ID: 1181757397

View in Genome Browser
Species Human (GRCh38)
Location 22:25033976-25033998
Sequence GACTGTGATGGTGGTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 1, 2: 23, 3: 143, 4: 569}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181757397_1181757401 10 Left 1181757397 22:25033976-25033998 CCTGTGAAACCACCATCACAGTC 0: 1
1: 1
2: 23
3: 143
4: 569
Right 1181757401 22:25034009-25034031 ACATCTCCATCCCAGGCAAAAGG No data
1181757397_1181757400 3 Left 1181757397 22:25033976-25033998 CCTGTGAAACCACCATCACAGTC 0: 1
1: 1
2: 23
3: 143
4: 569
Right 1181757400 22:25034002-25034024 ATAGCGAACATCTCCATCCCAGG 0: 1
1: 0
2: 2
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181757397 Original CRISPR GACTGTGATGGTGGTTTCAC AGG (reversed) Intronic
900854352 1:5168898-5168920 CACTGTCCTGGTGGTTTTACAGG - Intergenic
900991829 1:6101661-6101683 GCCTGGGATGGTCATTTCACGGG - Intergenic
901452707 1:9345624-9345646 GACTATCATGCTGGTTTCCCAGG + Intronic
902035891 1:13457762-13457784 GACTGTGGTGATGATTTCATAGG + Intergenic
902194571 1:14788882-14788904 GATTCTGATGGTGGTGTCTCAGG - Intronic
902673050 1:17988422-17988444 GATTGTGGTGATGGTTTTACAGG - Intergenic
903124719 1:21239841-21239863 GACTGTGGTGATGGTTACATGGG + Intronic
903605727 1:24573838-24573860 GTCTGTGATGGTGTTTCCAGAGG + Intronic
903620996 1:24698232-24698254 CATTGTGTTGATGGTTTCACTGG - Intergenic
904156344 1:28486405-28486427 AATTGTGATGATGATTTCACAGG + Intronic
904298056 1:29536134-29536156 GATTGTGGTGATGGTTTCACAGG + Intergenic
905970542 1:42138616-42138638 GATTGTGGTGATGGTTTCACAGG - Intergenic
908231488 1:62109804-62109826 GAATGTGGTGATGGCTTCACAGG + Intronic
908344413 1:63217156-63217178 GATTGTAGTGATGGTTTCACAGG + Intergenic
909328639 1:74385303-74385325 GATTGAGATGGTGGTTTCACAGG + Intronic
909442221 1:75710155-75710177 GATTGTGGTGATGGTTTCACAGG + Intergenic
909744064 1:79070973-79070995 GATTGTGGTGATGGTTTCTCAGG + Intergenic
910211660 1:84799914-84799936 GATTGTGATGATGGTATTACAGG + Intergenic
911564501 1:99447442-99447464 GACTGTGATGATGGTTTCCCGGG + Intergenic
911826714 1:102495872-102495894 GACAATGGTGATGGTTTCACAGG + Intergenic
912138048 1:106685345-106685367 GAGTGTGATGATGGTATCATAGG - Intergenic
912660189 1:111520923-111520945 GACTGTGGTGATGGTTTCACAGG - Intronic
913041150 1:115025273-115025295 GATTGTGATGATGGTTTTACAGG - Intergenic
913578474 1:120201272-120201294 GATTGTGGTGATGATTTCACAGG - Intergenic
913598160 1:120397207-120397229 TATGGTGATGGTGGGTTCACTGG + Intergenic
913629698 1:120697079-120697101 GATTGTGGTGATGATTTCACAGG + Intergenic
914089170 1:144482113-144482135 TATGGTGATGGTGGGTTCACTGG - Intergenic
914220181 1:145674442-145674464 GTCTGTGAAGGTGGTTCCAGAGG + Intronic
914309442 1:146452102-146452124 TATGGTGATGGTGGGTTCACTGG + Intergenic
914472761 1:147997304-147997326 GTCTGTGAAGGTGGTTCCAGAGG + Intergenic
914560397 1:148812712-148812734 GATTGTGGTGATGATTTCACAGG - Intronic
914592669 1:149121035-149121057 TATGGTGATGGTGGGTTCACTGG - Intergenic
914612436 1:149317503-149317525 GATTGTGGTGATGATTTCACAGG + Intergenic
915181943 1:154069229-154069251 CACTCTGATGGTAGTTTCTCTGG - Intronic
915505433 1:156352971-156352993 TACTGGGATGGTGGTTTTGCTGG - Intronic
915590379 1:156867113-156867135 TGCTTTGATGGGGGTTTCACTGG - Intronic
916815422 1:168347137-168347159 GATGGTGATGATGGTTTCATGGG + Intergenic
916868993 1:168891845-168891867 AATTGTGGTGGTGGTTACACAGG + Intergenic
918089240 1:181274173-181274195 GACTGTGCTGGTGTTTACTCAGG - Intergenic
918432412 1:184475568-184475590 AGCTCTGATTGTGGTTTCACAGG - Intronic
918510965 1:185314194-185314216 GATGGTGATGGTGGTTTTAGAGG - Intronic
918794209 1:188872337-188872359 GATTGTGGTGATGGTTTCAATGG - Intergenic
918844293 1:189588774-189588796 GATTGTGTTGATGGTTTCACAGG + Intergenic
919133511 1:193480285-193480307 GATTGTGGTGATGGTTTCATGGG + Intergenic
919207665 1:194437751-194437773 GACTGTGTGAGTGGTTGCACTGG - Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
919602962 1:199645636-199645658 AATTGTCATGATGGTTTCACAGG + Intergenic
921001239 1:211045602-211045624 GATTGTGGTGATGGTTTCCCAGG - Intronic
921167439 1:212517126-212517148 TACTGTCATGGTCTTTTCACTGG + Intergenic
921533554 1:216315517-216315539 GACAGGGATGGTGATTACACAGG + Intronic
921685253 1:218082444-218082466 GATTGTGGTGTTGGTTTCAGGGG - Intergenic
922085818 1:222345844-222345866 GACTGTATTGTTGGTTTCATGGG - Intergenic
922118823 1:222642190-222642212 GGTTGTGATGATGGTTTCACAGG + Intronic
922386944 1:225095908-225095930 GATTGTGGTGATGATTTCACAGG + Intronic
923299367 1:232627492-232627514 GACTGGGATGGTGTTTTGAAGGG - Intergenic
924833091 1:247618334-247618356 GGTTGTGGTGGTGGTTTCATAGG + Intergenic
1062779922 10:193665-193687 AATTGAGATGGTGGTTGCACAGG - Intronic
1062796643 10:349581-349603 GACTGTCATGTTGGTTGCACAGG - Intronic
1063413026 10:5851355-5851377 GATTTTGGTGATGGTTTCACGGG - Intergenic
1063946691 10:11183047-11183069 GATTGTTGTGATGGTTTCACAGG - Intronic
1064201257 10:13286916-13286938 GATTGTGGTGATGATTTCACAGG + Intronic
1064272598 10:13879026-13879048 GATTGTGGTGATGGTTTCCCAGG + Intronic
1064749668 10:18514691-18514713 TACTGTAATGGTGTTTTAACAGG - Intronic
1064778829 10:18810657-18810679 GATTGTGGTGATGGTTTCACAGG - Intergenic
1065048657 10:21767676-21767698 GATTGTGATGTTGGTTACATAGG - Intronic
1065338079 10:24675487-24675509 GACTGTGGTGATGTTTTCACTGG + Intronic
1066299422 10:34083682-34083704 TACTGCAATGGTGATTTCACAGG + Intergenic
1067195493 10:44114427-44114449 GACAGTGATCATGGGTTCACTGG - Intergenic
1068193353 10:53683567-53683589 GACTGTGGTGATGGTATCATCGG - Intergenic
1069972621 10:72185726-72185748 GTTTGTGATGGTTGTTACACTGG + Intronic
1070083975 10:73216871-73216893 GATTGTGGTGATGGTTTCATGGG - Intronic
1070701731 10:78607134-78607156 CACTCTGATGGTGGTTTCTTTGG + Intergenic
1071308303 10:84319531-84319553 GATTGACATGGTGGTTTCATTGG - Intergenic
1071812779 10:89201241-89201263 GATTGTGGGGATGGTTTCACAGG - Intergenic
1071814773 10:89221126-89221148 GATTATGGTGATGGTTTCACAGG + Intronic
1071817678 10:89249808-89249830 GAATGTACTGATGGTTTCACAGG + Intronic
1071818826 10:89259960-89259982 CACTGTAGTGATGGTTTCACAGG + Intronic
1072259059 10:93649957-93649979 GATTGTGGTGCTGGTTTCCCAGG - Intronic
1072522879 10:96244533-96244555 GACTGTGACAGAGTTTTCACTGG - Intronic
1072813175 10:98479482-98479504 GTCTGCGATGGGGGTCTCACAGG - Intronic
1072865549 10:99057112-99057134 GACTGAGGTGGTGGTTACATAGG + Intronic
1073862140 10:107758564-107758586 GATTGTGGTGATGGTTTCACAGG - Intergenic
