ID: 1181767268

View in Genome Browser
Species Human (GRCh38)
Location 22:25100825-25100847
Sequence AAGTGCCTGTTGAAGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181767266_1181767268 14 Left 1181767266 22:25100788-25100810 CCTGCTATAGTACCTGGTTCATA 0: 1
1: 0
2: 2
3: 25
4: 278
Right 1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG 0: 1
1: 1
2: 2
3: 19
4: 257
1181767267_1181767268 2 Left 1181767267 22:25100800-25100822 CCTGGTTCATAGTAGACACTCAA 0: 1
1: 5
2: 73
3: 469
4: 2102
Right 1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG 0: 1
1: 1
2: 2
3: 19
4: 257
1181767265_1181767268 15 Left 1181767265 22:25100787-25100809 CCCTGCTATAGTACCTGGTTCAT No data
Right 1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG 0: 1
1: 1
2: 2
3: 19
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181767268 Original CRISPR AAGTGCCTGTTGAAGTCAGA AGG Intronic
900195758 1:1374800-1374822 AAGTGCCCGTTCAGGTCAGGCGG + Exonic
901840637 1:11952029-11952051 AAGTGTCTGTTGAGGGCAGATGG - Intronic
904385808 1:30141316-30141338 AGGTGCCTTTTGACATCAGAGGG + Intergenic
906440200 1:45836349-45836371 AACTGTCTGTTGAGGTCACATGG + Intronic
909172342 1:72313467-72313489 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
911616483 1:100017485-100017507 AAATGCCTTTTGAAATAAGAGGG + Intronic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
915341477 1:155179003-155179025 AAGCGCCTGAAGAAGGCAGAAGG - Intronic
917216944 1:172688938-172688960 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
918552255 1:185756768-185756790 AAGTGCATTTTAAAGTTAGAAGG - Intronic
921191012 1:212708742-212708764 AACTGCCTGTGGAAGTTGGATGG - Intergenic
921266228 1:213423019-213423041 AGGTGCCTGAAGAAGTCACAGGG - Intergenic
922662797 1:227444737-227444759 AAGTGCTTGCTGAAGGCAAATGG + Intergenic
924606119 1:245537059-245537081 AAGTGCCTGTGGGAGACACATGG + Intronic
1065783455 10:29191627-29191649 ATCTGCTTGTTGCAGTCAGAGGG + Intergenic
1065902949 10:30224435-30224457 AACTGCCTGGAGAAGTCAAAAGG - Intergenic
1066431191 10:35353232-35353254 ATGTTCCTTTTGAAGTCAGTAGG + Intronic
1067754084 10:48991741-48991763 AGGTGCTTGCTGAAGGCAGAGGG - Intergenic
1067822422 10:49541581-49541603 AAGAGCCTATTGCTGTCAGAGGG - Intergenic
1067958224 10:50817347-50817369 GAGTCACTGTTGAAATCAGAGGG - Intronic
1067983700 10:51116921-51116943 AAGTGGCTGTTGAAGGCATGGGG + Intronic
1068512700 10:57986136-57986158 AAGCTCCAGTTGAAGTCTGAAGG - Intergenic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1069733616 10:70636231-70636253 CAGTGCCTGTTGAATACAGCTGG - Intergenic
1071125686 10:82332334-82332356 AACTGCCTGTTGATGTCATGGGG + Intronic
1072258101 10:93640203-93640225 AAGTACCTGTAGAGGTCAGAGGG + Exonic
1072299169 10:94042263-94042285 AAATGTCTGTAGAAGTAAGATGG + Intronic
1073918220 10:108430477-108430499 AAGTGCTTGTTGAAGGCAAAGGG - Intergenic
1079029164 11:16973170-16973192 AAGTGCCTGGTGGGATCAGAGGG - Intronic
