ID: 1181760039

View in Genome Browser
Species Human (GRCh38)
Location 22:25052011-25052033
Sequence CAGCTCCCCCAGCAGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 448}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181760039_1181760045 12 Left 1181760039 22:25052011-25052033 CCACACAGCTGCTGGGGGAGCTG 0: 1
1: 0
2: 3
3: 57
4: 448
Right 1181760045 22:25052046-25052068 GGCCTATCTCACTCCAGCCTTGG 0: 1
1: 0
2: 4
3: 174
4: 5029
1181760039_1181760044 -9 Left 1181760039 22:25052011-25052033 CCACACAGCTGCTGGGGGAGCTG 0: 1
1: 0
2: 3
3: 57
4: 448
Right 1181760044 22:25052025-25052047 GGGGAGCTGGAATGGAAACGGGG 0: 1
1: 0
2: 2
3: 39
4: 295
1181760039_1181760047 19 Left 1181760039 22:25052011-25052033 CCACACAGCTGCTGGGGGAGCTG 0: 1
1: 0
2: 3
3: 57
4: 448
Right 1181760047 22:25052053-25052075 CTCACTCCAGCCTTGGCCCCAGG 0: 1
1: 1
2: 47
3: 454
4: 2446
1181760039_1181760043 -10 Left 1181760039 22:25052011-25052033 CCACACAGCTGCTGGGGGAGCTG 0: 1
1: 0
2: 3
3: 57
4: 448
Right 1181760043 22:25052024-25052046 GGGGGAGCTGGAATGGAAACGGG 0: 1
1: 0
2: 4
3: 51
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181760039 Original CRISPR CAGCTCCCCCAGCAGCTGTG TGG (reversed) Intronic
900490351 1:2945900-2945922 CTGCTCCGCCAGGATCTGTGAGG - Intergenic
900612134 1:3548709-3548731 CAGCTGTGCCAGCAGCTGTGTGG - Intronic
900865631 1:5266837-5266859 CAGCTCTCACAGCACCTATGTGG - Intergenic
900865954 1:5268846-5268868 CAGGTCCCACAGCTGCTGAGTGG + Intergenic
901221680 1:7587039-7587061 CAGCTCCCCCAGAAGGGGAGGGG + Intronic
901231760 1:7645639-7645661 CAGCTCCCCCAGCCGCCTCGGGG + Intronic
901235057 1:7663226-7663248 CAGGGACCCCAGCCGCTGTGGGG + Intronic
901495156 1:9616759-9616781 CAGCTTCCCGAGTAGCTGGGAGG - Intergenic
902218676 1:14950728-14950750 CAGCTGACCCAGCATCTGAGTGG - Intronic
902387240 1:16082958-16082980 CACCTCCCAGAGCTGCTGTGAGG + Intergenic
902507616 1:16948328-16948350 CAGCTCTCCCGGCAGCTGAGCGG + Exonic
903332189 1:22601850-22601872 CAGCTCCTCCAGCACCTGAGAGG - Exonic
903376448 1:22869424-22869446 CATCTCCCCCAGCACCTCTTGGG - Intronic
903546321 1:24125649-24125671 AGGTTCCCCAAGCAGCTGTGCGG + Intronic
903779932 1:25814619-25814641 CATCTCCCAAAGCTGCTGTGAGG - Intronic
904080495 1:27869434-27869456 CCCCGCCCCCACCAGCTGTGAGG - Intergenic
904310746 1:29628051-29628073 CAGCTCCCCTTGCATCTGGGTGG + Intergenic
904400987 1:30256610-30256632 CAGCTCCTCCAGCAACTGGAGGG - Intergenic
904592638 1:31623566-31623588 CAGGTCCCCCAGCTGGTCTGAGG - Exonic
904617671 1:31758653-31758675 CATCTCCCCCAGCCCCTGTATGG - Intronic
905447840 1:38038862-38038884 CAGCTCTACCAGCTTCTGTGTGG + Intergenic
906057708 1:42929603-42929625 CAGCTGTCCCAGCAGCTGTCTGG - Exonic
906670482 1:47650744-47650766 CACCTCCCCCAGCTCCTTTGTGG + Intergenic
906773431 1:48506117-48506139 CAGCACCCCCAGTAGCTGAGAGG + Intergenic
909431190 1:75589706-75589728 CACCTCTGGCAGCAGCTGTGTGG + Intronic
911506651 1:98761393-98761415 CAGCTTGCCCAGAAGATGTGGGG - Intergenic
911587094 1:99704151-99704173 CATCTCACAGAGCAGCTGTGAGG - Intergenic
912713245 1:111964432-111964454 CAGCTGCCTCAGGAGCTGTGGGG - Intronic
912799942 1:112714443-112714465 CAGCTTCCCCAGGAGCGGGGAGG - Intronic
912860715 1:113211439-113211461 CTACTCCCCCACCAGGTGTGTGG - Intergenic
915294842 1:154912713-154912735 CAGCTCCCCCAGGAGACGAGAGG - Intergenic
916211144 1:162360894-162360916 CAGCTCCTCCATCAGAAGTGAGG - Intronic
916858253 1:168774429-168774451 CAGCTCAGCCAGCTGGTGTGAGG + Intergenic
917285501 1:173418185-173418207 CACCTCCACCAGCAGCTGGTAGG + Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918181930 1:182091605-182091627 CAGCTCGCTAAGCAGCTGGGTGG - Intergenic
918752687 1:188292485-188292507 CATCTCCAACAGCAGCTGTGTGG + Intergenic
919933368 1:202235954-202235976 CAGCTCCCACAGCGCCTCTGCGG - Exonic
920120220 1:203650598-203650620 CAGCTCCCCCGGCCTCTGCGCGG - Intronic
921358532 1:214308691-214308713 CAACTCCACCATCTGCTGTGTGG - Intronic
921373820 1:214452590-214452612 GGGCTCCTGCAGCAGCTGTGAGG - Intronic
921875837 1:220195077-220195099 CAGCTACCCCATTAGCTGTAAGG - Exonic
922373014 1:224929954-224929976 GCGCTCCCACAGCAGCTGGGTGG - Intronic
924552242 1:245089619-245089641 CCTCTCCCACAGCAGATGTGGGG + Intronic
924775872 1:247114268-247114290 AAGTTCCCTGAGCAGCTGTGTGG + Intergenic
924821070 1:247491360-247491382 CAGGTTCCACAGCAGCTGAGGGG - Intergenic
1062785070 10:257784-257806 GAGCTCCTACAGCATCTGTGTGG + Intergenic
1062868335 10:876608-876630 CAGTCCACCCAGCAGCTGTCAGG + Intronic
1063176721 10:3557377-3557399 CATCTCACCCAGAAGCAGTGAGG - Intergenic
