ID: 1181767743

View in Genome Browser
Species Human (GRCh38)
Location 22:25103862-25103884
Sequence CACGCTCAAGTGTTGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181767738_1181767743 20 Left 1181767738 22:25103819-25103841 CCTCACTGGCCTCTGCAAAATGG 0: 1
1: 0
2: 0
3: 23
4: 274
Right 1181767743 22:25103862-25103884 CACGCTCAAGTGTTGTTTTGAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1181767742_1181767743 11 Left 1181767742 22:25103828-25103850 CCTCTGCAAAATGGGGAACATCA 0: 1
1: 1
2: 8
3: 58
4: 377
Right 1181767743 22:25103862-25103884 CACGCTCAAGTGTTGTTTTGAGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181767743 Original CRISPR CACGCTCAAGTGTTGTTTTG AGG Intronic
906733939 1:48106353-48106375 CACACTCAAGAGATGATTTGAGG + Intergenic
909061083 1:70880193-70880215 TATGCTCAAGTGTGCTTTTGTGG + Intronic
913021880 1:114796124-114796146 CAATCTTTAGTGTTGTTTTGTGG + Intergenic
915659585 1:157391428-157391450 CAAGCTCAAGTGTATTTCTGAGG - Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918893783 1:190313682-190313704 CTATCTCAAGGGTTGTTTTGAGG - Intronic
921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG + Intergenic
921566047 1:216721797-216721819 CCCGCTCAAGTGTAGTTTGAAGG - Intronic
924783455 1:247172728-247172750 CACACTGAAGTGCAGTTTTGAGG + Intergenic
1064127217 10:12673511-12673533 CTAGTTCCAGTGTTGTTTTGTGG + Intronic
1074119991 10:110486961-110486983 CACGCTCCAGGGTTGTTGTATGG + Intergenic
1078262305 11:9721514-9721536 CAAGCTCAAGTGCAGTGTTGTGG + Intronic
1090100656 11:123793564-123793586 CACGCACAAGTGATGTGGTGAGG - Intergenic
1091179556 11:133591396-133591418 CAGGGTCCAGGGTTGTTTTGTGG - Intergenic
1092307101 12:7312318-7312340 TTATCTCAAGTGTTGTTTTGAGG + Intronic
1093465522 12:19444642-19444664 TACTCTGAAGTGTTGTTTTGTGG + Intronic
1102359034 12:112267685-112267707 CTTTCTCAAGTGTTTTTTTGGGG - Intronic
1103563571 12:121804558-121804580 CTCGCTCCATTCTTGTTTTGGGG + Intronic
1109672772 13:65631763-65631785 CAGGTTCAACTGTTGTTTAGAGG - Intergenic
1113086647 13:106575580-106575602 TACGCTCAGGTGTTGATTTGGGG + Intergenic
1113354201 13:109562460-109562482 CTTGCTCAAGTGTTGTTTGATGG - Intergenic
1114443707 14:22771610-22771632 CAGTGTCAAGTCTTGTTTTGAGG - Exonic
1116960317 14:50962137-50962159 CATTATCAAGGGTTGTTTTGAGG - Intergenic
1117622499 14:57601839-57601861 CACCCACAAGTATTGTTGTGAGG - Intronic
1119781564 14:77279617-77279639 AACGCTCTAGTGTTGTTGGGAGG + Intronic
1122631127 14:103108227-103108249 CACGCTCCCGTTCTGTTTTGGGG + Intronic
1124925405 15:34065557-34065579 CACCCTCAAGTGTGCTTTTCTGG - Exonic
1128347790 15:66865386-66865408 CAGGCTCTAGTGTTGGTTTGGGG + Intergenic
1131512846 15:93058926-93058948 CACGATCATGTTTTGTTTTCTGG - Intronic
1139681855 16:68571177-68571199 CAGCATCAAGGGTTGTTTTGAGG + Intronic
1140293452 16:73685764-73685786 CCTGCTCAAGGGTTGTTTTAGGG - Intergenic
1140610030 16:76587209-76587231 CAGGCTTAAGTGAAGTTTTGAGG + Intronic
1144717810 17:17446601-17446623 CAATCTCAAGTTTTATTTTGAGG + Intergenic
1144784592 17:17824522-17824544 CAGGCTCTAGGGTTCTTTTGAGG + Intronic
1150289709 17:63974138-63974160 CACCCTCAGGTGTGGCTTTGGGG - Intergenic
1151731091 17:75911673-75911695 CACGCTCAGCTATTTTTTTGTGG + Intronic
1155741005 18:29287509-29287531 AACTCTCAAGTCTTATTTTGAGG + Intergenic
1160007990 18:75082386-75082408 CCCGCTTAAGTCTTCTTTTGGGG - Intergenic
925522848 2:4767007-4767029 CACGCTCATGTATTGGTGTGTGG - Intergenic
927623907 2:24692416-24692438 CATTCCCAAGTTTTGTTTTGAGG - Intronic
931134914 2:59387723-59387745 CTAGCTCATGTGTTGTTTTGAGG + Intergenic