1080347279 11:31339125-31339147 AAGTTCATGTTTAAGTCAGTTGG + Intronic
1081007843 11:37770160-37770182 AAGTGCATAGTAAAGTCAGAAGG + Intergenic
1081640697 11:44751506-44751528 AAGTGCCTGATGGAGTCAGCAGG + Intronic
1081792176 11:45795917-45795939 AAGGGCCTGTTGAAGCCAAATGG - Intergenic
1081792914 11:45801636-45801658 ATGTGCCAGGTGAAGACAGAAGG + Intergenic
1082142084 11:48620672-48620694 AAGTTCCTTTAGAAGTTAGAAGG - Intergenic
1087470377 11:98566774-98566796 ATGTGGCTGTTGAATTCAGCCGG - Intergenic
1088193638 11:107252885-107252907 AAGTGACTATTCAAATCAGAAGG - Intergenic
1088388531 11:109287913-109287935 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1090159511 11:124478014-124478036 AAGTGCCTGTTCAAGTCATTTGG - Intergenic
1093036619 12:14337627-14337649 AGGTGCTTGCTGAAGTCAAAGGG + Intergenic
1093191582 12:16081078-16081100 ACGTTTCAGTTGAAGTCAGAAGG - Intergenic
1095502578 12:42856623-42856645 AAGTGTGTCTTGAAGTGAGAAGG + Intergenic
1095594338 12:43941495-43941517 AACTGCCTGAGGATGTCAGATGG - Intronic
1096735269 12:53648407-53648429 AAGTGCTTTCTGAAGTCAAAAGG + Intronic
1098158616 12:67625493-67625515 AGGTGCTTGTTGAAGGCAAAGGG + Intergenic
1098702286 12:73644839-73644861 AGGTGCCTGCAGAAGACAGAAGG - Intergenic
1100173365 12:92002589-92002611 AACTGCCTGTGGAAGTGAGGGGG - Intronic
1101697114 12:107137290-107137312 ACGTGCTTGTTGAAGGCAAAGGG - Intergenic
1101724485 12:107377699-107377721 AAATGCCTGTTGAAGATGGATGG + Intronic
1102846311 12:116187770-116187792 AATCGGCTGTTAAAGTCAGAGGG - Intronic
1102884754 12:116512975-116512997 ACGTGTTTGTTGAAGACAGAGGG + Intergenic
1103035904 12:117656016-117656038 AGGTGCCTGCTGAAGGCAAACGG + Intronic
1105891046 13:24682486-24682508 CAGTCCCTGTAGAACTCAGAAGG + Intronic
1106078721 13:26483169-26483191 AAATGAATTTTGAAGTCAGAGGG + Intergenic
1109201584 13:59437211-59437233 ATGTGGCTTTTGAAGTCAGGGGG - Intergenic
1109278397 13:60327513-60327535 AAGTGTTTGTTGAATTCAGTTGG - Intergenic
1109392572 13:61711267-61711289 AGGTGCTTGTTGAAGCCAAAGGG + Intergenic
1109478199 13:62912393-62912415 AGGAGCCTATTGAAGTGAGAAGG + Intergenic
1112249665 13:97768389-97768411 AGGTGCTTGTTGAAGGCAAAGGG - Intergenic
1112893379 13:104266992-104267014 AAGTGACTGTTGAAGTCAGAAGG + Intergenic
1112942671 13:104884158-104884180 AAGTGTCTGTTCAAGTCATTTGG + Intergenic
1113398316 13:109969127-109969149 AAATGCCTGTTGAATGCATAAGG - Intergenic
1113742455 13:112720995-112721017 ATTTGGCTCTTGAAGTCAGAAGG + Intronic
1113898953 13:113785318-113785340 AAGTGCAGGTGGAAATCAGAAGG - Intronic
1116068356 14:40011103-40011125 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1116666828 14:47787406-47787428 TAGGGCCTGCTGAAGTCTGAGGG + Intergenic
1116886858 14:50231037-50231059 AATTGCCTGTTGCATTCTGAAGG - Intronic
1117582968 14:57171498-57171520 AAGAGCCTGTTGATGTCTGCTGG + Intergenic
1118122165 14:62858238-62858260 AAGTGCTTGCTGAAGGCAAAAGG - Intronic