1068620554 10:59176886-59176908 CAGCCCCACCAGCCCCTGTGAGG + Exonic
1069591022 10:69641878-69641900 CTCCTCCCCCAGGAGCTGCGTGG + Intergenic
1069827532 10:71263236-71263258 CAGCTCTGCCAGGAACTGTGTGG + Intronic
1070155895 10:73835149-73835171 CTGCTCCCCCAGCACCTGCCAGG + Intronic
1070537178 10:77388321-77388343 CAGCCCCACCAGGAGCTTTGTGG - Intronic
1071670855 10:87608284-87608306 CAGATGCCCCAGGAGCTCTGGGG - Intergenic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1073062152 10:100739409-100739431 CTCCTCTCCCAGCAGCTGTGTGG - Intronic
1073223338 10:101894752-101894774 CAGCCCCCCAAGTAGCTGTCAGG - Intronic
1073301025 10:102471042-102471064 CCGCCGCCTCAGCAGCTGTGTGG - Exonic
1073331688 10:102674187-102674209 CAGCTCCCACGGCTGCTGGGAGG - Exonic
1073469445 10:103713797-103713819 CTCCTCCCCCACCTGCTGTGTGG - Intronic
1073985214 10:109200570-109200592 CAGCTCCACCAGCTCTTGTGGGG + Intergenic
1074106013 10:110390179-110390201 CAGGTCCCCCAGCAGCAGGAGGG - Intergenic
1074523485 10:114245366-114245388 CACCTCCCCAGGCTGCTGTGAGG - Intronic
1074708681 10:116158851-116158873 CAGCTCTGCCAGCAGCGCTGAGG + Intronic
1074814612 10:117134731-117134753 CAGCTCCCCCAGCAGCGCCCCGG - Intronic
1074826024 10:117216376-117216398 CGACTCACCCAGCCGCTGTGGGG + Intergenic
1074851508 10:117443008-117443030 CACTTCCTCCAGCAGCTGGGGGG - Intergenic
1074952857 10:118356789-118356811 CAGCTTGCACAGCAGTTGTGAGG + Intergenic
1075097584 10:119482752-119482774 AAGTTCCTCCAGCAGCTGAGAGG - Intergenic
1075418887 10:122286210-122286232 CAGCTCCCTCAGGGGGTGTGTGG - Exonic
1075618904 10:123911335-123911357 CAGGTCCCCCGGCAGCTGCTAGG + Intronic
1075780052 10:125011673-125011695 CAGCTTCCCCAGGGGCTCTGAGG - Intronic
1076124899 10:127966241-127966263 CATCCCCCTCAGCAGGTGTGTGG + Intronic
1076185662 10:128446565-128446587 CAGCCCCCCAAGAAGCTGCGGGG + Intergenic
1076619764 10:131779722-131779744 CAGCTCCAAGAGCAGCTCTGGGG - Intergenic
1076679281 10:132163398-132163420 CAGCTGGCTCAGCAGGTGTGTGG + Exonic
1076715717 10:132362787-132362809 CGGACCCCCAAGCAGCTGTGAGG - Intronic
1076715738 10:132362866-132362888 CGGACCCCCGAGCAGCTGTGAGG - Intronic
1076715768 10:132362983-132363005 CAGACCCCCGAGCTGCTGTGAGG - Intronic
1076715817 10:132363181-132363203 CGGACCCCCGAGCAGCTGTGAGG - Intronic
1076715839 10:132363262-132363284 CGGACCCCCGAGCAGCTGTGAGG - Intronic
1076858390 10:133128321-133128343 CAGGCCATCCAGCAGCTGTGGGG - Exonic
1077057132 11:599667-599689 CAGCCCCACCAGCAGCCCTGTGG + Intronic
1077137326 11:1007444-1007466 CAGCGAGCCCAGCAGCTGAGTGG + Intronic
1077227344 11:1444225-1444247 GAGTGCCCCCAGCAGCTGTGGGG + Intronic
1077392720 11:2307438-2307460 CAGCTCCCCCAGGAGTCCTGAGG - Intronic
1077442214 11:2574160-2574182 CACCTGGCCCTGCAGCTGTGGGG - Intronic
1077669797 11:4146850-4146872 CAGCAGTCCCAGCAGCTGGGAGG + Intergenic
1078188773 11:9074666-9074688 CACCTCACCCAGCAGCTCAGGGG + Intronic
1078251424 11:9619857-9619879 AAGCTTTCCAAGCAGCTGTGTGG + Intergenic
1078363893 11:10691342-10691364 CTGCTCCTCCAGGAGGTGTGGGG + Intronic
1080216353 11:29845976-29845998 CTACTCCCCCAGCCTCTGTGAGG - Intergenic
1081580465 11:44348270-44348292 CACCTCCCAGGGCAGCTGTGAGG - Intergenic
1082774653 11:57235984-57236006 CACCTCCCACAGCAGCAGTGGGG - Exonic
1083152379 11:60800042-60800064 CAGCGTTCCCAGGAGCTGTGAGG - Exonic
1083369163 11:62164853-62164875 CTGCACCCCCAGCACCTCTGGGG - Intergenic
1083807395 11:65083270-65083292 CAGCTCCCTGGGCAGATGTGAGG + Intronic
1083936914 11:65873923-65873945 CTTCTGCCCCAGCAGCTGGGAGG - Intergenic
1084008370 11:66334829-66334851 CGGCTCCCCCAGCAGCTCCGAGG - Exonic
1084072543 11:66745455-66745477 CAGCTCCCCGAGCACAGGTGTGG - Intronic
1086685430 11:89728506-89728528 CAGCTCCCTCCTCAGCTCTGGGG + Intergenic
1089127894 11:116190388-116190410 CAGCCCCCCCACCAGGTGGGAGG + Intergenic
1090981619 11:131727392-131727414 TAGCTGTCCCAGCAGCTGTTGGG - Intronic
1091224945 11:133951510-133951532 GGGCTCCCCCAGCAGCTGTGAGG + Intronic
1091236071 11:134022963-134022985 CAGGTTCCCCAGCTCCTGTGAGG - Intergenic
1091296614 11:134478259-134478281 CAGCCTCCTCAGCAGCTGTGCGG - Intergenic
1092091758 12:5809439-5809461 CAGCTGCCACAGCAACTGTGGGG - Intronic
1092359859 12:7827505-7827527 CAGCTCTCTCAGCAGCTCTCTGG - Exonic
1092372598 12:7929694-7929716 CAGCTCTCTCAGCAGCTCTCTGG - Exonic
1093455396 12:19360212-19360234 CAGCTTCCCCAGTAGCAGTTGGG - Intronic
1093688398 12:22082500-22082522 CAACACTCCCAGCAGCTGAGGGG - Intronic
1094316907 12:29145476-29145498 CAGCTCTCCAGCCAGCTGTGTGG + Intergenic
1095807256 12:46333276-46333298 TAGCTCCCCTAGGAGATGTGTGG - Intergenic