1073890332 10:108093463-108093485 GTTTGTGGTGGTAGTTTCACAGG + Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074159552 10:110826321-110826343 GATTGTGGTGATGGTCTCACAGG - Intronic
1074797897 10:116967515-116967537 GATGGTGGTGATGGTTTCACAGG - Intronic
1075231934 10:120687918-120687940 AACTTTGATGCTGTTTTCACAGG + Intergenic
1075516349 10:123111671-123111693 GATTGTGGTGGTGGTTACAAGGG + Intergenic
1076287979 10:129319832-129319854 GACTGTGGTGATGAATTCACAGG + Intergenic
1076349051 10:129802072-129802094 GACTGGGGTGTTGGTTACACAGG - Intergenic
1076437838 10:130458905-130458927 GACTGGGAGGATGGTTTCACAGG + Intergenic
1076805059 10:132851461-132851483 GAAGGTGGTGATGGTTTCACGGG - Intronic
1076938851 10:133586805-133586827 GATTGTGGTGATGGCTTCACTGG - Intergenic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1077649291 11:3955288-3955310 GATTGGGGTGGTGGTTACACAGG + Intronic
1077908652 11:6555782-6555804 GCCTGTGATGGTGGTGGCAGAGG + Intronic
1078051976 11:7973622-7973644 GACTGTGGTGGTGGATACATAGG + Intronic
1078371911 11:10754492-10754514 GATTGTGGTGATGGTTTCACAGG - Intronic
1078682395 11:13489136-13489158 CATTGTAATGGTGGCTTCACAGG - Intergenic
1078695171 11:13623980-13624002 CACTGTGATGGTAGTTTCTTTGG + Intergenic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1079461447 11:20682655-20682677 GATTGTGATGATGGCTGCACAGG - Intronic
1079530695 11:21448639-21448661 GATTGTGCTGATGGTTTCATGGG - Intronic
1079688880 11:23397814-23397836 GATTGTGGTGATGGTATCACAGG + Intergenic
1079914858 11:26356313-26356335 GATTGTGATTGTGGTTTCATGGG - Intronic
1079951043 11:26805087-26805109 GATTGTTGTGGTGGCTTCACAGG - Intergenic
1080148010 11:29012006-29012028 GACTGTAGTGGTAGTTTCACAGG - Intergenic
1080877233 11:36287875-36287897 GACTTTGGTGGTGGTTACATTGG + Intronic
1081979018 11:47254636-47254658 GTCTGAGATGGGGGTGTCACAGG + Intronic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1082886170 11:58085307-58085329 GATTGTGGTGATGGTCTCACAGG - Intronic
1083560300 11:63668275-63668297 GCCTGTGATGATGTTTTCTCTGG - Intronic
1083976821 11:66129020-66129042 GGCTATGATGGTGATTTCATGGG + Intronic
1084638873 11:70412369-70412391 GACTGTAATGGTGCGATCACAGG - Intronic
1084770501 11:71340022-71340044 CTCTGTGATGCTGGTTTCTCAGG + Intergenic
1084918058 11:72445917-72445939 GATTGTGGTGATGGTTTCAGAGG + Intergenic
1085004865 11:73077822-73077844 GCTTGTGATGCTAGTTTCACAGG + Intronic
1085500170 11:77014044-77014066 GATTGTGGTGGTGGTTTCATGGG + Intronic
1086253261 11:84843183-84843205 GATTATGGTGATGGTTTCACAGG + Intronic
1086340898 11:85847138-85847160 GATTGTGGTGGTGGTTACAAGGG - Intergenic
1086391347 11:86367476-86367498 GAATGTGGTAGTGATTTCACAGG - Intergenic
1086527479 11:87745068-87745090 GCCTGTGTTGGTGGCTTGACAGG + Intergenic
1086611163 11:88757612-88757634 GACTGTGTTTGTGGTTCCACTGG - Intronic
1086667913 11:89507232-89507254 GATTGTGGTGATGGTTTCATGGG + Intergenic
1087551839 11:99660403-99660425 TATTGTGGTGATGGTTTCACAGG + Intronic
1087856085 11:103092916-103092938 CATTGTGAGGGTAGTTTCACAGG - Intergenic
1088133051 11:106519243-106519265 GATTGTGATGATGGTTTCATGGG + Intergenic
1088563230 11:111136981-111137003 GCTTGTGGTGATGGTTTCACAGG - Intergenic
1091555744 12:1572315-1572337 GACTGTGGTGCTGGTTTCATGGG - Intronic
1093097947 12:14993718-14993740 GTCTGTGAGGGTGCTTCCACAGG + Intergenic
1094112776 12:26879111-26879133 GAATGTGTTGGTGTTTTCTCAGG - Intergenic
1094123745 12:27000794-27000816 GATTGTGGTAATGGTTTCACAGG - Intronic
1094439177 12:30456225-30456247 GACAGTGGTGATGGTTTCATAGG - Intergenic
1094454034 12:30612341-30612363 GATTGTGGTGGTGGTTTCATGGG + Intergenic
1095149395 12:38773389-38773411 GATTGTGGTGATGGTTTCATGGG + Intronic
1095263226 12:40122520-40122542 GATAGTAATGATGGTTTCACAGG + Intergenic
1095434754 12:42175442-42175464 GATTGTGGTGATAGTTTCACAGG + Intronic
1095755779 12:45765755-45765777 GACTGTGTTAATAGTTTCACAGG - Intronic
1096391443 12:51232236-51232258 GATTGTGGTGATGGTTTCATGGG - Intergenic
1096972639 12:55680165-55680187 GACTGTGGTAATGGTTTCCCAGG + Intergenic
1097204696 12:57310705-57310727 GATTGGGGTGATGGTTTCACAGG - Intronic
1099090407 12:78299733-78299755 GACTGTAGTGATGGTATCACAGG + Intergenic
1099653742 12:85462358-85462380 GACTGTGGTGATGGTTTCATGGG + Intergenic
1099870026 12:88335930-88335952 GATTGTGGTTGTGGTTTCATTGG - Intergenic
1100133753 12:91528406-91528428 GACTGTGGTGCTGGTTTAATGGG - Intergenic
1100385648 12:94102448-94102470 CACGGCGATGCTGGTTTCACTGG + Intergenic
1100523776 12:95401301-95401323 GATTGTGGTGATGGTTTCATGGG - Intergenic
1100894679 12:99168114-99168136 GATTGTGGTGATGGTTTCACAGG + Intronic
1100995789 12:100299428-100299450 GATCGTGGTGATGGTTTCACAGG - Intronic
1101626743 12:106451202-106451224 GACTATAGTGGTGGTTTCACAGG + Intronic
1101853908 12:108426407-108426429 GAGTGTGCTGGTGGCTTCAGAGG + Intergenic
1102200207 12:111052881-111052903 CACTGTGATGGAGGTGACACGGG + Intronic
1102359087 12:112268210-112268232 GATTGTGGTGATGGTTTCATTGG - Intronic
1102690832 12:114759505-114759527 GAATGTGATGGTGGTAGCACGGG + Intergenic
1102906610 12:116680995-116681017 GATTGTGGTGGTGGTTTCACAGG + Intergenic
1103450647 12:121026329-121026351 TACTGTGATGTTGCTTACACAGG + Intronic
1103836567 12:123825724-123825746 GATTGTGGTGGTGCTTTCACAGG + Intronic
1103948416 12:124539506-124539528 GACTGAGCTGGTGGCTTCAGAGG - Intronic
1103972505 12:124680947-124680969 GACTGTGCTGGGGGATTTACAGG - Intergenic
1104792145 12:131490051-131490073 GATTGTGATGATGGTTACATGGG + Intergenic
1105648188 13:22343870-22343892 GATTGTGTTGGTGGATTCAAAGG + Intergenic
1105912111 13:24878779-24878801 GTCTGTGAGGGTGTTTTCAGAGG - Intronic
1106214885 13:27687842-27687864 GATTATGGTGATGGTTTCACAGG + Intergenic
1106318170 13:28613603-28613625 GATTGTGGAGGTGGTTTCAATGG - Intergenic
1107369775 13:39732123-39732145 GTCTGTGAGGGTGTTTCCACAGG - Intronic
1107681044 13:42850969-42850991 GATTGTGGTGATGGTTTCATGGG - Intergenic
1107767404 13:43751448-43751470 GATTGTGATGATGGTTTCACAGG - Intronic
1108132538 13:47318273-47318295 GAATGTGGTGATGGTTTCACAGG - Intergenic
1108334973 13:49431089-49431111 TGATGTGATGATGGTTTCACAGG - Intronic
1108780803 13:53829726-53829748 GACTATAGGGGTGGTTTCACAGG + Intergenic
1109069493 13:57746723-57746745 GACTGTGAGGATGTTTTCAGAGG + Intergenic
1109487075 13:63039652-63039674 GATTGTGCCGATGGTTTCACAGG - Intergenic
1109989027 13:70029227-70029249 GAATGTTAGGGTGTTTTCACTGG + Intronic
1110024445 13:70517388-70517410 CATTGTGATGATGATTTCACAGG + Intergenic
1110514404 13:76392786-76392808 GATTGTTATGATGGTTTCATGGG + Intergenic
1110745146 13:79043642-79043664 GATTGTGGTGATGGTTTCACTGG + Intergenic