1121596062 14:95163644-95163666 CAGTGCAGGTTGAAGTCATAGGG - Intergenic
1121661243 14:95636711-95636733 AATTGCCTGCTGAAGGTAGAGGG + Intergenic
1122562698 14:102628067-102628089 AAGTTCCAGTTCAAGTCCGAAGG + Intronic
1122775813 14:104116639-104116661 AAGTTCCCTTTGAAGTGAGAGGG + Intergenic
1123473924 15:20574602-20574624 AAGAGTCCGTTGAAGTCACAAGG - Intergenic
1123644084 15:22425751-22425773 AAGAGTCCGTTGAAGTCACAAGG + Intergenic
1123665385 15:22605642-22605664 AAGAGTCAGTTGAAGTCACAAGG + Intergenic
1123734224 15:23169613-23169635 AAGAGTCCGTTGAAGTCACAAGG - Intergenic
1123752372 15:23367009-23367031 AAGAGTCAGTTGAAGTCACAAGG - Intronic
1123992896 15:25696505-25696527 AAGTGCCGCCTGAAGTCAGTGGG - Intronic
1124284727 15:28390924-28390946 AAGAGTCCGTTGAAGTCACAAGG - Intronic
1124297970 15:28520690-28520712 AAGAGTCCGTTGAAGTCACAAGG + Intronic
1124914723 15:33958735-33958757 AGGTGCCTGTTGAACTAGGATGG - Intronic
1124975473 15:34525728-34525750 AAGAGTCAGTTGAAGTCACAAGG + Exonic
1128702674 15:69815630-69815652 AGGTGCCTGATGGAGGCAGAAGG + Intergenic
1129038898 15:72668287-72668309 AAGAGTCAGTTGAAGTCACAAGG - Intergenic
1129210991 15:74068945-74068967 AAGAGTCAGTTGAAGTCACAAGG + Intergenic
1129399415 15:75272139-75272161 AAGAGTCAGTTGAAGTCACAAGG - Intronic
1129403019 15:75296420-75296442 AAGAGTCAGTTGAAGTCACAAGG - Intergenic
1129728121 15:77913218-77913240 AAGAGTCAGTTGAAGTCACAAGG + Intergenic
1130282191 15:82528313-82528335 AAGAGTCAGTTGAAGTCACAAGG - Intergenic
1130749197 15:86691978-86692000 AATTGCTCTTTGAAGTCAGAGGG - Intronic
1131188890 15:90297599-90297621 AAGAGTCAGTTGAAGTCACAAGG - Intronic
1131417126 15:92270003-92270025 AAGAGCCTTTTGAAATCTGAGGG - Intergenic
1131823944 15:96301405-96301427 AAGTGACGTTTGAAGGCAGAAGG + Intergenic
1132184853 15:99794777-99794799 AAGAGTCAGTTGAAGTCACAAGG - Intergenic
1132305496 15:100808939-100808961 AAGTACCTGCTGAAGGCAAAGGG - Intergenic
1132432130 15:101769854-101769876 AAGAGTCAGTTGAAGTCACAAGG + Intergenic
1132642848 16:985487-985509 AAGTGCCTGCTGAAGTCTGCAGG + Exonic
1135508208 16:23057955-23057977 AAGTGCGTGTTGAAATTACAAGG + Intergenic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1140801996 16:78496878-78496900 GAATGACTGTTGAAGCCAGATGG + Intronic
1141270749 16:82539088-82539110 AAATGCCTGATGAAGGCAGGTGG + Intergenic
1143467831 17:7149741-7149763 AGGTGCTGGTTGAAGGCAGAGGG + Intergenic
1146415891 17:32632505-32632527 AAATGCCTTTAGGAGTCAGATGG - Intronic
1147931797 17:43986333-43986355 ATATGCCTGTTCAAGACAGATGG + Intronic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1148404677 17:47400539-47400561 CAGTACCTGTTGACGTCAGATGG + Intronic
1151507198 17:74537234-74537256 AAATGCCTGTTTAAGAAAGAGGG + Intergenic
1151511082 17:74560624-74560646 AAGTCCTTTTTGCAGTCAGAGGG + Intergenic
1151720690 17:75854304-75854326 AATTGCCTCTTGAAGGCAGAAGG - Intronic
1152542604 17:80983867-80983889 CAGTCTCAGTTGAAGTCAGAGGG + Intergenic
