ID: 1181766109

View in Genome Browser
Species Human (GRCh38)
Location 22:25093251-25093273
Sequence CTAGGCTGCCTGCTCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181766109_1181766112 10 Left 1181766109 22:25093251-25093273 CCAGTTTTGAGCAGGCAGCCTAG 0: 1
1: 0
2: 0
3: 3
4: 122
Right 1181766112 22:25093284-25093306 CAGCCTAGGAACCAGATCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 135
1181766109_1181766111 -4 Left 1181766109 22:25093251-25093273 CCAGTTTTGAGCAGGCAGCCTAG 0: 1
1: 0
2: 0
3: 3
4: 122
Right 1181766111 22:25093270-25093292 CTAGCTATGCTTCACAGCCTAGG 0: 1
1: 0
2: 2
3: 2
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181766109 Original CRISPR CTAGGCTGCCTGCTCAAAAC TGG (reversed) Intronic
903271327 1:22190267-22190289 CTAGGCTGCCTGGTCTGAGCAGG - Intergenic
903318597 1:22527866-22527888 CGGGGCTGCCTGCACAAAGCCGG - Exonic
906531619 1:46526996-46527018 TTTGGCTGCTTGCTCCAAACAGG - Intergenic
913525530 1:119688864-119688886 CTAGTCTGCCTGTTGAAAAAAGG - Intronic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
918290043 1:183098674-183098696 CAAGGATACCTGCTCAAGACTGG - Intronic
918348447 1:183628211-183628233 ATAGTGTTCCTGCTCAAAACAGG + Intronic
1063901059 10:10732883-10732905 CCAGCCTGCCTGCTGAAACCTGG - Intergenic
1065791044 10:29261418-29261440 TCAGCCTGCCTGCTCCAAACTGG - Intergenic
1078069584 11:8099502-8099524 TCAGGCTGCCTCCCCAAAACTGG - Intronic
1079101948 11:17547422-17547444 CTCGGCTGCCTGCTCACCCCAGG - Exonic
1079295841 11:19233294-19233316 CTAGATTACCTGCTCAAAATTGG - Intronic
1081566706 11:44264970-44264992 TGAGGCTGGCTGCTCCAAACAGG + Exonic
1085758355 11:79220136-79220158 CTGGGCTGCCTTCCCTAAACAGG - Intronic
1085762211 11:79251473-79251495 CTAAGTTGCTTGCTCAAATCAGG + Intronic
1086735698 11:90302733-90302755 CTAGGTTTCCAGCACAAAACTGG - Intergenic
1088248303 11:107840373-107840395 CTTGGCTGCCTGTTGAGAACAGG - Intronic
1089775031 11:120830070-120830092 CTAGAAAGCCTTCTCAAAACAGG + Intronic
1090641490 11:128732987-128733009 CAAAGCTGCTTTCTCAAAACAGG + Intronic
1092049946 12:5461485-5461507 CTCAGCTCTCTGCTCAAAACAGG + Intronic
1096507607 12:52105047-52105069 TTAGGCTGCCTGGTTCAAACTGG - Intergenic
1105339540 13:19507431-19507453 TTAGGCTGGCTGATGAAAACAGG + Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1115486375 14:33914869-33914891 CCTGGCTGCCTGCTCAAGTCAGG + Intergenic
1116423591 14:44762626-44762648 CTTGGCTGCCTGTTCTAAGCTGG - Intergenic
1118703701 14:68460515-68460537 CTGTGCTGCCTGCTCCACACTGG + Intronic
1120256376 14:82124610-82124632 CTTAACTGCCTCCTCAAAACTGG - Intergenic
1121781371 14:96624501-96624523 CAAGGCTGCCTCCTCCACACAGG + Intergenic
1122857683 14:104567705-104567727 CTCGGCTGCCTCCTCAAAGACGG - Intronic
1127329295 15:57923019-57923041 CTGGGCTGCTTGCCCAAATCTGG - Intergenic
1127837087 15:62798644-62798666 CTAGTCTGTCTGGACAAAACTGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1128906564 15:71472924-71472946 CAAGTCTGCCTGCACAAATCAGG - Intronic
1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG + Intergenic
1130288250 15:82572995-82573017 CCAGGCAGGCTGCTCAAACCTGG + Intronic