1096522431 12:52191851-52191873 CAGCAGCCTCAGCAGCTGTGAGG - Exonic
1096881914 12:54680163-54680185 TAGCTCCCCCTCCAGCTGTTGGG + Intergenic
1100384222 12:94091014-94091036 CAGCACTCCCAGTAGCTGTGTGG + Intergenic
1101441602 12:104708375-104708397 CAGCTTTCCCTGCAGGTGTGTGG + Intronic
1101724395 12:107377061-107377083 CAGCACTCCCCTCAGCTGTGGGG - Intronic
1102006300 12:109591163-109591185 CAGCTGCCCCAGCAGTGGGGTGG - Intronic
1102011640 12:109622735-109622757 GAGTTCCTCTAGCAGCTGTGGGG - Intergenic
1102227615 12:111240155-111240177 CAGCTCCACCATTGGCTGTGAGG - Intronic
1103513749 12:121493154-121493176 CAGCTACTCCAGAAGCTGAGGGG - Intronic
1103736934 12:123066501-123066523 CCCCACCCCCAACAGCTGTGGGG - Intronic
1103875918 12:124127198-124127220 CTGCTTCCCCAGTAGCTGCGCGG + Intronic
1104760299 12:131294071-131294093 CAGCTCCTCCAGCCCCTCTGTGG + Intergenic
1104819468 12:131666576-131666598 CAGCTCCTCCAGCCCCTCTGTGG - Intergenic
1104840920 12:131825219-131825241 CAGCTTACACAGCAGCTTTGTGG + Intergenic
1104856549 12:131904959-131904981 CAGGGCTCCCAGCAGCTGTGGGG - Intronic
1104864016 12:131942091-131942113 CTGCTCCTGCAGCAGCTGTGTGG - Intronic
1105013880 12:132774225-132774247 CAGCTCCTCCAGCAGCGAGGCGG + Exonic
1105897208 13:24726455-24726477 CAGCCTCCCCAGTAGCTGGGAGG - Intergenic
1106456668 13:29933948-29933970 CAGCTTCCCAGGCAGGTGTGTGG - Intergenic
1107198429 13:37683217-37683239 CAGATGCCCCAGCAGGGGTGAGG - Intronic
1108856470 13:54799675-54799697 CAGCTCCACCTGCAGCCCTGTGG - Intergenic
1113596934 13:111540070-111540092 GTGCTCCCCCTGCAGCTGTGAGG - Intergenic
1113644246 13:111981171-111981193 CAGCTCCTCCTGAGGCTGTGGGG + Intergenic
1113778010 13:112959955-112959977 CAGCACCTCCTGCAGGTGTGGGG + Intronic
1113880248 13:113621342-113621364 CAGCTCCCCCAGCCGTGGGGTGG + Intronic
1113916933 13:113879818-113879840 GTGCTCCCCCAACAGCTGGGAGG + Intergenic
1114643721 14:24241980-24242002 CAGCTCCACCACCACCTGTACGG + Exonic
1117092972 14:52268575-52268597 CAGCTCCTCCAGGGGCTGAGGGG - Exonic
1117727529 14:58689358-58689380 CAGCCTCCCAAGCAGCTGGGAGG - Intergenic
1119033675 14:71212239-71212261 AAGCTAGCCCAGCATCTGTGAGG - Intergenic
1121458260 14:94053313-94053335 CAGCCTCCCAAGCAGCTGGGAGG + Intronic
1121548395 14:94779792-94779814 CAGCTCCCCTAGAAGCTGGCTGG + Intergenic
1121804431 14:96803661-96803683 CAGCACCCCCTTCATCTGTGAGG - Intronic
1122016899 14:98803908-98803930 CTCCTCCCAGAGCAGCTGTGAGG - Intergenic
1122323294 14:100868039-100868061 CAGCTCCCCCAGCCACTGCATGG + Intergenic
1122387306 14:101357955-101357977 CAGCCCTCCCAGCTGCTCTGTGG - Intergenic
1122387320 14:101358026-101358048 CAGCCCTCCCAGCTGCTCTGTGG - Intergenic
1122609802 14:102974064-102974086 CAGCCCCCGCAGCCGCTGCGTGG + Exonic
1122617482 14:103029974-103029996 CAGCCCTCCCAGCACCTGAGGGG + Intronic
1124195610 15:27624120-27624142 CCACTCGCCCAGCTGCTGTGGGG + Intergenic
1125033143 15:35093007-35093029 CAGCTCCCGCCGCAGCTCTCTGG - Intergenic
1125241462 15:37582027-37582049 CAGCTGCAGCCGCAGCTGTGTGG - Intergenic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1127331908 15:57948023-57948045 CTGCTCCTCCTGCAGCTTTGGGG + Intergenic
1128562379 15:68677398-68677420 CAGCTCCACCCTCTGCTGTGTGG - Intronic
1128718257 15:69926168-69926190 CAGTTCCCACAGCTGCTGAGGGG + Intergenic
1129407185 15:75327587-75327609 TAGTGCCCCCAGCTGCTGTGCGG + Intergenic
1130527703 15:84721516-84721538 CAGCTGTCCCTGCAGCTGTCTGG - Intergenic
1130780189 15:87028888-87028910 CAGCTCCTCCTGGATCTGTGAGG + Exonic
1132157451 15:99505811-99505833 CAGCTTCCCAAGTAGCTGGGAGG - Intergenic
1132590691 16:725131-725153 CACTTCCCCCTGCAGCTGTGGGG + Exonic
1132725925 16:1338347-1338369 CCGGTCACCCAGCAGGTGTGGGG + Intronic
1132746386 16:1438083-1438105 CAGCTCGCCAGCCAGCTGTGCGG + Exonic
1132859750 16:2064351-2064373 CAGGTCCACCAGCAACTGGGTGG - Exonic
1132879231 16:2154214-2154236 CAGAACCCTCAGCAGGTGTGTGG + Intergenic
1132882354 16:2168023-2168045 GGGCTCCCTCAGCAGATGTGGGG - Intronic
1134570329 16:15285095-15285117 TAGGTCTCCCAGCAGCTGGGGGG + Intergenic
1134732047 16:16470958-16470980 CAGGTCTCCCAGCAGCTGGGGGG - Intergenic
1134739671 16:16531393-16531415 CAGCTTTCCAAGGAGCTGTGTGG - Intergenic
1134927828 16:18180759-18180781 CAGCTTTCCAAGGAGCTGTGTGG + Intergenic
1134935394 16:18241005-18241027 CAGGTCTCCCAGCAGCTGGGGGG + Intergenic
1135314295 16:21431205-21431227 CAGCCCCCCAAGTAGCTGGGAGG - Intronic
1135367218 16:21863483-21863505 CAGCCCCCCAAGTAGCTGGGAGG - Intronic
1135421603 16:22308891-22308913 AAGCACCCCCACCAGCTATGAGG - Intronic
1135444596 16:22507677-22507699 CAGCCCCCCAAGTAGCTGGGAGG + Intronic