1153591783 18:6682160-6682182 AAGTGCCTCTTGAAGTATGATGG - Intergenic
1153626033 18:7023229-7023251 AAGTGCCTGGGGAACACAGATGG - Exonic
1155609577 18:27650020-27650042 GGGTCCCAGTTGAAGTCAGAAGG - Intergenic
1157138654 18:45083928-45083950 GAGTGTCTGCTGAAGTCTGAGGG + Intergenic
1157926433 18:51771937-51771959 AAGTGGCAGATGAGGTCAGAGGG + Intergenic
1158583605 18:58708160-58708182 CAGGGCCTGTTGAAGGCTGACGG - Intronic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165820768 19:38674309-38674331 CAGTGTGAGTTGAAGTCAGAGGG + Intronic
926653162 2:15368727-15368749 AATTGCCTGTAGATGTCACAGGG - Intronic
927168930 2:20351867-20351889 AAGTGCCTGTTGAATACACATGG + Intronic
930000331 2:46856841-46856863 ACGTGCCTGTGGAGGTCAGCAGG - Intronic
931973762 2:67619877-67619899 AAGTTCCTTTTGTAGTCACATGG - Intergenic
932932124 2:76053732-76053754 AAATGCCTGTTGAAGTTAATGGG + Intergenic
935183405 2:100709828-100709850 CAGTGCCTGATGATGTGAGATGG + Intergenic
935564033 2:104588313-104588335 AGGTGCTTGCTGAAGTCAAAGGG - Intergenic
938650054 2:133373645-133373667 TAGTGCATTTTGAAGTCAGACGG - Intronic
939121883 2:138126962-138126984 AAGTTGGTGTTGAAGGCAGAAGG + Intergenic
939806507 2:146780405-146780427 AGGTGCCTGATGAAGGCAAAGGG + Intergenic
939875204 2:147569922-147569944 TATTGCCTGTGGAAGTCAAAAGG - Intergenic
939959615 2:148554747-148554769 AAGTGCCTGAAGAAGTAAGAGGG - Intergenic
940811020 2:158243057-158243079 AAGTGCCGCCTGAAGACAGACGG - Intronic
941873272 2:170407828-170407850 AAGTACCTGTTTTGGTCAGAGGG - Exonic
942655845 2:178213293-178213315 ATGTGCCTCTGGAATTCAGAAGG - Intronic
944103298 2:196052797-196052819 AAGAGCTTACTGAAGTCAGAGGG + Intronic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
946703493 2:222435862-222435884 AAGTGCTTGCTGAAGGCAAAGGG - Intronic
947526029 2:230877270-230877292 AAGTGCCTGAGGACATCAGAAGG + Intronic
948488282 2:238295051-238295073 CAGTGCTTGTTGCAGGCAGAGGG - Intergenic
1170882119 20:20305858-20305880 ATCTGCCTGTTGGAGTAAGAAGG - Intronic
1173430148 20:42980632-42980654 ACGTGAGTGTTGAAATCAGATGG + Intronic
1175284661 20:57830093-57830115 AAGTGCTTGTTAAAGGAAGAGGG - Intergenic
1175406849 20:58740590-58740612 ATGTCCCTGTTGAAGACAGCAGG - Intergenic
1177344233 21:19848280-19848302 CAGTGCCTGCTAAAGTCTGAGGG - Intergenic
1177387006 21:20421611-20421633 AAGTGACTGTGAAAGTGAGAAGG - Intergenic
1177387137 21:20423209-20423231 AAGTGACTGTGAAAGTGAGAAGG - Intergenic
1178063061 21:28873472-28873494 AAGTGCTTGCTGAAGGCAAAGGG - Exonic
1179564889 21:42241106-42241128 ACGTGTCTGTGAAAGTCAGAAGG - Intronic
1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG + Intronic
1181981402 22:26769388-26769410 CAGTGCCTTCTGCAGTCAGAGGG + Intergenic
1184464936 22:44663398-44663420 AGGTGCCTCTGGAAGCCAGAAGG - Intergenic
1184938832 22:47745904-47745926 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
949606581 3:5660172-5660194 AAGTGCATGTAGAAGACACATGG - Intergenic