1110762842 13:79249744-79249766 GATTGTGGTGATGGTTTCATGGG + Intergenic
1110802843 13:79720068-79720090 AATTATGATGCTGGTTTCACAGG - Intergenic
1111247568 13:85560743-85560765 GATTGTGATGATGATTTCACAGG - Intergenic
1111450710 13:88411346-88411368 GATTGTGTTTGTGGTTTTACAGG - Intergenic
1111928913 13:94493480-94493502 GAGTGTGATGATGGTTTCACTGG + Intergenic
1111981242 13:95017679-95017701 GAATGTGGTGATGGTTTCATAGG + Intergenic
1112542306 13:100327142-100327164 GGCTGTGGTAATGGTTTCACAGG - Intronic
1112731842 13:102371487-102371509 TAGTCTGATGGAGGTTTCACTGG - Intronic
1113100614 13:106713584-106713606 TAGTGTGATAGTGGTTTTACTGG + Intergenic
1113125094 13:106969168-106969190 GCCAGTTATGGTTGTTTCACTGG + Intergenic
1113598499 13:111551328-111551350 GGCTGTGATGCTGGTTTCTAAGG + Intergenic
1113829417 13:113283410-113283432 GATTGGGGTGGTGGTTTCATGGG + Intergenic
1113915191 13:113866427-113866449 GATTGTGATGATGGCTTCACAGG - Intergenic
1114651290 14:24286232-24286254 GACTGTGGTGGTGGTATCCCTGG - Intergenic
1114824503 14:26060567-26060589 GAATGTGATTGAGGTTTCAGTGG - Intergenic
1115173228 14:30531958-30531980 GATTGCGGTGGTGGTTTTACAGG + Intergenic
1115804858 14:37039334-37039356 AATTGTGATGATGTTTTCACAGG - Intronic
1116310683 14:43322481-43322503 GATTGTGGTGGTGGTTTCATAGG + Intergenic
1116400645 14:44502573-44502595 CATTGTGGTGATGGTTTCACAGG + Intergenic
1117669790 14:58094856-58094878 GATTGTGATGGGGGTTGCATGGG + Intronic
1117709542 14:58511049-58511071 GATTGTGGTGATGGTTTCATGGG + Intronic
1117868006 14:60169558-60169580 GATTGTGGTGATGGTTTCACAGG - Intronic
1118424193 14:65641090-65641112 GATTGTGGTGATGGTTTCATGGG - Intronic
1118583297 14:67326547-67326569 GATTGGCATGGTGGTTACACAGG - Intronic
1119142747 14:72282681-72282703 GATTGTGATGATAGTTTCACAGG - Intronic
1119160135 14:72445578-72445600 GATTGTGATGATGTTTTCAAGGG + Intronic
1119275003 14:73347369-73347391 GATTGTGGTGATGGTTTCTCAGG - Intronic
1119364006 14:74076113-74076135 GATTGTGATGCTATTTTCACAGG + Intronic
1119656889 14:76423655-76423677 AACTGTAATGGTTGTTTGACTGG + Intronic
1119834554 14:77736671-77736693 GCTTGTGATGATGATTTCACAGG - Intronic
1120033948 14:79674347-79674369 GACTGTGTTGAAGGTATCACAGG - Intronic
1120278625 14:82410564-82410586 GATGGTGGTGATGGTTTCACAGG - Intergenic
1120875891 14:89375172-89375194 GACAGTAATGGTGGTTACAGAGG + Intronic
1121167703 14:91823030-91823052 GACTGTGGTGATGGTTTCATAGG + Intronic
1121293614 14:92797925-92797947 GGTTTTGATGGTGGTTACACTGG - Exonic
1123067120 14:105624318-105624340 GACTGTGATGGTTCTTTCCACGG - Intergenic
1123071142 14:105643045-105643067 GACTGTGATGGTTCTTTCCGTGG - Intergenic
1123076102 14:105668087-105668109 GACTGTGATGGTTCTTTCCACGG - Intergenic
1123090803 14:105741315-105741337 GACTGTGATGGTTCTTTCCACGG - Intergenic
1123096438 14:105769079-105769101 GACTGTGATGGTTCTTTCCACGG - Intergenic
1124215395 15:27803996-27804018 GATTGTGGTGACGGTTTCACAGG + Intronic
1125009884 15:34859783-34859805 GACTGTGCTGATGGCTTCACAGG + Intronic
1125088246 15:35757696-35757718 AACTCTGAGGGTGGTTTCACAGG - Intergenic
1125526420 15:40378412-40378434 AATTGTGGTGATGGTTTCACAGG + Intergenic
1126145197 15:45467277-45467299 GATTGTGGTGATGGTTTCACAGG - Intergenic
1126513223 15:49503458-49503480 CACTGTGATGGTAGTTTCTTTGG - Intronic
1127183177 15:56447730-56447752 GATTGTGGTGATGGTTTCACAGG - Intronic
1127444867 15:59050680-59050702 GATTGTAATGATGGTTTTACAGG - Intronic
1128387354 15:67159571-67159593 TACTGCTATGGTGGTTTCATAGG - Intronic
1128873267 15:71180487-71180509 GATTGTGGTGGTGGTTTCAGGGG + Intronic
1128964414 15:72043760-72043782 GACTGTGGTGGTGGTTTCATGGG + Intronic
1129498246 15:76008051-76008073 GATGGTGGTGGTGATTTCACAGG + Intronic
1129779168 15:78258352-78258374 GATTAAGATGGTGGTTTCATGGG + Intergenic
1129800615 15:78411061-78411083 GACTCTGATGATGGTTTCATGGG - Intergenic
1130524147 15:84689317-84689339 GATTGTGATGATGGTTTCACAGG + Intronic
1130885307 15:88087697-88087719 GACAGTGGTGGCGATTTCACTGG + Intronic
1131256607 15:90867005-90867027 GATTGTGGTGATGGTTTCATGGG - Intergenic
1131794608 15:96002445-96002467 TACTGTGATGATGGTTTAAATGG - Intergenic
1132207557 15:99997032-99997054 GGCTGGGAAGGTGGTTTCAAAGG - Intronic
1133470745 16:6072884-6072906 GATTGTGGGGATGGTTTCACAGG + Intronic
1134272755 16:12747755-12747777 TATTGTGATTGTAGTTTCACAGG + Intronic
1134904295 16:17966805-17966827 GACTGTGATGGTGGTGACCCTGG + Intergenic
1135200704 16:20435558-20435580 GACTGTGGTGGCAGTTACACAGG - Intronic
1137901127 16:52270737-52270759 GATTGTGGTGATGCTTTCACAGG - Intergenic
1138846263 16:60570664-60570686 GATTGTAGTGATGGTTTCACAGG + Intergenic
1139389608 16:66598512-66598534 GATTGGGGTGGTGGTTACACAGG - Intergenic
1139668612 16:68475764-68475786 GATTGTGGTGGTGGTTTCACAGG - Intergenic
1140176010 16:72660737-72660759 GATTGTGGTGATGGTTTCATGGG + Intergenic
1140318577 16:73924280-73924302 GATTGTGGTGGTAGTTTCACTGG - Intergenic
1140732266 16:77867263-77867285 GACGGTGATGAGGGTTTCACAGG + Intronic
1141074910 16:80995829-80995851 GACTGTGATGGTGGTTGCATGGG + Intronic
1141270224 16:82532891-82532913 GATTGTGATCATGGTTTCATGGG - Intergenic
1141299879 16:82804380-82804402 GATTGTGGTGATGGTATCACAGG + Intronic
1143243146 17:5461200-5461222 AACTGTGATGGGGGTGGCACAGG - Intronic
1143752532 17:9039583-9039605 GATTGTGGTGATGGTTTCACAGG - Intronic
1143927706 17:10387243-10387265 GATTGAGATGATGGTTTCACAGG - Intergenic
1144002572 17:11069384-11069406 GACTGTGGTGATGGTATCACAGG - Intergenic
1144601055 17:16613936-16613958 GATTGTGGTGGTGGCTACACAGG + Intergenic
1146103648 17:30010763-30010785 CACTTTGATGGTAGTTTCTCTGG + Intronic
1147299567 17:39514802-39514824 GGCTGTGTTGATGGTTTTACTGG - Intronic
1148430652 17:47640762-47640784 GACTGTGGTAGTGGTAGCACAGG + Intergenic
1148637582 17:49160470-49160492 GCCTGTCATGGTGGCTTCCCGGG + Intronic
1150727042 17:67659838-67659860 GATTGTGGTGATGGTTTCACAGG - Intronic
1151022483 17:70633503-70633525 GATTGTGATGATGGTTTTACAGG - Intergenic
1151056759 17:71040966-71040988 GATTTTGGTAGTGGTTTCACAGG + Intergenic
1152146471 17:78571725-78571747 GTCGATGATGGTGGTTTCAATGG + Exonic
1152165540 17:78702604-78702626 GGCTGTGATGGTTGTTTTACAGG - Exonic
1152171854 17:78755994-78756016 TATTGTGATAGTGGTTTCACTGG + Intronic
1152324001 17:79625070-79625092 GATGGTGGTGATGGTTTCACGGG - Intergenic
1152522727 17:80869000-80869022 GACTGTGGCGGTAGCTTCACAGG + Intronic
1153098199 18:1433877-1433899 GATTGTGGTGGTGCTTTCACAGG + Intergenic
1153221923 18:2869367-2869389 GATTGTGATGTTGGTTTCACGGG - Intronic
1153607759 18:6851970-6851992 GACTGTGGTGATGGTTTCATAGG + Intronic