1132236710 15:100227544-100227566 CTGGGCTGCCTGATCAATCCAGG - Intronic
1133331380 16:4976736-4976758 CAAGCCTGCCTGCTCAGAAAAGG - Intronic
1134607479 16:15582498-15582520 CTTGTCTGCCTGCCCAAGACTGG - Intronic
1138473303 16:57255698-57255720 CCATGCTGCCTGCTCAGAGCTGG - Intronic
1140160742 16:72490208-72490230 CTAGGGTTCCTGCTTAATACTGG + Intergenic
1140797240 16:78450404-78450426 CTTTTCTGACTGCTCAAAACAGG + Intronic
1142543926 17:685217-685239 CTTTGCTGCCTGTTCAACACCGG - Intronic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1143710334 17:8730117-8730139 CAAGGCTGCCTCCTTAAATCCGG + Exonic
1147711954 17:42473930-42473952 AGAGTCTGCCTTCTCAAAACAGG - Intronic
1148550843 17:48550206-48550228 CCAGGCTTCCTGGTCAGAACCGG - Exonic
1148847272 17:50536797-50536819 CTGGACTACCTGCTCAAGACGGG + Exonic
1149644777 17:58232374-58232396 CTAGCCTGACAGCTGAAAACCGG - Intronic
1155462121 18:26094364-26094386 CAAGCCTGTCTGCTCATAACTGG + Intergenic
1160534452 18:79584772-79584794 CCAGGCTGCCTGCTCCCAGCTGG - Intergenic
1161667406 19:5585685-5585707 CCAGGCTGCCTCCTCAACGCAGG + Intergenic
1161683269 19:5691078-5691100 CTGGGCTGCCTGCTGAATAAAGG - Intronic
1162595443 19:11625329-11625351 TAATGCTGCCTGCTCAAGACAGG + Intergenic
1163223369 19:15937427-15937449 CTAGGCTGCCTGCTCATCCCAGG - Intergenic
1167489976 19:49786923-49786945 CTAGGCTGCCCCCTCCACACTGG + Intronic
931685872 2:64792470-64792492 CTGGACTGCATGATCAAAACAGG + Intergenic
937250676 2:120521928-120521950 CTAGGCTCACTGCTCAACAGGGG + Intergenic
940458147 2:153928205-153928227 CTAGGCTTCCATTTCAAAACAGG - Intronic
940477979 2:154191140-154191162 CAAGGCTGCCTGCTCTAATGAGG + Intronic
945067853 2:205962114-205962136 ATAGGATTCTTGCTCAAAACAGG - Intergenic
1169255282 20:4092089-4092111 CTAGGCTGCTTGTCCAAAAGCGG + Intergenic
1169707696 20:8524560-8524582 CATGGCTGCCTGCTTAAAAAAGG - Intronic
1174390708 20:50216812-50216834 CCAGGCTGCCTGCCCCAACCAGG - Intergenic
1174654708 20:52161127-52161149 CTAGCCTGCCTGCTCACCTCCGG + Intronic
1176734648 21:10534314-10534336 TTAGGCTGGCTGATGAAAACAGG - Intronic
1180562384 22:16629788-16629810 TTAGGCTGGCTGATGAAAACAGG - Intergenic
1181766109 22:25093251-25093273 CTAGGCTGCCTGCTCAAAACTGG - Intronic
1184231997 22:43163331-43163353 CTGGGCTGCCTTCTCCAGACAGG + Intergenic
1185221056 22:49629501-49629523 CTAGACTCCCTGCTCCAACCCGG - Intronic
950904095 3:16521817-16521839 CAAGGCTGCCTGCCAAAACCGGG - Intergenic
953462590 3:43093624-43093646 GTAGACTGCCTGCTCATAAGTGG - Intronic
954434115 3:50486929-50486951 CTTGGCTGCCTGCTGAAATGGGG - Intronic
955284686 3:57628224-57628246 CAAGGCATACTGCTCAAAACGGG - Exonic
956506006 3:69940792-69940814 CTAAACTGCCTGCCCTAAACAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
966346169 3:178982933-178982955 TTGGGGTGCCTGCTCAAAACAGG - Intergenic
972277378 4:37569800-37569822 AAAGGCTCCCTGGTCAAAACAGG - Intronic
978566813 4:110091340-110091362 GTAGGCTGTCTGTTCACAACTGG + Intronic
981788024 4:148502974-148502996 CTGGGCTTCCTGCAAAAAACTGG - Intergenic
987656972 5:20819600-20819622 CTAGTCTCCCTGCTAGAAACAGG - Intergenic
988766578 5:34384348-34384370 CTAGTCTCCCTGCTAGAAACAGG + Intergenic