950094905 3:10323387-10323409 AACTGCGTATGGAAGTCAGATGG + Intergenic
950911569 3:16600125-16600147 AAGTGCCTGTTGACTACAAAAGG + Intronic
951318973 3:21222277-21222299 AGCTGTCTGCTGAAGTCAGAGGG - Intergenic
951421031 3:22484954-22484976 AATTGCCTGTTGATTTCATAGGG + Intergenic
951920727 3:27851812-27851834 AGGTGCATTTTAAAGTCAGATGG + Intergenic
952057055 3:29460242-29460264 AAGTGCCAGTTGCAATCAGTGGG + Intronic
952211286 3:31231509-31231531 AAGAGGCAGTTGAAGTCAGTGGG + Intergenic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
952704543 3:36364205-36364227 AAGTAACTATTGAAGCCAGAGGG + Intergenic
953245886 3:41191648-41191670 AAGAGCCTGTTCAGGTCACACGG + Intergenic
953969209 3:47334060-47334082 AAGTGCCTGTCCATGGCAGATGG + Intronic
954249074 3:49354439-49354461 AGGTGCCTGAAGAAGTCAGAAGG - Intergenic
957094272 3:75763924-75763946 TAGTGCCTGAAGAAGTCAGTAGG + Intronic
958715327 3:97773852-97773874 AGGTGCCTGCTGAAGGCAAAGGG - Intronic
959357627 3:105353129-105353151 AAAGGCCTGTTCAAGTCTGAGGG - Intergenic
959716338 3:109437295-109437317 AAGTGGCTGATGATGTCAAATGG + Intergenic
961906743 3:130270738-130270760 AGGTGCCTGTGGAAGGCACATGG + Intergenic
962442113 3:135429816-135429838 AAGTCCCAGTGGAGGTCAGAAGG - Intergenic
963855859 3:150252594-150252616 AATTTCCTGTTCAAGTTAGAGGG + Intergenic
967943236 3:194782430-194782452 ATGTTCCGGTTCAAGTCAGAAGG - Intergenic
969152406 4:5180635-5180657 AATTGCCTGTTGGGGTCATAAGG + Intronic
971100746 4:23464477-23464499 AGGTGCTTGTTGAAGGCAAAGGG - Intergenic
971303974 4:25464326-25464348 AAGTGCCTGCTGGAGTTAGGAGG + Intergenic
971723953 4:30283916-30283938 AAGGGAATGTTGAAGTGAGAAGG + Intergenic
971817486 4:31507010-31507032 AGGTGCCTGTTAAAGGCAAAGGG + Intergenic
973124340 4:46565691-46565713 AGGTGCCTGTTGAAGGAGGATGG + Intergenic
974289825 4:59914686-59914708 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
974459275 4:62166201-62166223 AGGTGCTTGCTGAAGGCAGAGGG + Intergenic
974473164 4:62345182-62345204 AACTGCCTGTTGAGGTCACATGG - Intergenic
974698839 4:65411442-65411464 AATTGCCTGTTCAATTCATAAGG - Intronic
974746711 4:66087346-66087368 ACGTGCTTGTTGAAGGCAAAGGG - Intergenic
975112414 4:70642575-70642597 AATTGCCTCTTGAAGTAGGAGGG - Exonic
975386458 4:73765568-73765590 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
977089247 4:92650282-92650304 AAGTGATTGTTGAAGGCAAAGGG - Intronic
979595452 4:122529653-122529675 AAGTGCCTGCTGAAGGCAGAGGG - Intergenic
982623066 4:157730944-157730966 AGGTGCTTGCTGAAGTCAAAGGG - Intergenic
984403718 4:179300308-179300330 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
986182502 5:5406474-5406496 CAAAGCCTGTTGAAGGCAGAGGG - Intergenic
986531134 5:8738392-8738414 AAGTGCTTGCTGAAGGCAAAGGG - Intergenic
988229019 5:28450065-28450087 AGATGCTTGTTGAAGGCAGAGGG + Intergenic
990799187 5:59580554-59580576 GAGTGTCTCTTGAATTCAGAAGG - Intronic
992020501 5:72619186-72619208 AAGCGCCTTTTGAATTCTGAAGG - Intergenic