1136022445 16:27448830-27448852 CACCTGGCCCTGCAGCTGTGAGG + Exonic
1136324407 16:29511690-29511712 CAGCCCCCCAAGTAGCTGGGAGG - Intergenic
1136368594 16:29821477-29821499 CTGCTCCCCCAGAACCTGGGAGG - Intronic
1136439092 16:30251672-30251694 CAGCCCCCCAAGTAGCTGGGAGG - Intronic
1136858558 16:33680849-33680871 CAGCCAGCCCAGCAGCTGGGGGG + Intergenic
1138530651 16:57632578-57632600 CAGCTCTCCCAGCAGTAGCGGGG - Intronic
1139600136 16:67981540-67981562 CAGCTCCCTAAGTAGCTGGGAGG + Intergenic
1139796580 16:69487594-69487616 CAGCCTCCCAAGCAGCTGGGAGG - Intergenic
1139963168 16:70729512-70729534 CAACTCCCCCAGCAGCATTCAGG + Intronic
1140415515 16:74771442-74771464 CAGCCTCCCAAGCAGCTGGGAGG + Intronic
1140509838 16:75499013-75499035 CAGCCCCCTCAGCAGCACTGGGG - Intergenic
1140515634 16:75539221-75539243 CAGCCCCCTCAGCAGCACTGGGG - Exonic
1141392597 16:83677286-83677308 TACCTCCCCCAGCCACTGTGTGG - Intronic
1141476125 16:84274679-84274701 CAGCACTCCCAGTAGCTGAGGGG - Intergenic
1141663661 16:85454682-85454704 CGGCACCGCCAGCAGCTGGGAGG - Intergenic
1141716513 16:85730087-85730109 CAGCTCCCCCAGGGGCTCTGAGG - Intronic
1141908828 16:87044870-87044892 GAGCTCCCTCAGCAGGTCTGTGG - Intergenic
1142194700 16:88734012-88734034 CTGCTCCTCCCGCAGCAGTGGGG + Exonic
1142196052 16:88739782-88739804 CCTCGCCCCCAGCTGCTGTGTGG - Intronic
1142667125 17:1469591-1469613 CAACTCCCGCAGAAGCTCTGAGG + Exonic
1143654226 17:8284098-8284120 CAGCCTCCCCAGTAGCTGGGAGG + Intergenic
1143781505 17:9231876-9231898 CAGCGCCCTCAGCAGCAATGGGG - Intronic
1144080628 17:11760839-11760861 CAGCTCCCCCATCCGCAGGGTGG - Intronic
1144712985 17:17414566-17414588 CAGCTCTCCCTGGGGCTGTGGGG + Intergenic
1145984735 17:29037894-29037916 CAGATGCCCCAGCAGCTGGCAGG + Intronic
1146323117 17:31862177-31862199 CAGCCTCCCGAGCAGCTGGGTGG - Exonic
1146341245 17:32021334-32021356 CTGCTCCCCCAGCAGCCCCGGGG + Exonic
1147720515 17:42536767-42536789 CGCCGCCTCCAGCAGCTGTGTGG + Intronic
1148125225 17:45233246-45233268 CAGCTCCCGTAGCACCTGCGTGG - Exonic
1148262587 17:46196127-46196149 CAGCTACTCCAGAAGCTGAGGGG + Intronic
1148394285 17:47295807-47295829 CTCCTCCCCCAGCTGCTGTGAGG + Intronic
1148536349 17:48442238-48442260 CAGCTCCTACAGAAACTGTGTGG + Intergenic
1148909457 17:50932904-50932926 CTGCTTCTCCAGCAACTGTGCGG - Intergenic
1149459144 17:56813116-56813138 CAGCTCCCCCAGCCCCTGCCGGG + Intronic
1149881025 17:60290701-60290723 CAGCCCCCCACCCAGCTGTGGGG - Intronic
1151047113 17:70933591-70933613 CAGCTACTCCAGAAGCTGAGGGG + Intergenic
1151244251 17:72782246-72782268 CTGCACCCCCAGAAGCTGGGAGG + Intronic
1151360401 17:73585194-73585216 CAGCTCTGCCTCCAGCTGTGTGG - Intronic
1151728301 17:75896911-75896933 CTTCTCCTCCAGCAGCTGCGCGG + Exonic
1152085629 17:78216434-78216456 CATCTCCCCCCACATCTGTGTGG - Intronic
1152100297 17:78297591-78297613 CAGCACCCCCACAAGCAGTGGGG + Intergenic
1152347202 17:79760465-79760487 CAGCCCCCCAGGCAGCAGTGTGG + Intergenic
1152510398 17:80782966-80782988 CACCTCCCCCAGTAGCTCTGGGG - Intronic
1152610886 17:81314558-81314580 CAACTCCCCCAGCACCGGGGTGG + Intronic
1152707530 17:81852466-81852488 GAGCTCACCCCGCAGCTGAGAGG - Intronic
1152754042 17:82079594-82079616 CAGCGCCTCCAGCACCTGTGGGG + Exonic
1152759795 17:82101838-82101860 CAGCTCCTCCAGCAGCCGACAGG - Exonic
1152888610 17:82867152-82867174 CAGCTCCCCCAGCACCTCCGTGG + Intronic
1153855146 18:9137354-9137376 CAGCCCCGCCAGCCGCGGTGAGG - Intronic
1154344699 18:13532129-13532151 CAGCTGCCTCTGCAGCTCTGAGG - Intronic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1156375608 18:36512567-36512589 CAGCTGCCCCAGCTGCAGGGGGG + Intronic
1156499499 18:37548579-37548601 CAGCACCCCTATCAGCTCTGAGG - Intronic
1157200781 18:45657686-45657708 CAGCTCTGCCAATAGCTGTGTGG + Intronic
1157337855 18:46754790-46754812 CAGCAGCCCCAGCAACTTTGGGG + Intronic
1157698646 18:49745308-49745330 CAGATGCCCCAGCTGCTGTGTGG + Intergenic
1157700596 18:49759648-49759670 CAGTCCCCCCAGCAGCTCTTAGG - Intergenic
1161032242 19:2062938-2062960 CAGCTTCCCCAGTAGCTGCACGG + Intergenic
1161300253 19:3539054-3539076 CACCTCACCCCGCAGCTGGGAGG + Intronic
1161391918 19:4025536-4025558 CACCGCCCCCACCTGCTGTGGGG + Intronic
1161428521 19:4217511-4217533 CAGGGCCGCCCGCAGCTGTGTGG - Exonic
1161465629 19:4428775-4428797 CAGCTCCTCCAGCAGCAGAGCGG + Exonic
1161586199 19:5107143-5107165 CAGCTTCCCCGGCAGCTCTCAGG + Intronic
1161640989 19:5423000-5423022 CAGCTCACACAGCAACTGTGAGG + Intergenic
1162236592 19:9314519-9314541 CAGGTCACCCAACAGCTGTTGGG + Intergenic
1162358090 19:10199649-10199671 CAGTTCCCCCAACAGCTGGTAGG + Intronic