1153752185 18:8244109-8244131 GACTGTGATGGTGAACTCAATGG + Exonic
1154039760 18:10842726-10842748 GATTGTGATGATGGTTTCAATGG + Intronic
1154299311 18:13179197-13179219 GATTGTGGTGATGGTTTCACTGG - Intergenic
1154299485 18:13180641-13180663 GATTATGGTGATGGTTTCACAGG - Intergenic
1155199744 18:23506278-23506300 GATTGTGGTGATGGTTTCATGGG - Intronic
1155457048 18:26028825-26028847 GATTCTGCTGATGGTTTCACAGG + Intronic
1156206521 18:34892047-34892069 GATTGTGGTGATGGTTTCACAGG + Intergenic
1156678720 18:39563616-39563638 GACTGTGGTAATGGCTTCACAGG + Intergenic
1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG + Exonic
1158209357 18:55029640-55029662 GATTGTGGTGATGGTTTCATGGG + Intergenic
1158425105 18:57332553-57332575 GATTGGGATTGTGGTTTCACAGG + Intergenic
1158459959 18:57637619-57637641 AATTGTGGTGATGGTTTCACAGG - Intergenic
1158749029 18:60237193-60237215 GATTGTGATGATTGTTTCACAGG - Intergenic
1158858236 18:61565649-61565671 GACTGTGGCGGTGGTTTCATGGG - Intergenic
1158961729 18:62593425-62593447 GATTGTGGTAATGGTTTCACAGG + Intergenic
1158982351 18:62775766-62775788 GACTGTGGTGGTGGTTTCACAGG - Intronic
1159682014 18:71366777-71366799 GACTGTGATGTTGGTTTTGAGGG + Intergenic
1160132537 18:76239495-76239517 GACAGTGATGATAGTTTCACAGG + Intergenic
1160327009 18:77959236-77959258 CACTGGGATTGTGCTTTCACTGG + Intergenic
1160533610 18:79579293-79579315 GTCTGTGATGGTGGTCTCCCAGG + Intergenic
1161926924 19:7307760-7307782 GATGGTGGTGGTGTTTTCACAGG + Intergenic
1162416715 19:10542994-10543016 AACTGTAATAGTGGCTTCACAGG - Intergenic
1164450549 19:28359378-28359400 GACTCTGATGGTTGTTTCCTTGG + Intergenic
1164452379 19:28377973-28377995 GATGGTGGTGATGGTTTCACAGG - Intergenic
1164980451 19:32609734-32609756 GATGGTGGTGATGGTTTCACAGG + Intronic
1165290805 19:34883835-34883857 GTCTGTGAGGGTGTTTCCACAGG + Intergenic
1165440730 19:35825471-35825493 GATTGTGGTGGTGGTTGCACGGG - Intergenic
1166061081 19:40326176-40326198 GACAGTGATGGTGGCTGCAGAGG - Intronic
1166514306 19:43434574-43434596 GGTTGTGGTGATGGTTTCACAGG + Intergenic
1166955138 19:46458973-46458995 GTCTGGGTTGGTGGTTGCACAGG - Intergenic
1167122540 19:47527244-47527266 GACTGTGGTGATGGTTTCCCAGG + Intronic
1167515542 19:49921351-49921373 GACGGTGATGGTGGTGGCAGTGG - Intronic
1168207456 19:54861844-54861866 GCCTGTGCTGGTGGGTTCAGGGG - Intronic
1168611854 19:57807238-57807260 GACTCTGATGATGGTTTCATGGG + Exonic
1168616972 19:57846050-57846072 GACTCTGATGATGGTTTCACGGG - Exonic
924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG + Intergenic
925815231 2:7740895-7740917 GACTGTGGCGGTAGATTCACAGG - Intergenic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
927266497 2:21158624-21158646 AACTATGTTGGTGGTTACACAGG - Intergenic
927376761 2:22425788-22425810 GACTGTAAAGTTGGTTTCAGGGG - Intergenic
927854850 2:26521584-26521606 GACAGTGATGGGGCTGTCACTGG + Intronic
928127048 2:28624123-28624145 GATTGTGGTGATGATTTCACAGG - Intronic
928711126 2:34006831-34006853 GATTGTGGTGATGGTTTCACAGG - Intergenic
929048508 2:37814233-37814255 GATTGTGGTGATGGTTTCATTGG + Intergenic
929188021 2:39115199-39115221 GATTGTGCTGATGGTTTCAGGGG - Intronic
929352659 2:40977828-40977850 AATTGCGATGGTGGTTTCTCAGG - Intergenic
929566193 2:42986865-42986887 GATTGTGGTGATGGTTTCAAGGG - Intergenic
929626247 2:43410786-43410808 GACAGTGATGATGGTTTTATGGG + Intronic
929909521 2:46077273-46077295 GATTGTGGTGATGGTTTCATGGG + Intronic
930081772 2:47455860-47455882 GACTTTGATGATGCTTTCCCTGG + Intronic
930524956 2:52516814-52516836 TATAGTGGTGGTGGTTTCACAGG + Intergenic
930625138 2:53688336-53688358 GTTTGAGATGGTGGTTACACAGG - Intronic
930735036 2:54769652-54769674 CATTGTGGTGATGGTTTCACAGG - Intronic
931101662 2:59008858-59008880 CACTGTGGTCATGGTTTCACAGG - Intergenic
931133018 2:59360382-59360404 TATTGTGGTGGTGGTTGCACAGG - Intergenic
931580511 2:63766671-63766693 GATTGTGGTGATGTTTTCACAGG - Intronic
931631390 2:64304297-64304319 GGCTGTGAGGGTGTTTTCAGAGG - Intergenic
931703763 2:64929677-64929699 GATTGTGGTGATGGTTTCACTGG - Intergenic
932320516 2:70819117-70819139 GATTGTGGTGATGGTTTCAGGGG + Intronic
933017735 2:77151066-77151088 GATTGTGGTGATGATTTCACAGG - Intronic
933147799 2:78876477-78876499 GACTGTGATGTTGATTTCCTAGG - Intergenic
933476038 2:82791858-82791880 AACTGTTGTGATGGTTTCACAGG - Intergenic
933660047 2:84920263-84920285 GTCTGTGAGGGTGTTTTCACAGG + Intergenic
934654839 2:96112109-96112131 GTCAGTGATGGTGGGTACACTGG + Intergenic
934930454 2:98418154-98418176 GATTGTGGTGATGGTATCACAGG + Intergenic
935029796 2:99311124-99311146 GACTGAGATGGGAGGTTCACTGG - Intronic
935183472 2:100710719-100710741 GACTGTGGTGATGGTTTCACAGG + Intergenic
935490092 2:103708685-103708707 CAATGAGATGGGGGTTTCACAGG + Intergenic
935525220 2:104157383-104157405 GACTGTGAGGGTGTTTCCAGAGG - Intergenic
936344728 2:111666617-111666639 GATGGTGATGGTGGTGTTACTGG + Intergenic
936391848 2:112082012-112082034 AACTGTGATGGTGCCTCCACTGG - Intronic
936471714 2:112804736-112804758 GACTGTAGTGATAGTTTCACTGG + Intergenic
936472220 2:112809469-112809491 GATTGTGGTGATGTTTTCACAGG - Intergenic
937070605 2:119060360-119060382 GAATGTGCTGATGGTTTCATAGG - Intergenic
937192520 2:120117710-120117732 GATTATGGTGTTGGTTTCACGGG - Intronic
937346110 2:121126496-121126518 AACTGTGATGATGGTTCCATGGG + Intergenic
937432467 2:121850823-121850845 GATTGTGGTGGTGGTTTCTGGGG + Intergenic
937586422 2:123557102-123557124 GATTGTGATGATAGTTTCAGGGG - Intergenic
939514846 2:143153601-143153623 GATTGTGGTGTTGGTTTCATAGG - Intronic
939593201 2:144092119-144092141 GTCTGTGGTGATGGTTACACAGG + Intronic
939647167 2:144714750-144714772 GACTGTTAAGGAGGTTTCTCAGG + Intergenic
942224134 2:173800101-173800123 GGCTGTAATGGTGGTTTCATGGG - Intergenic
942283816 2:174393780-174393802 GATTGTGATGATGGTTTCACAGG - Intronic
942348126 2:175024837-175024859 GATTGTGGTGATGGTTTCACAGG - Intergenic
942589120 2:177522166-177522188 GACTGGGGTGATGGTTTCACAGG - Intronic
942765632 2:179453332-179453354 GACTGTGTTGGGGGTTTCTGAGG - Intronic
943225046 2:185162343-185162365 GATTGTGGTGATGGTTTCATGGG - Intergenic
943712457 2:191112056-191112078 GATTGTGATAATGGTTTCATGGG + Intronic
943821070 2:192321505-192321527 GACTGTGGTGGTTATTTCATAGG + Intergenic
943965038 2:194321606-194321628 GTTAGTGATGGTGGCTTCACTGG - Intergenic
944524188 2:200601528-200601550 GACCGTGGTGATGGTTTCATGGG + Intronic
944734408 2:202548949-202548971 GACTGTGATGATGGTTTTATGGG - Intronic
945669181 2:212781947-212781969 GATTGTGATGTTGGTTTCATGGG - Intergenic
946000665 2:216479259-216479281 TATTCTGATGGTGATTTCACAGG - Intronic