992242014 5:74781523-74781545 AAGTGCCTGTGGTAGACAGGCGG - Exonic
993203664 5:84849486-84849508 AGGTGCTTGTTGAAGGCAAAGGG + Intergenic
994435280 5:99721898-99721920 AACTGCATGTTGAAATCATAAGG + Intergenic
995549784 5:113269248-113269270 TAGAGTCTGTTGAAGTCAAAAGG - Intronic
996090020 5:119341495-119341517 CAGTGATAGTTGAAGTCAGATGG - Intronic
996687351 5:126297360-126297382 CTGGGCCTGTTGAAGTCTGAGGG + Intergenic
996961279 5:129253374-129253396 AGGGGCCTGTTGGAGGCAGAGGG - Intergenic
997179769 5:131815860-131815882 AAGTGCCTGCTGAAGGCAGAAGG + Intronic
997291063 5:132736025-132736047 AAGTGGCTGTTGAGTTCTGAAGG - Intronic
997777115 5:136620073-136620095 ATGTGACTGTTGAAGTCAATGGG - Intergenic
999351645 5:150876759-150876781 AGGTGCTTGCTGAAGTCAAAGGG + Intronic
1000094706 5:157961121-157961143 AAGTTCGTGTAGGAGTCAGAAGG - Intergenic
1000730697 5:164830219-164830241 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1000739173 5:164944743-164944765 AAGTTCCAGTTCAAGTCTGAAGG + Intergenic
1000857469 5:166417260-166417282 CAGGGCCTGCTGAAGTCTGAGGG - Intergenic
1002254319 5:177948058-177948080 AGGTGCCTGTGGAAAGCAGATGG - Intergenic
1002998251 6:2306710-2306732 AGGTGCTTGTTGAAGGCAAAGGG + Intergenic
1004887013 6:20060868-20060890 AAGTGCAGGTTGAAGTGTGAAGG + Intergenic
1009514804 6:64601807-64601829 AAGTGCCTGTAGAAGTAAACAGG - Intronic
1010124902 6:72420481-72420503 AAGTGCCTGTTCACTTCAGAAGG - Intergenic
1010291875 6:74147098-74147120 AGGTGCTTGCTGAAGTCAAAGGG - Intergenic
1010407417 6:75520911-75520933 AAGTCCCAGTTGAAGTCTGAAGG + Intergenic
1011542741 6:88449901-88449923 CAGTGGCTGTTTAAGTCAGAAGG + Intergenic
1012344888 6:98172535-98172557 AGGTGCTTGTTGAAGGCAAAGGG + Intergenic
1013080014 6:106804159-106804181 CAATGACTTTTGAAGTCAGAAGG - Intergenic
1013981712 6:116137649-116137671 AAGTGTCTGTTGATGGCTGAAGG - Intronic
1014044151 6:116864572-116864594 AAGTGAATGTTGAAGGCAGCTGG + Intergenic
1015401555 6:132794069-132794091 AAGAGCCTGTGGAATTGAGATGG - Intronic
1015473172 6:133629406-133629428 AGGTGCTTGTTGAAGGCAAAAGG + Intergenic
1016517180 6:144908231-144908253 TAGTTCCTGTTAAAGTCAGCAGG - Intergenic
1017457065 6:154610649-154610671 AAGTGCCTGTTGAATTGAATGGG + Intergenic
1018484642 6:164228390-164228412 TAGTGCAGGTGGAAGTCAGAAGG + Intergenic
1019558695 7:1645289-1645311 AAGGACCTGTGGAGGTCAGAAGG - Intergenic
1019667024 7:2257124-2257146 AAATGCCTGGTGAAGGCTGAAGG - Intronic
1022892602 7:34716372-34716394 AAGTCAAAGTTGAAGTCAGAAGG - Intronic
1023919269 7:44614466-44614488 GAGTCCCTGATGAAGGCAGAAGG - Intronic
1024742182 7:52366020-52366042 AGGTGTCTGCTGAAGACAGAAGG + Intergenic
1026874736 7:73872584-73872606 ATGTCCCTAGTGAAGTCAGAGGG - Intergenic
1028714809 7:93953144-93953166 TAAGGCCTGTTGAAGTCTGAGGG - Intergenic
1028765777 7:94558066-94558088 AAGTACCTTTTAAAGCCAGATGG - Intergenic
1030192672 7:106824946-106824968 AGGTGCATGTTGAAGGCAAAGGG + Intergenic