1162721988 19:12668144-12668166 CATCTCCCCCAGCAGCAGGCAGG + Exonic
1162799505 19:13103005-13103027 CCGCTCCCCCAGCCACTGTAGGG + Intronic
1163141857 19:15355110-15355132 CTGCTCTTCCAGCAGCTGTTCGG + Exonic
1163369001 19:16891637-16891659 CAGCCTCCCCAGTAGCTGGGTGG - Exonic
1163393045 19:17042146-17042168 CAGCTCACTCAGCAGATGTTTGG - Intergenic
1163482769 19:17567828-17567850 CAGCCTCCCGAGCAGCTGGGAGG - Intronic
1163611000 19:18301495-18301517 CATCTCGCCTAGCACCTGTGGGG - Intergenic
1163627315 19:18397570-18397592 CAGCGACCCCAGCAGCGCTGCGG - Exonic
1163640663 19:18460277-18460299 CTTCCCCCCAAGCAGCTGTGGGG - Intronic
1165027067 19:32969785-32969807 CGGCTCCCCCAGGAGCAGAGAGG + Intronic
1165732564 19:38155705-38155727 CAGCTCCCCCAGATGCTGTGGGG + Intronic
1166303347 19:41924049-41924071 CACCTCCCCCACAAGCTGTTTGG - Intronic
1166522005 19:43486833-43486855 CAGCTCTCCCGCCAGCAGTGGGG - Exonic
1166687459 19:44804134-44804156 CAGCACCCCCAGCCGCCCTGTGG - Intergenic
1166755374 19:45187448-45187470 GGGCTCCCCAAGCAGGTGTGGGG - Intronic
1166761659 19:45228060-45228082 GTGCTCTTCCAGCAGCTGTGAGG + Exonic
1168241586 19:55091653-55091675 CAGCTCCTCCTCCAGCTCTGCGG + Exonic
926112540 2:10192409-10192431 GAGCTCCCCGAGCTGCTGTAGGG - Intronic
926136480 2:10340192-10340214 CAGCCCCTCAACCAGCTGTGTGG + Intronic
926220154 2:10931012-10931034 CACCTCCCCCACCATCTGTTTGG + Intergenic
926607255 2:14909828-14909850 CATGTCCAGCAGCAGCTGTGGGG + Intergenic
928021215 2:27706538-27706560 CAGTTCCCCAAGCAGCAGTCTGG - Exonic
929276263 2:40028111-40028133 CGGCTTCCTCAGCAGCTGTCAGG - Intergenic
929531276 2:42754581-42754603 GAGCTCCCTGAGCAGATGTGAGG + Exonic
929570492 2:43019798-43019820 CAGGACCCCCAGCAGATGAGAGG + Intergenic
930204026 2:48570979-48571001 CAGCCTCCCGAGTAGCTGTGAGG + Intronic
931071656 2:58658383-58658405 ATGCTCCCCCAGAAGCTGTGGGG - Intergenic
932582536 2:73001132-73001154 TAGCTTCCTCAGCAGATGTGGGG + Intronic
933811605 2:86036159-86036181 CAGCTCCACCACCTGCTGTTTGG + Intronic
934713218 2:96528821-96528843 CAGCTCCCCAAGGAGCTCAGAGG - Intergenic
934945703 2:98539789-98539811 CCTCTCCCCCTGCAGCTCTGTGG + Intronic
934987443 2:98898007-98898029 CAGCTTCCCCAGCTGCATTGAGG - Intronic
935182661 2:100704524-100704546 CAGCTCCACCAGCAACTGGCTGG + Intergenic
935333366 2:101993896-101993918 CAGCTCCCACTGCAGCCATGCGG - Intronic
935453930 2:103243542-103243564 CAGCTCCACTTTCAGCTGTGGGG + Intergenic
936462187 2:112722089-112722111 CACCTTCCCCACCAGGTGTGTGG + Exonic
936743494 2:115544789-115544811 CACCACCACCAGCAGCAGTGAGG - Intronic
937216368 2:120316125-120316147 GAGTTCCCACAGCTGCTGTGTGG + Intergenic
937230110 2:120393403-120393425 CAGCTTCCCCATCAGAGGTGGGG + Intergenic
938763770 2:134446931-134446953 CAGAAGCCCCAGCAGATGTGCGG + Intronic
942909979 2:181231484-181231506 CAGCTCTCCCTGCAGCTGCACGG + Intergenic
944718181 2:202396230-202396252 CAGCTCATCCAGCAGCTCAGTGG - Intronic
944771763 2:202921942-202921964 CAGCTTCCCAAGAAGCTATGGGG + Intronic
945182612 2:207107237-207107259 CCGATGCCACAGCAGCTGTGGGG - Intronic
946245540 2:218385139-218385161 CAGCACCCAGAGAAGCTGTGAGG - Exonic
946869444 2:224072621-224072643 CAGATGTCCCAGCAGCTGGGAGG + Intergenic
947078542 2:226370055-226370077 CACCTTCCCCAGCATCAGTGAGG - Intergenic
947136172 2:226978870-226978892 AAGCTCTCCCAGCTACTGTGTGG + Intronic
947519189 2:230830665-230830687 CAGCTTATCCATCAGCTGTGTGG + Intergenic
948174004 2:235928897-235928919 CACCTCCCCCGGCTGCTGTGAGG + Intronic
948830927 2:240597919-240597941 CGGCTCCTGCAGCAGCAGTGGGG - Exonic
948866918 2:240780230-240780252 CCGCTCCCCGAGCAGCTGCATGG + Intronic
948899452 2:240949029-240949051 CAGCTGCTCCTGCAGCTTTGTGG - Intronic
948999074 2:241602018-241602040 CAGCTCACCCAGCAGCTGCTCGG + Intronic
949014765 2:241702721-241702743 CGGCGCCCCCAGCGGCTGAGCGG + Intronic
1169417995 20:5433828-5433850 AAGAGCCCCTAGCAGCTGTGTGG + Intergenic
1169778929 20:9288004-9288026 CAGCTCCACCAGCAGGATTGTGG + Intronic
1172627593 20:36357038-36357060 AAGATCACCCAGCAGCTTTGTGG - Intronic
1174114242 20:48215862-48215884 GAGCTGCCTCAGGAGCTGTGAGG - Intergenic
1174381017 20:50155456-50155478 CTGCTCCCCCAGCACCTTTCAGG - Intergenic
1174416093 20:50368190-50368212 CCGCTCTCCCTGCTGCTGTGTGG + Intergenic
1174435868 20:50506385-50506407 CAGCACCCCCTGCAGGCGTGAGG + Intergenic
1174570713 20:51499187-51499209 CAGATCCTCTGGCAGCTGTGTGG + Intronic
1175457114 20:59123778-59123800 AAGATCCCTTAGCAGCTGTGTGG - Intergenic
1175704760 20:61168420-61168442 CAGCTCCCCCTGCAGATCTCAGG - Intergenic
1176083454 20:63285244-63285266 CAGCTCCGCGGCCAGCTGTGGGG - Intronic