991161332 5:63507306-63507328 CTAGGTTTCCAGCACAAAACTGG + Intergenic
994020068 5:95012967-95012989 CTAGGCCTCTTGCTCCAAACAGG + Intronic
996120337 5:119664986-119665008 CCAGGCTTCCTGCTTACAACAGG + Intergenic
997960471 5:138316718-138316740 CTATGCTGTCTGCTGAAAGCTGG + Intronic
998115030 5:139530277-139530299 CTAAGCTGCCTGATCAGGACAGG + Intronic
998908314 5:146930564-146930586 CTGGGAAGCCTGTTCAAAACAGG - Intronic
999223673 5:150001820-150001842 CTAAGCACCCTGCGCAAAACGGG - Intronic
999368875 5:151040724-151040746 GTAGGCTGACTGCTCAAATAAGG + Intronic
1001021120 5:168183252-168183274 CTAGGCTGCCTGCTGGAACTGGG - Intronic
1005057894 6:21746834-21746856 CAAGGCTGCCTTCTCAGAGCAGG - Intergenic
1006779540 6:36623026-36623048 CTGGGCTGCCTCATCAAACCAGG + Intergenic
1010541680 6:77099472-77099494 CTAGGATGCATCCTCCAAACTGG + Intergenic
1015593473 6:134844092-134844114 CTAGGCTGCCTGCTCCTTATAGG - Intergenic
1017197865 6:151721668-151721690 CTAGGCAGCATGCCCAAAGCTGG + Intronic
1019731915 7:2633294-2633316 CTAGGCTGCCCGCGGAATACCGG - Intronic
1019972001 7:4548910-4548932 CTAGCCTGCCAGCTCAAGCCAGG + Intergenic
1020038696 7:4984711-4984733 CTAGTCTGCCGGCTCCAGACAGG + Intronic
1023908040 7:44536129-44536151 AGTGGCTGCCTGCTCAGAACGGG - Intronic
1028931963 7:96423287-96423309 CTTGGCTGCCTGATCTAAAACGG - Intergenic
1029293827 7:99523330-99523352 GTAGGCTGCCTGCTGAACGCAGG + Intronic
1030065050 7:105652960-105652982 CAAGGCTGCCTGCCCAGAACCGG - Intronic
1041247294 8:55901036-55901058 CTATGATGCCTGAGCAAAACTGG + Intronic
1042802290 8:72732798-72732820 CTAGGCTGCCTACTCAGCCCTGG + Intronic
1048217177 8:132506933-132506955 TTTGGCAGCCTGCTCAAAATGGG + Intergenic
1048873561 8:138818279-138818301 CTAGCCTGGCTGCCCAAGACAGG + Intronic
1055830791 9:80376353-80376375 CTCAGGTGCCTGCTCAACACTGG - Intergenic
1059461096 9:114430696-114430718 CTATGCTGCCTCTTCAAATCTGG - Intronic
1060523983 9:124310167-124310189 CTTTGCTGCCTGATCAGAACAGG + Intronic
1061607099 9:131718841-131718863 CTAGGCTGCCTGTTCCCAAATGG + Intronic
1061911910 9:133729467-133729489 CTAGGCTGCCTGCACCACGCAGG + Intronic
1187690724 X:21863795-21863817 CTAGGCTGACAACTCACAACTGG - Intronic
1188640443 X:32495192-32495214 ATATGCTGCCTGCTCAACAAGGG + Intronic
1195777412 X:108422788-108422810 TTAGGCTGAGGGCTCAAAACAGG + Intronic
1196184784 X:112734426-112734448 CAAGCCTGCCTGCTGAAAAGAGG + Intergenic
1197081070 X:122417775-122417797 ATAGGCTCCCTGCTTGAAACTGG + Intergenic
1200182745 X:154160798-154160820 CTAGACTTCGTGCTCAACACTGG - Intergenic
1200188399 X:154197912-154197934 CTAGACTTCGTGCTCAACACTGG - Intergenic
1200194049 X:154235052-154235074 CTAGACTTCGTGCTCAACACTGG - Intergenic
1200199804 X:154272856-154272878 CTAGACTTCGTGCTCAACACTGG - Intronic
1201792742 Y:17860003-17860025 GTAGACTTCCTTCTCAAAACTGG - Intergenic
1201808812 Y:18045983-18046005 GTAGACTTCCTTCTCAAAACTGG + Intergenic
1202354277 Y:24029253-24029275 GTAGACTTCCTTCTCAAAACTGG - Intergenic
1202516502 Y:25640859-25640881 GTAGACTTCCTTCTCAAAACTGG + Intergenic
1202592683 Y:26503826-26503848 TTAGGCTGGCTGATGAAAACAGG - Intergenic