933170621 2:79121026-79121048 CACTGTTAAGGGTTGTTTTGTGG + Intronic
935298928 2:101675894-101675916 CAAGTTAAAATGTTGTTTTGGGG + Intergenic
939209845 2:139160296-139160318 CTCTCTCAACTGTTCTTTTGAGG + Intergenic
939627765 2:144498995-144499017 CACTCTGAAGTTATGTTTTGTGG - Intronic
940104848 2:150087585-150087607 CTCCCTCAAGTTTTATTTTGAGG - Intergenic
943845840 2:192646436-192646458 CAATCTTAAGTGTTGATTTGTGG - Intergenic
944453941 2:199874250-199874272 AACGCTGAATTGTTGTGTTGGGG - Intergenic
1181119328 22:20654963-20654985 CAGGCTCAAGTGCTATTTTCAGG + Intergenic
1181767743 22:25103862-25103884 CACGCTCAAGTGTTGTTTTGAGG + Intronic
951399753 3:22216926-22216948 CTCTCTCCAGTGTTGATTTGTGG - Intronic
952633429 3:35497976-35497998 CATGCACAGGTGTAGTTTTGTGG + Intergenic
956256818 3:67292050-67292072 CAAGCTCATGGGTTGTTGTGAGG - Intergenic
956504099 3:69919504-69919526 CATGCACAAATGTTGTCTTGGGG - Intronic
960812192 3:121635935-121635957 CATGTTCCAATGTTGTTTTGTGG + Intronic
961668193 3:128507134-128507156 CAGGTACAAGAGTTGTTTTGTGG - Intergenic
962343578 3:134604250-134604272 CACGCTCAAGTGCAATTATGTGG - Exonic
965125254 3:164619524-164619546 CACTCTCAGGTGTTGCTTTATGG - Intergenic
966954237 3:184857311-184857333 GACTCTCAAATGTTGTATTGGGG - Intronic
976381224 4:84401364-84401386 AATCCTCCAGTGTTGTTTTGTGG - Intergenic
978086935 4:104666278-104666300 CACTCTAAATTCTTGTTTTGTGG + Intergenic
982207197 4:153005674-153005696 CACCTTCTAGTGTTGTTTTCAGG + Intergenic
982813521 4:159856571-159856593 CACGGTGAAGTGTGGTTTTGGGG + Intergenic
1015772313 6:136781890-136781912 CACGCTCAAGTTTTGTAATATGG - Intronic
1025739456 7:64183651-64183673 CAGGCTCACAGGTTGTTTTGTGG - Intronic
1026530734 7:71195119-71195141 CACTCTTTAGAGTTGTTTTGAGG - Intronic
1026883803 7:73924754-73924776 CACGTACAAGTTTTGTTTTTTGG + Intergenic
1028019502 7:85752078-85752100 CATACTTAAGTGTGGTTTTGTGG - Intergenic
1030283529 7:107801397-107801419 CAGGCTCATGTTTTGTGTTGTGG - Intronic
1030389855 7:108914059-108914081 AACTCTCAAGTGCTGTTTTGGGG - Intergenic
1032151928 7:129436118-129436140 CTCGTTCAAATGTTTTTTTGGGG + Intronic
1034021127 7:147643761-147643783 TACGCTCAAGAGTTCATTTGGGG + Intronic
1036809929 8:11860879-11860901 CTCGCCGAAGTCTTGTTTTGTGG - Intronic
1039437050 8:37566915-37566937 CAGCCTCAGGCGTTGTTTTGGGG - Intergenic
1043186370 8:77155925-77155947 AAAGCTCAAGTGTTATTTAGAGG - Intergenic
1045188381 8:99860211-99860233 CAAGATCAAGTCTTCTTTTGAGG - Intronic
1049304805 8:141895517-141895539 CACTCTCAGGTTGTGTTTTGAGG - Intergenic
1051391317 9:16567163-16567185 CAGACTCAAGTGTCATTTTGGGG - Intronic
1053053680 9:34981041-34981063 CTTGCTCAAGTGTTCTGTTGGGG - Exonic
1057897608 9:98922318-98922340 ATCACTAAAGTGTTGTTTTGTGG - Intergenic
1059254439 9:112916331-112916353 GACCTTCTAGTGTTGTTTTGGGG + Intergenic
1061524382 9:131146630-131146652 CAGGCACAAGAGTTGTTTGGCGG + Intronic
1062179488 9:135183520-135183542 CAGGCTCTAGTTTTGCTTTGGGG - Intergenic
1186247306 X:7627922-7627944 CATGCTCATGTGTGGTCTTGTGG + Intergenic
1187708694 X:22032197-22032219 CACGCACTTGTGTTTTTTTGTGG + Intergenic
1188593012 X:31862609-31862631 TATGCTTAAGTGTTGTTTTCTGG - Intronic
1192325058 X:70124646-70124668 GGGGCTCAAGTGTTGTTATGGGG + Intergenic
1196213067 X:113017096-113017118 CAAGCTCAAATCCTGTTTTGAGG + Intergenic
1196696000 X:118612691-118612713 CATGCTCAACTCTTGTCTTGGGG - Intronic
1197169960 X:123421771-123421793 CACGCTGCAGTGGTGTTTTGAGG - Intronic
1198116012 X:133545242-133545264 CACGGTCAAATGTTGTGTAGGGG + Intronic
1199592183 X:149477615-149477637 CACGCTCAAGGGTTTTCTTTGGG - Intergenic