTGGGCACAAAGGG - Intronic
1191706483 X:64099533-64099555 AACACTGAGCTTGGTATTAATGG + Intergenic
1192938584 X:75887987-75888009 GACTCTGAGCTGGGCACAAAAGG - Intergenic
1195475326 X:105278538-105278560 AACTAGGAGCTTGGTACAGAGGG + Intronic
1198102876 X:133437104-133437126 AAGGCGGAGCTGGGAACAAAGGG + Intergenic
1198869266 X:141158566-141158588 AGCACAGAGCTTGGCATAAATGG + Intergenic