1176146252 20:63566790-63566812 CCCCTCCCCCAGCAGGGGTGCGG + Intronic
1176417526 21:6486158-6486180 CAGCTCCCGCCGCAGCTCTCTGG + Intergenic
1178396865 21:32250526-32250548 CAGCTGCCCCATAAGCTGTAGGG - Intergenic
1178496968 21:33094954-33094976 GAGTCCCACCAGCAGCTGTGAGG + Intergenic
1178772757 21:35521085-35521107 AAGCTCCCCCTGAAACTGTGGGG + Intronic
1179192524 21:39135634-39135656 CAGCTGCCTCTGCAGCTATGAGG + Intergenic
1179215620 21:39364794-39364816 CAGCCTCCCGAGCAGCTGGGAGG + Intergenic
1179693022 21:43094491-43094513 CAGCTCCCGCCGCAGCTCTCTGG + Exonic
1180108395 21:45634608-45634630 CAGCCGCCGCAGCAGATGTGGGG - Intergenic
1181526722 22:23493740-23493762 CAGCTCACCCAGGAGCTGAGCGG + Intergenic
1181760039 22:25052011-25052033 CAGCTCCCCCAGCAGCTGTGTGG - Intronic
1181783096 22:25207194-25207216 CCGCTTCCCCAGCAGCTGAAAGG + Exonic
1182294061 22:29302837-29302859 CAGCAGTACCAGCAGCTGTGGGG + Intergenic
1182698508 22:32212204-32212226 CAGCCCCCACTGCAGCTGTGAGG - Intergenic
1183060927 22:35335950-35335972 CATCTTTCCCAGCTGCTGTGCGG - Intronic
1183342803 22:37291258-37291280 CAGGTCCCCAGGCAGCGGTGTGG - Intronic
1183381145 22:37491164-37491186 AGGCTGCCCCAGCAGCAGTGAGG - Exonic
1183391372 22:37547160-37547182 CGGCTGGGCCAGCAGCTGTGGGG - Intergenic
1183406174 22:37631723-37631745 CAGCTTCCCCCGATGCTGTGTGG - Intronic
1183556967 22:38536095-38536117 CAGCCTCCCGAGCAGCTGGGAGG - Intronic
1183591860 22:38783641-38783663 CTGCTGGCCCAGCAGCTGGGAGG + Intronic
1183710203 22:39498843-39498865 CTGCTCCCCCTGCAGCTAAGGGG + Intergenic
1184489572 22:44801023-44801045 CGCCTCTCCCCGCAGCTGTGTGG + Intronic
1185091626 22:48778816-48778838 CAGCTCCCCTGGCTGCTGTGGGG + Intronic
1185210530 22:49568351-49568373 CAGCACTCCCTGCAGCAGTGGGG + Intronic
950195516 3:11006556-11006578 AAGACCGCCCAGCAGCTGTGTGG - Intronic
950477641 3:13224007-13224029 AAGGTCACCCAGCAGCTCTGGGG - Intergenic
950534434 3:13571036-13571058 CACCTCCCAGAGCAGCTGGGGGG - Exonic
950653470 3:14422304-14422326 CAGCTCTGCCAGCAAGTGTGTGG - Intronic
951356075 3:21668138-21668160 CAGCACTCCAAGCAGCTGAGAGG - Intronic
952402444 3:32975469-32975491 CAACTCCCCTAACTGCTGTGAGG - Intergenic
952580979 3:34833048-34833070 CAGCTGACCCAGCAGTTCTGAGG + Intergenic
953168857 3:40489309-40489331 CAGCTTCCCAAGAAGCTGGGAGG + Exonic
953840453 3:46386028-46386050 CAGCCCCCCAAGTAGCTGGGAGG + Intergenic
953929320 3:46998104-46998126 CTGCTCCATCAGCAGCTGGGCGG - Exonic
954370867 3:50169013-50169035 CACCTCCCCCAGCAGTGATGGGG - Intronic
954445909 3:50546828-50546850 CAGCTCCCCCAGGAGCCTGGAGG + Intergenic
956162185 3:66366849-66366871 CAGGTCCCGCACCAGCTGTGTGG + Intronic
956214092 3:66830519-66830541 CAACTCCACCAGCAGCCATGAGG + Intergenic
961639785 3:128357924-128357946 CAGTCCCCACAGCAGCTCTGTGG - Intronic
961664204 3:128486195-128486217 CAGGGCCTCCAGCAGCTGAGGGG + Exonic
961674664 3:128557219-128557241 CAGCTTCCCCAGCCGGTGTGAGG + Intergenic
961786935 3:129352984-129353006 AAGGTCACCCAGCAGCTCTGGGG + Intergenic
966656490 3:182364386-182364408 CAGCCCTGCCAACAGCTGTGTGG - Intergenic
967388357 3:188931278-188931300 CAGCTAACTCAGCAGCTTTGGGG - Intergenic
967534482 3:190586649-190586671 CAGCTCCTCCATCAACTGTCTGG - Intronic
967933096 3:194704910-194704932 CAGCTTCCCCCGCAGATGTCTGG + Intergenic
968460833 4:723976-723998 TCCCTTCCCCAGCAGCTGTGAGG + Intronic
968472721 4:789484-789506 CAGCTCCCACAGCGGCTAGGAGG - Intronic
968490270 4:886404-886426 CTCCCTCCCCAGCAGCTGTGGGG - Intronic
968510257 4:992420-992442 CTGCTCCCCCAGCAGACTTGGGG - Intronic
968638433 4:1696089-1696111 CAAGTCCCCCAGCAGCTGTTGGG - Intronic
968678187 4:1897049-1897071 CAGCCTCCTGAGCAGCTGTGAGG - Intronic
968697088 4:2036405-2036427 CAGCTCCCCCAGCTGCCATCAGG + Intronic
969161279 4:5261101-5261123 CAGTACCTCCAGCAGCTGGGGGG + Intronic
969236194 4:5866518-5866540 CACCTCCCCCAACCTCTGTGAGG + Intronic
969925748 4:10584181-10584203 CAGTTCTCCCAGCTGCTGGGTGG + Intronic
970050223 4:11905861-11905883 CAGCTCCTCCATCATCTGTGCGG - Intergenic
973296334 4:48525427-48525449 CAGTGCCCCCTGCAGATGTGAGG - Intronic
973764225 4:54149261-54149283 CAGCTCTGCCAGCAGCCTTGGGG - Intronic
975008616 4:69321653-69321675 GAGCTCCTCCAGAATCTGTGAGG + Intronic
975663511 4:76710344-76710366 CTCCTCTCCCAGCAGCTGAGTGG - Intronic
975738126 4:77401560-77401582 CAGCTTTCCCAGCAGCTGCTTGG - Intronic
977177465 4:93834700-93834722 CAGCTCCCCGGGGAGCTGTGCGG + Intergenic
978283888 4:107051780-107051802 CACCTCTGCCAACAGCTGTGTGG + Intronic
978405387 4:108373239-108373261 CATCTGCTCCAGCAGCAGTGCGG - Intergenic