946383975 2:219370456-219370478 GATTGTGGTGGTGGTTTCCCAGG + Intergenic
946943869 2:224799081-224799103 GATTGTGGTGATGGTTTCATGGG - Intronic
947173007 2:227331105-227331127 GACTGTGGTGGTGGTTATATGGG - Intronic
947295239 2:228623701-228623723 GACTGTGGTGATAGTTTCACAGG + Intergenic
947377230 2:229509052-229509074 GTTTTTGGTGGTGGTTTCACTGG + Intronic
947530480 2:230905938-230905960 GCCTGTGATGGTAGTTTCAGGGG + Intergenic
948148479 2:235726540-235726562 GTGTGTGATGGTGGTTCCATTGG - Intronic
1168827724 20:825103-825125 GGCAGTGATGGTGGTTTGAGAGG + Intergenic
1169277124 20:4241218-4241240 GAGTGGGATGGTGGTTTCCAGGG + Intronic
1169802680 20:9526986-9527008 GATTGTGGTGATGGCTTCACAGG - Intronic
1169981099 20:11384701-11384723 GAGTGTGATGGTGGTTACAAGGG + Intergenic
1170151584 20:13232235-13232257 GACTATGGTGATGGTTTTACAGG - Intronic
1171158857 20:22903184-22903206 GTTTGTGGTGATGGTTTCACAGG - Intergenic
1171178458 20:23073456-23073478 GACTGTGAGGGTGCGTTCCCTGG + Intergenic
1171939069 20:31307105-31307127 GATTGTGATGATGGTTTCATGGG - Intronic
1172041444 20:32049392-32049414 GATTGGGGTGGTGGTTACACAGG + Intergenic
1172176425 20:32975038-32975060 AACTGTGATCCTGGTGTCACAGG + Intergenic
1172276329 20:33681619-33681641 GACTGTCCTGGAGGTCTCACAGG + Intronic
1173343140 20:42172766-42172788 GACTGTGATGGTGGTCACACAGG - Intronic
1174897439 20:54465765-54465787 GATTATGGTGGTGATTTCACAGG + Intergenic
1174989201 20:55490399-55490421 TATTATGATGGTGGTATCACTGG - Intergenic
1175214397 20:57383815-57383837 GACTGTGGTGATGGTTTCATGGG - Intergenic
1176948556 21:15015308-15015330 AATGGTGATGATGGTTTCACAGG + Intronic
1178095895 21:29215301-29215323 GATTGTGGTGATGGTTTCATGGG - Intronic
1178266883 21:31151642-31151664 GATTGTGACGATGGTTTCATAGG + Intronic
1178442836 21:32612545-32612567 GACTGTGTGGGTGGTTTCCCCGG - Exonic
1178846575 21:36178881-36178903 GATTGTGGTGATGGTTTCACAGG - Intronic
1179161007 21:38899176-38899198 GATTGGGATGATGGTTACACAGG + Intergenic
1179288025 21:39994907-39994929 GGCTTTGATGGAGGTTTCCCGGG + Intergenic
1179911779 21:44454749-44454771 GATTGTGGTGATGGTTTCACAGG + Intergenic
1180110809 21:45648562-45648584 CACTGAGATTGTGGTGTCACAGG + Intronic
1180712954 22:17852291-17852313 GACTGTGATTGACGTTTTACAGG - Intronic
1180944295 22:19681266-19681288 GATTGTGGTGATGGTTTCATGGG + Intergenic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
1181995337 22:26876172-26876194 AACTGTGGTGATGATTTCACAGG - Intergenic
1182505915 22:30782221-30782243 GATTGTGGTGATGGTTTCATGGG - Intronic
1182529347 22:30943367-30943389 GTCTGTGATGGTGGCAACACAGG + Intronic
1182987040 22:34729642-34729664 GAGTGAGATGGTGGTTACAGAGG + Intergenic
1183497094 22:38153077-38153099 GATTGTGGTGGTGGTTACATGGG + Intronic
1183860166 22:40664196-40664218 GCCTGTGAGGGTGTTTTCAGAGG + Intergenic
1183974853 22:41505822-41505844 GATTGTGGTGCTGGTTTCACAGG + Intronic
1184544792 22:45160224-45160246 GACTGTGATGGTTGTTAGGCTGG - Intergenic
1184552935 22:45214574-45214596 GATTGTGACGCTGGTTTCACAGG + Intronic
1184702160 22:46182623-46182645 GGCTATGATAGTGGTTTCACAGG + Intronic
949302835 3:2604757-2604779 GATTGTGATGATGGTTTCATGGG - Intronic
949541497 3:5035857-5035879 GATTGTGGTGATGGTTTCCCAGG - Intergenic
950005968 3:9691240-9691262 GCGTGTGGCGGTGGTTTCACAGG - Intronic
950823308 3:15786537-15786559 GACTGTGGTGATGGTTTCATAGG + Intronic
951079070 3:18429750-18429772 GACTGTGATGACTGTTTCAAAGG - Intronic
951159588 3:19401196-19401218 CACAGTGATGCTGGTGTCACTGG + Intronic
951233485 3:20207229-20207251 GAATGTCATGGTAGTTTGACAGG + Intergenic
951459070 3:22929483-22929505 GATTGTGGTGATGGTTTCATGGG + Intergenic
951797739 3:26559889-26559911 GATTGTGGTGGTGATTTCACAGG + Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952767838 3:36970487-36970509 GACTGAGGTGTTGGTTCCACAGG - Intergenic
952798491 3:37265630-37265652 GATGGTGGTGATGGTTTCACAGG - Intronic
953361913 3:42304900-42304922 GATTGTGATGATGGCTTCAAGGG - Intergenic
953604043 3:44397210-44397232 GACTGTGATAATGGCTTCATGGG - Intronic
953823657 3:46231693-46231715 GATTATGATGAGGGTTTCACAGG + Intronic
953843976 3:46412338-46412360 GACTGTGGTGATGGTTTCATTGG + Intronic
955195659 3:56802531-56802553 GACTGTGGAGGTGGTTATACGGG - Intronic
955284177 3:57623000-57623022 GGCTGTGATGATGGTTTTATGGG + Intergenic
955464108 3:59218479-59218501 GATTGTGGTGATGGTTTCATGGG - Intergenic
956218907 3:66881249-66881271 GATTGTGGTGATAGTTTCACAGG + Intergenic
956327127 3:68066116-68066138 GATTGTAGTGATGGTTTCACAGG + Intronic
957516329 3:81257405-81257427 GGCTGTAGTGATGGTTTCACAGG + Intergenic
958084407 3:88787812-88787834 GGCTGTCATGATGGTTTCATGGG + Intergenic
958517494 3:95136865-95136887 GATTATGATGATGATTTCACAGG - Intergenic
958985316 3:100774013-100774035 GATTGTGATGATGGTCTCATGGG + Intronic
960509518 3:118531560-118531582 AATTGTGATGATAGTTTCACAGG - Intergenic
961968985 3:130939110-130939132 GACTATTTTGTTGGTTTCACAGG - Intronic
962631997 3:137286724-137286746 CACTGTGGTGATGGTTTCATGGG - Intergenic
962758055 3:138482992-138483014 GATTGTGGTGATGATTTCACAGG + Intergenic
963339094 3:144012657-144012679 GCTTGTGATGATGGTTTCATAGG + Intronic
964353177 3:155823270-155823292 GACTCTAATAGTGGTTTGACTGG + Exonic
964488262 3:157208063-157208085 TACTGTGGTGGTGATTTCATGGG + Intergenic
965189432 3:165508884-165508906 CATTGGGATAGTGGTTTCACAGG + Intergenic
965208036 3:165747190-165747212 GATTGGGATGGTGGTTTTGCAGG + Intergenic
965674207 3:171177770-171177792 GACTGTGATGATGTGTTCACAGG - Intronic
965755497 3:172022033-172022055 GAATGTGATGGTGGATCCACAGG + Intergenic
965830905 3:172788432-172788454 GATTGTGGTGATGGTTTCATGGG - Intronic
966026550 3:175290516-175290538 GACTTTGGTGGTGGTTACATGGG + Intronic
966175066 3:177129598-177129620 GACTGGTATAGTGGTTACACAGG + Intronic
966809935 3:183834638-183834660 GAGTGTGGTGATGGTTTCACGGG + Intronic
967617950 3:191595917-191595939 TATTGTGATGGTGGTTTTATGGG - Intergenic
967764718 3:193266232-193266254 GATTGTAATGATGGTTTCATGGG + Intronic
968092255 3:195906664-195906686 GAAGGTGGGGGTGGTTTCACGGG + Intronic
968960276 4:3739867-3739889 GTCTGTGACTGTGGTTTCAGGGG - Intergenic
971289493 4:25323818-25323840 GACTGTGGTGATGATTTCACGGG - Intronic
971373729 4:26039239-26039261 GACTGTGTTGCAGTTTTCACTGG - Intergenic
971636150 4:29061235-29061257 GGTTGTGATGATGGTATCACTGG - Intergenic
971991993 4:33910500-33910522 GACTGTGGTAGTGAATTCACAGG + Intergenic
972151352 4:36094931-36094953 GACTGGGAAGGTGCTATCACAGG + Intronic
973017421 4:45158682-45158704 GATTGTGGTAATGGTTTCACAGG - Intergenic