1030277817 7:107738579-107738601 AGGTGCCTGCTGAAGCCAAATGG + Intergenic
1033392536 7:140941367-140941389 AGGTGCCTGCTGAAGGCAAAAGG + Intergenic
1034318321 7:150155291-150155313 AAGTGGCAGTTGAGATCAGAGGG - Intergenic
1034774431 7:153811941-153811963 AAGTGGCAGTTGAGATCAGAGGG + Intergenic
1035016012 7:155766623-155766645 AAGAGCCTGCTGATGTCAGTGGG + Exonic
1035454508 7:158999118-158999140 AGCTGCCTCTTGAAGGCAGAGGG - Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1037168186 8:15856873-15856895 ATGTGCCAGTTGTAGCCAGAAGG - Intergenic
1037334756 8:17781287-17781309 AATTGTATGTTGAAGTCATATGG - Intronic
1037498785 8:19465653-19465675 AAGTGCCTGAAGAAGAGAGACGG - Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041274193 8:56141305-56141327 AAGTGCTTGCTGAAGGCACAGGG - Intergenic
1042061971 8:64828545-64828567 AAGTGTCAGTTGAACCCAGATGG + Intergenic
1042246633 8:66714589-66714611 AAGTGTCTCTTGAAGCAAGAAGG + Intronic
1043283225 8:78495688-78495710 AAGTGATTAGTGAAGTCAGAGGG + Intergenic
1048353483 8:133634697-133634719 AAGTGCATGCTGTGGTCAGACGG - Intergenic
1050053148 9:1623848-1623870 AAGTACCTGCTGAAGGCAAAGGG + Intergenic
1051462326 9:17335025-17335047 AAGTTCAAGTTCAAGTCAGAAGG + Intronic
1051802337 9:20949791-20949813 AAATGCCTCTTGAACTCAGCGGG - Intronic
1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG + Intergenic
1052783178 9:32801962-32801984 AAATGCCTGATGAACTGAGATGG - Intergenic
1053140396 9:35679229-35679251 AAGTAGCGGCTGAAGTCAGAGGG - Exonic
1055997408 9:82175185-82175207 GAGTGAGTGTTGAAGACAGAAGG - Intergenic
1056617196 9:88178784-88178806 AGGTTCCTGCTGAAGTCTGAGGG + Intergenic
1056648728 9:88438820-88438842 AAGTGCCTGTTGATGACATGGGG + Intronic
1057244926 9:93447098-93447120 AAGTACCTGTGGAATTCAGATGG + Exonic
1057319441 9:93998947-93998969 GAGTTCCAGTTGAAGTCTGAAGG + Intergenic
1057666962 9:97053601-97053623 AAGTAACTGTTGAAACCAGAGGG + Intergenic
1059583672 9:115581308-115581330 AAGTGACTGTATATGTCAGAGGG + Intergenic
1059892437 9:118817878-118817900 AAGTAACTATTGAAATCAGAGGG - Intergenic
1062135854 9:134927608-134927630 AGGTGCCTGCTGAAGGCAAAGGG + Intergenic
1186872006 X:13782572-13782594 AAATGCCTGTGGAAAGCAGAGGG - Intronic
1187051596 X:15701796-15701818 AAATGCTTTTTGAGGTCAGAGGG - Intronic
1188680811 X:33002154-33002176 AAGTGCCTTTTCTATTCAGAAGG + Intronic
1189032221 X:37462434-37462456 AGGTGCTTGTTGAAGGCATAGGG - Intronic
1190552881 X:51602940-51602962 AAGTGTTTTTTGATGTCAGAGGG + Intergenic
1191564496 X:62507891-62507913 ATGTGCGTGTTGAATTCACATGG - Intergenic
1191658535 X:63627859-63627881 AGGTGCTTGCTGAAGTCACAGGG - Intergenic
1193107466 X:77693225-77693247 AGGTGCCTCTGGAAGACAGAGGG + Intronic
1194213287 X:91095915-91095937 AAGATCGTGTTGAAGTCATAGGG - Intergenic
1197420144 X:126228307-126228329 AAGTGCTTGCTGAAGGCAAAGGG + Intergenic
1198302271 X:135344229-135344251 CCGTGGCTGTTGAAGGCAGAGGG + Intergenic
1201193466 Y:11469518-11469540 AGGTGCTTGTTGAAGGCAAAGGG - Intergenic