981569225 4:146133997-146134019 CATCTCCACCAGCATCAGTGTGG + Intergenic
983136669 4:164092414-164092436 CAGCTCCCCCACCTTCTGTCAGG - Intronic
983935517 4:173500301-173500323 CTGCTCCCCCAAGAGCTGCGGGG + Intergenic
984764382 4:183388392-183388414 CAGGTCACCCAGCAGTTGTGTGG - Intergenic
985210380 4:187586497-187586519 CACCACCACCAGCAGCCGTGGGG - Intergenic
985318098 4:188680008-188680030 CAGCTTCTCCAGCTGCTGCGGGG - Intergenic
985538603 5:477577-477599 CCCCTCCCTCTGCAGCTGTGAGG - Intronic
985574308 5:666445-666467 CAGCTCCCGGCGCAGCTGGGCGG - Intronic
985575331 5:671079-671101 CAGCCCCCCGACCGGCTGTGTGG - Intronic
985584212 5:720068-720090 CTGCTCCCCCATTATCTGTGGGG - Intronic
985597714 5:804398-804420 CTGCTCCCCCATTATCTGTGGGG - Intronic
985693087 5:1324337-1324359 CAGCTCCCCCAACAGCAATGGGG + Intronic
985987809 5:3532096-3532118 CCGGACCCCCAGCAGGTGTGTGG + Intergenic
986266222 5:6193533-6193555 CACCTGCTCCAGCACCTGTGTGG - Intergenic
986636778 5:9830039-9830061 CTGCTCCCACAGCAGGTGGGAGG + Intergenic
988181255 5:27796991-27797013 CAGCTCCTCCAGCTGCAGTTGGG + Intergenic
989999361 5:50875160-50875182 CACCTCCTCCATCAGATGTGTGG + Intergenic
993739058 5:91514567-91514589 CTGCTCTCTCAGCAGCTGTGCGG + Intergenic
996691288 5:126342945-126342967 CAGCTGCCCCAACGGCTGAGAGG + Intergenic
997572924 5:134946770-134946792 CTACTCCCCCATCATCTGTGGGG - Intronic
998058233 5:139097257-139097279 CAGCTCCCCCAGGTGCTATGTGG - Intronic
998458503 5:142292263-142292285 CACCTCCAACAGCAGCTGGGTGG - Intergenic
998521913 5:142808688-142808710 CAGCTCGACCACCAGCTGGGAGG - Intronic
999240100 5:150122423-150122445 CAGCTCCCCAAAGAGCTGTGGGG + Intronic
999320970 5:150614842-150614864 CAGCAACCCCAGGAGCTGTGGGG + Intronic
1000462928 5:161545275-161545297 CAGGTCCCCCCGTGGCTGTGGGG - Exonic
1000542409 5:162556177-162556199 CAACTCTCCCAGCAGCAATGTGG - Intergenic
1001600232 5:172923683-172923705 CTGCTCCCCCTCCAGCTCTGTGG - Intronic
1002061856 5:176630099-176630121 CAGCTGCCCGGGCGGCTGTGGGG - Intronic
1002278196 5:178116359-178116381 CAGCTCCCCCAGCAGGGCGGGGG - Intronic
1002577088 5:180180100-180180122 CACATCCACCAGCAGCTCTGGGG + Intronic
1003291385 6:4781569-4781591 CATTTGCCCCAGCAGCAGTGTGG + Intronic
1004143605 6:13044672-13044694 CACCTCCACCAGCAGCTATTAGG + Intronic
1004176124 6:13341700-13341722 CAGCTCCCCCAGCACCAGAGAGG + Intergenic
1005688747 6:28281576-28281598 CGGCGCCTCCAGCAGCTGGGCGG - Exonic
1006524776 6:34594532-34594554 CATATCCCCTAGCAGATGTGGGG - Intronic
1006613796 6:35311523-35311545 CACCTGCCCCAGCAGCTTTTTGG - Intronic
1006929250 6:37677906-37677928 TATCTCCCCCTGCAGCTGGGTGG - Intronic
1006976276 6:38105291-38105313 CAGCTACTCCAGAAGCTGAGGGG + Intronic
1007454701 6:41967624-41967646 CATCTCCCGCAGCAGCTGCTGGG + Intronic
1007576541 6:42928844-42928866 AAGCTCCCACAGCAGCTAGGAGG + Intergenic
1007687433 6:43675303-43675325 CAGCTCCCTCTGCAGCTCTGAGG + Intronic
1007982563 6:46173963-46173985 CAGAATCCCCAGCAGCTGTTAGG - Intergenic
1010475852 6:76286496-76286518 CAGCTTCACCAGCAGCTATAAGG - Intergenic
1011884388 6:92076058-92076080 CTGCACCCACAGCAGCTCTGTGG - Intergenic
1014371439 6:120613692-120613714 CAACACTGCCAGCAGCTGTGGGG - Intergenic
1018676847 6:166229559-166229581 CAGCTCCCTCAGCAACTGGGTGG - Intergenic
1018867242 6:167755812-167755834 CAGCAGCCCCTGCAGCTCTGGGG - Intergenic
1019049827 6:169174267-169174289 CAGAGCCCCTACCAGCTGTGTGG - Intergenic
1019158952 6:170056947-170056969 CAGCTCACCCAGCATGTGTGAGG + Intergenic
1019398415 7:836088-836110 CACCTCCCCCAGCAGCCGACAGG - Intronic
1019693897 7:2433749-2433771 CAGGACCGCCAGCAGCTGGGAGG + Exonic
1019864143 7:3689232-3689254 CAGCTTCCCTTGCAGCTATGGGG + Intronic
1020063524 7:5170134-5170156 CAGCTTCCCAAGTTGCTGTGGGG - Intergenic
1020252389 7:6479903-6479925 CAGCTCCCTCTGTAGCTGTTTGG - Intronic
1020272762 7:6607068-6607090 CAGCTCCCCCAGCCGAGGCGAGG - Intronic
1022649218 7:32259476-32259498 CAGCTCCCCCAGCTGGTGGGAGG - Intronic
1022818464 7:33935702-33935724 CAGCAGCCCCTGCAGGTGTGGGG + Intronic
1022848997 7:34240561-34240583 CAGCTCCCCAGGCCTCTGTGTGG - Intergenic
1022860651 7:34363203-34363225 CAACTCCTCCAGCTCCTGTGGGG - Intergenic
1023700559 7:42888410-42888432 CAGCTGGCCCAGCAGGTCTGGGG + Intergenic
1023869016 7:44252694-44252716 CACCTGCCCCAGCAGGTGTCTGG + Intronic
1026522201 7:71127273-71127295 CAGCTTCCCTAGTAGCTGGGAGG + Intergenic
1029135415 7:98367008-98367030 CAGCTTCCCGAGTAGCTGGGAGG + Intronic
1029617525 7:101668456-101668478 CAGGTCCCCCAGCCTCCGTGAGG + Intergenic
1031060514 7:117046197-117046219 CAGCTCCACCATCACCTGTAGGG + Intronic
1031111915 7:117620981-117621003 CAGCCTCCCCAGTAGCTGGGAGG - Intronic