973107619 4:46360149-46360171 GATTGTGGTGATGGTATCACAGG + Intronic
973264323 4:48196142-48196164 GTCTGTGATGGTGTTTCCAGAGG + Intronic
973277255 4:48323101-48323123 GACTGTTCTGGTGGTATCTCTGG + Intergenic
973725978 4:53776389-53776411 TATTGTGGTGGTGATTTCACAGG - Intronic
974209823 4:58757062-58757084 GACTTTGATGGTGGCTTCCTGGG - Intergenic
974576361 4:63728790-63728812 GACTGTGTTGGTGGGGGCACAGG + Intergenic
975590303 4:75993219-75993241 GATTGTGATGATGGTTTTATGGG - Intergenic
976383163 4:84423824-84423846 CACTTTGATGGTAGTTTCGCTGG - Intergenic
976397347 4:84570448-84570470 ATCTGGGATGCTGGTTTCACGGG + Intergenic
976900965 4:90175440-90175462 GATTGTGGTGATGGTTTCACAGG + Intronic
977697865 4:99986941-99986963 GATTGTGGTGATGGTTTCACAGG + Intergenic
978779066 4:112530813-112530835 GATTGTGATGGTGGTTACAAAGG + Intergenic
979004892 4:115281678-115281700 GATTGTGGTGATGGTTTCATGGG + Intergenic
979464333 4:121018950-121018972 GACTGTGATGGGGTTTTGTCAGG + Intergenic
979768265 4:124489811-124489833 GATTGTGATGGTGATTTCATAGG + Intergenic
980197571 4:129610440-129610462 GACTGTAGTGGTGGCTACACAGG + Intergenic
980214909 4:129839599-129839621 GATTGTACAGGTGGTTTCACAGG + Intergenic
980483915 4:133427754-133427776 GATTGTGGTGATGGTATCACAGG + Intergenic
980807739 4:137835383-137835405 GTCTGTGATGGTGTTTCCAGAGG + Intergenic
980838385 4:138226304-138226326 GATTGTGGTGATAGTTTCACAGG + Intronic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
981979594 4:150774983-150775005 AACTGTGATGCTGATTTGACTGG - Intronic
982098457 4:151945305-151945327 GACTGTGGTGATGATTACACAGG + Intergenic
982229389 4:153194662-153194684 CATTGTGGTGATGGTTTCACAGG + Intronic
982332738 4:154199706-154199728 GATTGTGTTTCTGGTTTCACTGG + Intergenic
982383073 4:154770643-154770665 GACTGTTTGGTTGGTTTCACTGG - Intergenic
982391151 4:154865071-154865093 GTCTGTGAGGGTGTTGTCACAGG - Intergenic
982402740 4:154986060-154986082 GTCTGTGAGGGTGGTTCCAGAGG + Intergenic
983248854 4:165321693-165321715 GATTGTGGTGATGGTTTCATGGG - Intronic
983665100 4:170172562-170172584 GATTGCGGTGATGGTTTCACAGG - Intergenic
983950154 4:173629993-173630015 GATTGTAATAATGGTTTCACAGG - Intergenic
984418692 4:179492406-179492428 GATTGTGATGATGGTTTCCTGGG - Intergenic
984957532 4:185060318-185060340 GACTGTGATGACGGTTTCATGGG - Intergenic
985332443 4:188853534-188853556 GATTGTGGTGGTTGTTTCACAGG - Intergenic
986210747 5:5669571-5669593 GATTGTGATGATGGTTGCTCAGG - Intergenic
986359130 5:6958613-6958635 GGTTGTGGTGGTGGTATCACAGG + Intergenic
986482899 5:8206532-8206554 GATTGTGGTAATGGTTTCACAGG - Intergenic
987029418 5:13962095-13962117 GATTGTGGTGATGGTTTCATGGG - Intergenic
987765223 5:22218642-22218664 GATTATGATGGTGGCTTCACAGG + Intronic
988378251 5:30467565-30467587 GATTATGGTGTTGGTTTCACAGG + Intergenic
988651811 5:33160736-33160758 GATTGTGATGATATTTTCACAGG - Intergenic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
988979454 5:36552061-36552083 GACTGTGGAGGTGGTTACACAGG + Intergenic
991279804 5:64899748-64899770 GATTGTGGTGATGTTTTCACAGG - Intronic
991571493 5:68059052-68059074 GATTGTGATCATGGTTTCATGGG - Intergenic
992350852 5:75927740-75927762 GGTTGTGATGATGGTTTCATGGG + Intergenic
992449922 5:76867170-76867192 GACTGTGGTGATGGTGTCACTGG - Intronic
992533465 5:77673913-77673935 GATTGTGGTCATGGTTTCACAGG - Intergenic
992906193 5:81348303-81348325 GATTGTGGTGATGTTTTCACAGG + Intronic
992928139 5:81612073-81612095 GGTTGTGATGATGGTTTCATGGG + Intronic
993479542 5:88407343-88407365 GATTGTGATAATGGCTTCACAGG + Intergenic
993687699 5:90960264-90960286 CATTGTGATGATGGCTTCACAGG + Intronic
993700432 5:91113106-91113128 GAATGTGATGGTAGTTACAGAGG - Intronic
995396359 5:111691232-111691254 GATTGTGGTGATGGTTTCATGGG + Intronic
995634266 5:114167754-114167776 GATTGTGGTGATGGTTTCTCAGG - Intergenic
995664839 5:114530250-114530272 GATTGAGATGGTGGTTACATGGG + Intergenic
997167390 5:131675818-131675840 GATTGTGGTGATGGTTTCAGAGG + Intronic
997832702 5:137164793-137164815 GCCTGTGATGGTGGTGGCAATGG + Intronic
997876708 5:137555674-137555696 GATTGTGGTGATGGTTTCATAGG - Intronic
998494451 5:142575384-142575406 GAGTGTGGTGGTGATTTCATGGG - Intergenic
998645889 5:144061763-144061785 GACGGTCATGATGGTTTCATGGG - Intergenic
999058038 5:148602210-148602232 GAGTGTGGTGATGGTTTCACGGG + Intronic
999120176 5:149203483-149203505 GATTGTGGTGGTGGTGTCAATGG - Intronic
999304693 5:150511960-150511982 GACTGTGCTGGGGGTGTGACTGG + Intronic
999463479 5:151777740-151777762 GATTGTGGTGATGGTTTCATGGG - Intronic
999509321 5:152231649-152231671 GATTGGGATGGTGGTTACATGGG - Intergenic
999700350 5:154222041-154222063 GACTGTGATGATGGCTTCACAGG - Intronic
999717279 5:154371430-154371452 GACTCTGATGATGGTTCTACCGG - Intronic
999830760 5:155317003-155317025 GATTGTGGTGATGGTATCACTGG - Intergenic
1000436138 5:161211503-161211525 GATTGAGATGAAGGTTTCACGGG + Intergenic
1000732059 5:164847218-164847240 GATTGTGATGATGGTTTTACAGG - Intergenic
1001876239 5:175203859-175203881 GATTGTGGTGATGGTATCACAGG + Intergenic
1002536884 5:179880614-179880636 GACTGTGGTGATGGCTTCATGGG + Intronic
1002622028 5:180494673-180494695 GACTGGTATGGTGGTTCCACAGG + Exonic
1002627925 5:180545230-180545252 GATTGTGGTGATGGTTTCACGGG - Intronic
1003055304 6:2812872-2812894 GATTGTGATGATGATTTCACAGG - Intergenic
1003069849 6:2937329-2937351 CACTGTGCTGGTGGGTTCATTGG - Intergenic
1003111824 6:3257379-3257401 GATTGTAATGATGGTTTCACTGG - Intronic
1003111871 6:3257784-3257806 GATTGTGATGATGATTTCACTGG + Intronic
1003221845 6:4167184-4167206 GGTTGTGGTGATGGTTTCACAGG - Intergenic
1003258949 6:4498626-4498648 GCTTGTGATGATGGTTTCATGGG + Intergenic
1003362092 6:5436982-5437004 GATTGTGGTGATGGTTTCACTGG - Intronic
1003651289 6:7962680-7962702 GATTGTGATGATGGCTTCAATGG + Intronic
1003667416 6:8124491-8124513 GATTGTGGTGATGGTTTCATGGG - Intergenic
1004029603 6:11853358-11853380 CTCTGTGATGGTTGTTTCTCAGG + Intergenic
1005416592 6:25606338-25606360 GACTCTGCAGGTGGTTTCAGGGG + Intronic
1005769046 6:29046652-29046674 GATTGTGTTGATGGTTTCACAGG + Intergenic
1005903367 6:30238873-30238895 TGCTGTGATGATGGTTTCAGAGG - Intergenic
1006739599 6:36297890-36297912 AATTGTGGTGATGGTTTCACAGG - Intronic
1006747780 6:36356916-36356938 ACCTGTGATGATGTTTTCACGGG - Intronic
1007015406 6:38461233-38461255 GATTGTGGTGATGGTTTTACAGG - Intronic
1007921345 6:45612367-45612389 GATTGTGGTGATGGTTTCAAGGG - Intronic
1008531145 6:52460436-52460458 GATTGTAATGATGGTTTCATGGG + Intronic
1009281451 6:61756777-61756799 GATTGTGGTGATAGTTTCACTGG - Intronic
1009866598 6:69405941-69405963 TATTGTGGTGATGGTTTCACAGG - Intergenic
1010276551 6:73974131-73974153 GATTGTGATGTTAGTTTCACAGG - Intergenic
1010747109 6:79576715-79576737 AATTGTGGTGGTGGTTTCATGGG - Intergenic
1010864538 6:80958577-80958599 GATTGTATTGGTGGTTTCATGGG + Intergenic
1011239980 6:85261082-85261104 GATTCTCATGCTGGTTTCACAGG - Intergenic
1011638530 6:89398257-89398279 GACTGTGCTGATGGTTTCACAGG + Intronic
1011673340 6:89705803-89705825 GACTGTGATAATGGTTTCACAGG + Intronic
1011834147 6:91409156-91409178 GACTGTGATAGTGGTTACCGTGG - Intergenic
1012388877 6:98714251-98714273 GATTGTGATGATGGCTTCATAGG + Intergenic
1012490672 6:99779901-99779923 GACTGTGTGTGTGGTTACACTGG + Intergenic
1012500756 6:99885848-99885870 GACTGTAACAGTGTTTTCACTGG + Intergenic
1012572575 6:100747757-100747779 GATTGTGATGATGGTTCCATAGG + Intronic
1012819226 6:104063718-104063740 GATTGTGGTGATGGTTTCATGGG + Intergenic
1012972757 6:105749178-105749200 GAATGTGTTGCTGGTTACACAGG - Intergenic
1013112058 6:107071934-107071956 GACTGTGGCTGTGGGTTCACTGG + Intronic
1013809037 6:114023921-114023943 GATTATGGTGATGGTTTCACAGG - Intergenic
1014418129 6:121209236-121209258 GATTGTGGTTATGGTTTCACAGG - Intronic
1014748465 6:125228286-125228308 GATTGTGATAATGGCTTCACGGG + Intronic
1015026711 6:128541912-128541934 GATTGTGTTGATGTTTTCACAGG - Intergenic
1015073302 6:129123963-129123985 GACGGTGGTGATGGTTTCGCTGG + Intronic
1015617344 6:135091303-135091325 AAGTCTGATGGAGGTTTCACTGG - Intronic
1016755365 6:147678879-147678901 GATTGTGGTGATGGTTTCATGGG - Intronic
1016982656 6:149866962-149866984 GATTGTGGTGATGGTTTCACTGG + Intergenic
1017403228 6:154088612-154088634 AATTATGGTGGTGGTTTCACAGG + Intronic
1018220925 6:161578651-161578673 GACAGTCATGGAGGTGTCACAGG - Intronic
1018245266 6:161816426-161816448 GACTGTGATAGTGGTCTTACCGG + Intronic
1019045438 6:169141964-169141986 GGCTGAGGTGGTGGTGTCACGGG + Intergenic
1020182795 7:5935309-5935331 GACTGAGGCGATGGTTTCACAGG - Intronic
1020300117 7:6789448-6789470 GACTGAGGCGATGGTTTCACAGG + Intronic
1021332494 7:19356129-19356151 GATTATGGTGATGGTTTCACGGG - Intergenic
1021689733 7:23220405-23220427 GATTGTGGTTGTGGTTTCATAGG + Intergenic
1021823927 7:24528284-24528306 GATTATGGTGATGGTTTCACAGG + Intergenic
1022151323 7:27610307-27610329 GAATGTGGTGGTGGTTTTATGGG - Intronic
1022155306 7:27654997-27655019 GACTGTGATGATAGCTTCACCGG + Intronic
1023898083 7:44451696-44451718 GATTGTGGTGATGGTTTCATAGG + Intronic
1024148917 7:46547609-46547631 GAATGTGTTGTTGGTTTCATGGG + Intergenic
1025850034 7:65237703-65237725 GACTGTCATTGTGGTCTCTCAGG - Intergenic
1025985846 7:66451032-66451054 AACTGTGATGCTGGATACACAGG + Intergenic
1026002703 7:66574329-66574351 AACTGTGATGCTGGATACACAGG + Intergenic
1026668872 7:72369220-72369242 GATTGTGGCGATGGTTTCACAGG - Intronic
1027209071 7:76129575-76129597 AACTGTGATGCTGGCTACACAGG + Intergenic
1027585869 7:80057864-80057886 TTTTGTGATGCTGGTTTCACAGG + Intergenic
1028117369 7:87014879-87014901 GATTGTTATGATGGTTTCACAGG + Intronic
1028204914 7:88005415-88005437 CACTGTGATGGTGATAGCACTGG - Intronic
1028521958 7:91742029-91742051 GACTGTCATGGTGGTGGCCCTGG - Intronic
1028596453 7:92551270-92551292 GATTGTGGTGATGGTTTCATAGG + Intergenic
1029918180 7:104233752-104233774 GATGGTGGTGATGGTTTCACAGG - Intergenic
1030343521 7:108407777-108407799 GATTGTGTTGATGGTTTCACAGG + Intronic
1030707921 7:112714358-112714380 GCCTTTGGTGCTGGTTTCACAGG - Intergenic
1031212759 7:118851534-118851556 GATTATGGTGATGGTTTCACAGG + Intergenic
1031676126 7:124614700-124614722 GTCTGTGATGGTGTTGTCAAAGG + Intergenic
1031775094 7:125898989-125899011 GACTGTGGTGATGGTTTCACAGG - Intergenic
1031812071 7:126382968-126382990 GATTGTGGTGATGGTTTCATGGG - Intergenic
1032064663 7:128758008-128758030 GATTGCAGTGGTGGTTTCACTGG - Intronic
1032112097 7:129084866-129084888 GACTGTGGTCATGGTTTCACGGG - Intergenic
1033301552 7:140190575-140190597 GATTGTGGTGATGGTTTCATGGG + Intergenic
1033363539 7:140654788-140654810 GACAGTGATGGTGGTGACAGTGG - Intronic
1033381309 7:140822355-140822377 GAATGTGATGATGGTTGCATGGG - Intronic
1033815514 7:145068259-145068281 GATTGTGATGATTGTTTCATAGG - Intergenic
1033826385 7:145195374-145195396 GATTGTAGTGATGGTTTCACAGG - Intergenic
1035830054 8:2686138-2686160 GATTGCGTTGATGGTTTCACGGG - Intergenic
1036158742 8:6366900-6366922 GATTGTGTTGATGGTTACACAGG - Intergenic
1036398107 8:8386008-8386030 GACTGTTAGGATGGTTTCTCTGG - Intronic
1036782045 8:11656492-11656514 GATTGTGGTGATGGTTTCACGGG - Intergenic
1037250216 8:16884323-16884345 TATTGTGGTGATGGTTTCACAGG + Intergenic
1037530750 8:19770432-19770454 GATTGTGGTGATGGTTTCACGGG + Intergenic
1037596167 8:20356133-20356155 GATTGTGGTGATGGTTTCACAGG - Intergenic
1038118124 8:24581012-24581034 GACTGTGGTAATGGCTTCACTGG + Intergenic
1038172317 8:25147463-25147485 GACTGTAGTGTTGGTATCACTGG + Intergenic
1038281755 8:26171568-26171590 GATTGTAACGATGGTTTCACAGG + Intergenic
1038555822 8:28514460-28514482 GACTGTGGTGATGGTTTCACAGG - Intronic
1038860282 8:31380257-31380279 GCCAGTTATGGTTGTTTCACTGG + Intergenic
1039767196 8:40641605-40641627 GATTGTGATGATGGTTTCAAAGG - Intronic
1040025979 8:42783009-42783031 GATTGTGGTGGTGGTATCATGGG - Intronic
1040617535 8:49053232-49053254 GATTGGAATGGTGGTTACACAGG + Intergenic
1040668583 8:49659185-49659207 GACTGTGCATGTGGCTTCACTGG - Intergenic
1041000760 8:53449279-53449301 GATAGTGGTGGTGGTTGCACAGG + Intergenic
1041050437 8:53929228-53929250 GATTGTGATGATGGCTTCCCAGG + Intronic
1041488623 8:58407661-58407683 GATTGTGGTGGTAGTTACACAGG - Intergenic
1042268084 8:66928797-66928819 GAATGTGGTGATGGTTTCACAGG - Intergenic
1042494175 8:69437192-69437214 GATGGTGATGATGGTTTCATGGG + Intergenic
1042527357 8:69777477-69777499 GACTGTGGTGATGGCTTCACTGG + Intronic
1042651958 8:71052783-71052805 CACTGTGATGCTGGTTCCAGAGG + Intergenic
1042769311 8:72362153-72362175 GACAGTAGTGATGGTTTCACAGG - Intergenic
1042995019 8:74687896-74687918 GATTGTGGTGGTGTTATCACTGG + Intronic
1043765769 8:84130229-84130251 GAGAGTGATGGTGGTATCTCAGG - Intergenic
1043964432 8:86457045-86457067 GATTGTAATGGTGGTTACACAGG + Intronic
1044139445 8:88631724-88631746 CATTGTGCTGATGGTTTCACAGG - Intergenic
1045538833 8:103061618-103061640 GATTGTGGTGATGGTTTCATGGG + Intronic
1045650215 8:104335249-104335271 GATTGTGATGATGTTTTCACGGG + Intronic
1046066663 8:109205365-109205387 GATTCTGCTGCTGGTTTCACAGG - Intergenic
1046077390 8:109329670-109329692 GATTGTGGTGATGATTTCACGGG + Intronic
1046556693 8:115782183-115782205 GATTGTGATAATAGTTTCACAGG - Intronic
1046798544 8:118398771-118398793 GATTGTAGTGATGGTTTCACAGG + Intronic