1032173048 7:129601695-129601717 CAGCCTCCCCAGTAGCTGGGAGG + Intergenic
1032344769 7:131107607-131107629 CAGCTCCGCCGGCAGCGGAGGGG + Intergenic
1032859441 7:135863291-135863313 CAGCTAGCCCAGGAGCTGTCAGG + Intergenic
1034200781 7:149281845-149281867 CCGCTCGCCCACCAGCTGCGGGG + Exonic
1034345662 7:150383928-150383950 CTCCTCCCCCAGCTGCTGTCTGG + Intronic
1035309038 7:157953194-157953216 CAGAGTCCCCAGCAGCTCTGGGG + Intronic
1035712820 8:1731448-1731470 CACTTCCCGCTGCAGCTGTGTGG - Intergenic
1035734851 8:1880851-1880873 CGGCTGCTCCAGAAGCTGTGTGG - Intronic
1035746051 8:1962698-1962720 CAGCATCCCCAGCTGCTGTGGGG + Intergenic
1036601784 8:10267682-10267704 CTGATCCCCCAGCAGGTGTGGGG - Intronic
1036752062 8:11449654-11449676 CAGGCCACCCAGCAGCAGTGGGG + Intronic
1036772644 8:11589687-11589709 CAGCCCGCACAGCAGCCGTGGGG + Intergenic
1037842106 8:22252081-22252103 CTGCCCAGCCAGCAGCTGTGAGG + Exonic
1038552887 8:28484992-28485014 CAGCTCCCCTAGTAGCTGATTGG + Intronic
1039448104 8:37648616-37648638 CACCTCCCACAGCAGCTCCGTGG - Intergenic
1039525726 8:38214411-38214433 CAGCCTCCCCAGTAGCTGGGAGG + Intergenic
1039936910 8:42052694-42052716 TCCCTCCCCCAGCAGCTGAGAGG + Intergenic
1040550987 8:48437464-48437486 CAGCCTCCCGAGCAGCTGGGAGG + Intergenic
1040779498 8:51091304-51091326 AAGCTCCCCAACCAGCTGAGTGG - Intergenic
1043519426 8:81027989-81028011 CAGCCCCAACAGCAGCTGTGGGG - Intronic
1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG + Intronic
1049181611 8:141225904-141225926 CAGCTGCCCCAGCCTCCGTGCGG + Intronic
1049221929 8:141432343-141432365 TGGCTCCCCCAGCTCCTGTGTGG + Exonic
1049628489 8:143637475-143637497 CAGCAGCCACAGCAGCTCTGGGG - Intronic
1049777865 8:144414781-144414803 CTGCTCCAACAGCAGCTGAGTGG - Exonic
1050792887 9:9495991-9496013 CAGCTCCCGTAGCAGCTGGCTGG + Intronic
1052029500 9:23612026-23612048 CAACTCACCCTGCAGCTGTTAGG - Intergenic
1052192780 9:25678130-25678152 CCGCTCCTCCAGCTGCTGTCGGG + Exonic
1053172865 9:35903430-35903452 AAGCTTACCCATCAGCTGTGTGG + Intergenic
1055787333 9:79884688-79884710 CTGCTCCCCCAGCTGTTCTGTGG + Intergenic
1056830343 9:89911949-89911971 CAGCTCCCCCAGCAGTCAGGAGG - Intergenic
1057016732 9:91658635-91658657 GGCCGCCCCCAGCAGCTGTGTGG - Intronic
1057035407 9:91808503-91808525 CAGCCTCCCCAGTAGCTGGGTGG - Intronic
1057276024 9:93676397-93676419 CAGCACCCACAGCAGCTGCCTGG - Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1059379033 9:113909093-113909115 CAGGTCCCACAGCAGCCGAGGGG - Intronic
1059948367 9:119436345-119436367 CACCTCCCCCACCAGCCTTGGGG - Intergenic
1060212639 9:121719910-121719932 CTACTCCCCAAGCAGGTGTGGGG + Intronic
1060411629 9:123404163-123404185 CCGCTGCTGCAGCAGCTGTGGGG - Intronic
1060817578 9:126643246-126643268 CAGTTCCTCCTGCAGCTGTCTGG - Intronic
1061160188 9:128889315-128889337 ATGCTTCCCCAGCAGTTGTGAGG + Intronic
1061259887 9:129474426-129474448 CAGCTCACCCAGGAGCTGAGAGG - Intergenic
1061631032 9:131872250-131872272 CAGCTCCCCCAGGCGCTGCTCGG - Intronic
1061656984 9:132099819-132099841 CAGCTCCCCAAACAGCTGCAGGG + Intergenic
1061673839 9:132204244-132204266 CAGCTTCCCCAGACCCTGTGGGG + Intronic
1061861014 9:133468860-133468882 CAGAGCCTGCAGCAGCTGTGTGG + Exonic
1061973921 9:134058892-134058914 CCACTGCCCCACCAGCTGTGGGG - Intronic
1062071096 9:134555396-134555418 CAGCCGTCCCTGCAGCTGTGCGG - Intergenic
1062372962 9:136249523-136249545 CAGCTCCCCAGGCAGCTTTGGGG - Intergenic
1062384651 9:136304360-136304382 CAGAGGTCCCAGCAGCTGTGGGG + Intronic
1062397714 9:136359104-136359126 CATCTCCCCCAGCTGGTGGGAGG - Exonic
1062445607 9:136592912-136592934 GAGCTGGCCCAGCAGCTCTGAGG - Intergenic
1062458654 9:136653551-136653573 CAGCTCCCCCTGCACCGGAGCGG - Intergenic
1062662341 9:137644441-137644463 CAGCCTCCCGAGCAGCTGGGAGG + Intronic
1185599675 X:1330201-1330223 CAGCCTCCCCAGTAGCTGGGAGG + Intergenic
1187972562 X:24673662-24673684 GAGCTCCCCCAGCAGTTGGCAGG - Intergenic
1188163143 X:26827109-26827131 CAGCTGCCCCAGCAGAACTGAGG - Intergenic
1189467209 X:41286314-41286336 CAGCCTCCCCTGCAGCTGAGTGG - Intergenic
1190302999 X:49067320-49067342 CAGCTCCCCCACCAGCGGCCCGG - Exonic
1197110757 X:122771525-122771547 CACCTTCCCCAGCAGTAGTGGGG + Intergenic
1198312355 X:135435210-135435232 CAGCTCTCCCAGCAGCTGAGCGG + Intergenic
1198749069 X:139920797-139920819 AAGATCCCCCTGGAGCTGTGTGG + Intronic
1199018675 X:142848960-142848982 GTTCTCCACCAGCAGCTGTGTGG - Intergenic
1199666167 X:150098212-150098234 CAGCTCCCCTATCTCCTGTGGGG + Intergenic
1200154447 X:153967985-153968007 CAACTCCGCCACCAGCTGGGAGG + Intronic