1046806456 8:118484502-118484524 GATTGTGGTGATGGTTTCATAGG + Intronic
1046850114 8:118962522-118962544 GATTGTGGTGATGGTATCACAGG - Intergenic
1047001203 8:120574437-120574459 GACTATGATGATGGTTTCATAGG + Intronic
1047375860 8:124295314-124295336 GAATATGGTGATGGTTTCACAGG + Intergenic
1047598562 8:126403757-126403779 AATTGTGATGATGGTTTCATGGG + Intergenic
1047670587 8:127142028-127142050 GCTTGTGGTGGTGGTTTGACTGG - Intergenic
1047949225 8:129915623-129915645 GATTGTGGTGATGGTTTCATAGG + Intronic
1048126485 8:131641252-131641274 GTCTGTGATGGTGGTGCCAAAGG + Intergenic
1048768133 8:137866710-137866732 GACTGTGATGATAGTCTCATGGG - Intergenic
1049113716 8:140667371-140667393 GACTGGCATGTTGGTTGCACAGG - Intronic
1049485417 8:142856341-142856363 GACTGTGATAGGGATTGCACTGG + Intronic
1049842260 8:144780467-144780489 GACTGTGGTGCTGGTTCCATGGG - Intronic
1050639453 9:7651698-7651720 AACTGTGCTGATGCTTTCACAGG + Intergenic
1050793250 9:9502035-9502057 GATTGTGGTAGTGGTTTCATGGG - Intronic
1051597023 9:18834537-18834559 GATTGTGGTGATGATTTCACAGG - Intronic
1051813009 9:21072128-21072150 GACTGTGTTGATGGTTTCAGGGG - Intergenic
1052127538 9:24796223-24796245 GATTGTGGTGATGATTTCACAGG + Intergenic
1052397322 9:27955397-27955419 GATTGTGATGGTGCTTACAAAGG - Intronic
1052510910 9:29418862-29418884 AATTGTGATGATGGTTTCACAGG - Intergenic
1052521862 9:29558444-29558466 GACTGGGATGGTGGCTGCAAAGG - Intergenic
1053209526 9:36216151-36216173 GATTGTGGTGATGCTTTCACAGG + Exonic
1053244272 9:36521748-36521770 GATTGTGTTGATGGTTTCACAGG + Intergenic
1053536318 9:38930097-38930119 GATAGTGATGTTGGTTTCATAGG - Intergenic
1054629816 9:67433851-67433873 GATAGTGATGTTGGTTTCATAGG + Intergenic
1054747309 9:68867625-68867647 GATTGTGGTGATGGTTTCACAGG + Intronic
1055542268 9:77323640-77323662 GACTGTGATGACAGTTTCAAAGG - Intronic
1056417892 9:86395153-86395175 CACTCTGATGGTGGTTTCTTTGG - Intergenic
1056849318 9:90068887-90068909 GATTGTGGTGATGGTTTCACAGG - Intergenic
1056995684 9:91455732-91455754 GAATGTGGTGATGGTGTCACAGG - Intergenic
1057155565 9:92835766-92835788 TATTGTGTTGGTGGTTTCATGGG - Intergenic
1057361886 9:94380899-94380921 GATTATGATAATGGTTTCACAGG - Intronic
1057661471 9:97007265-97007287 GATTATGATAATGGTTTCACAGG + Intronic
1058364560 9:104193316-104193338 GACTGTAATTATGGTTTCATAGG - Intergenic
1058515226 9:105765423-105765445 GACTGTGGTAGTAGTTACACAGG - Intronic
1058547337 9:106074590-106074612 GATTGTGGTGATGGTTTCATGGG - Intergenic
1058725264 9:107797269-107797291 GACTGTGGTGATGGTTTCATGGG - Intergenic
1059257530 9:112945038-112945060 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1059491523 9:114671573-114671595 GACTGTGGTGGGGGTATCATTGG + Intergenic
1059536586 9:115086532-115086554 GAGTGTGATGATGGTTTCACTGG - Exonic
1059536631 9:115086811-115086833 GTGTGTGATGAGGGTTTCACGGG - Exonic
1059797701 9:117716785-117716807 GATTGTGGTGATGGTTTGACAGG + Exonic
1060081022 9:120645405-120645427 AACTGTGATGATGCTTTAACTGG - Intronic
1060273248 9:122162894-122162916 GATTGTGATGATGTTTTCCCAGG + Intronic
1060534929 9:124377843-124377865 AACTGTGATGGTCCTTTCTCTGG - Intronic
1060898477 9:127236385-127236407 GAGTGTGATTGTGCTATCACTGG - Intronic
1061024822 9:128041692-128041714 GACTGTTGTGGTGGTTTGAGAGG + Intergenic
1061266552 9:129508836-129508858 AGCTGGGATGGTGGTTTCAGAGG + Intergenic
1061336209 9:129938637-129938659 GATTGAGATGCTGGTCTCACTGG - Intronic
1062127579 9:134871859-134871881 AATTGTGGTGCTGGTTTCACGGG - Intergenic
1062409013 9:136412351-136412373 GATTGTGCTGATGGTTTCACAGG - Intronic
1186385771 X:9109035-9109057 GATTGTGGTGATGGTTTCACAGG - Intronic
1186484221 X:9921381-9921403 GATTGTGGTGATGATTTCACAGG - Intronic
1186507239 X:10102909-10102931 GACTGAGATGGTGCTCTCCCTGG + Intronic
1187455674 X:19439395-19439417 GATTGTGGTGGTAGTTTCATGGG + Intronic
1188624042 X:32262418-32262440 GACTGTGCTAATAGTTTCACTGG + Intronic
1188702357 X:33280620-33280642 GATTGTGGTGATGGTTTCACAGG + Intronic
1188892012 X:35623213-35623235 GATTGTGATGATGGTTTCACAGG + Intergenic
1188970080 X:36604718-36604740 CCCTGTGAGGATGGTTTCACTGG - Intergenic
1189028621 X:37427361-37427383 GATGGTGATGGTTGTTTCATAGG - Intronic
1189488638 X:41452271-41452293 GATTGGGGTGGTGGTTACACAGG + Intronic
1189679122 X:43496581-43496603 GATTGTGGTGATGGTTTCATGGG + Intergenic
1189902141 X:45717448-45717470 GATTGTGAAGATGGCTTCACAGG + Intergenic
1189950722 X:46227845-46227867 GAATGTGGTGATGGTTTCACAGG + Intergenic
1191630569 X:63317360-63317382 GTCTGTGAGGGTGTTTTCAGAGG + Intergenic
1191927120 X:66325488-66325510 GATTGTGTTGATGGTTTCATGGG + Intergenic
1192303496 X:69932269-69932291 GATTGTGATGATGGTTTCACAGG + Intronic
1192605166 X:72508979-72509001 GATTGTGGTGATGGTTTCATGGG - Intronic
1193239562 X:79151437-79151459 GATTGTGGTGGTGGTTTCCCAGG - Intergenic
1193850121 X:86527278-86527300 GACTGTGGTGATGGTTTCATAGG - Intronic
1193892014 X:87059702-87059724 GATTGTCATGGTAGTTTTACAGG + Intergenic
1194407399 X:93513736-93513758 GACTGTGTTGGTGGTGGCAGCGG + Intergenic
1194824743 X:98547945-98547967 GATTGTGATGATGGTTTCATGGG - Intergenic
1195293425 X:103451302-103451324 GACTATGGTGTTGGTTTCATTGG - Intergenic
1195682272 X:107556544-107556566 GATTGTGGTGATGGTTTCATGGG - Intronic
1196115246 X:111992268-111992290 GATTGTGGTGATGGTTTCACAGG + Intronic
1196215907 X:113051066-113051088 GCCTGTGATGGTGGTGTCGGTGG + Intergenic
1196280238 X:113815665-113815687 GATTGTGGTGATGATTTCACAGG + Intergenic
1196317158 X:114241321-114241343 GAGTGTAATGGTTGTTTCATAGG + Intergenic
1196339118 X:114575663-114575685 GATTGTGGTGATGATTTCACAGG + Intergenic
1196567294 X:117223849-117223871 GATGGTGGTGATGGTTTCACTGG - Intergenic
1196584138 X:117409643-117409665 GACTATGCCTGTGGTTTCACTGG - Intergenic
1197180218 X:123527320-123527342 GATGGTCGTGGTGGTTTCACAGG - Intergenic
1197310589 X:124900456-124900478 GATTGTGGTGATAGTTTCACAGG + Intronic
1197367838 X:125587599-125587621 GATTGTGATGATGGTATCATAGG - Intergenic
1197726259 X:129778696-129778718 GACTGTGGTGATGATTTCATGGG - Intergenic
1198594129 X:138217624-138217646 GATTGTGATGATGATTTTACAGG + Intergenic
1199419052 X:147621827-147621849 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1199428661 X:147733537-147733559 GATTGTGGTGATGGTATCACTGG + Intergenic
1199951222 X:152707569-152707591 CACTGTGGTTGTGGTTTCATGGG + Intergenic
1199958459 X:152760892-152760914 CACTGTGGTTGTGGTTTCATGGG - Intergenic
1199998307 X:153041203-153041225 GACTGTGGTGATGGGTTCACAGG - Intergenic
1200306908 X:155035467-155035489 GACTGTGGTGATGGTTTTATGGG - Intronic