ID: 1181768445

View in Genome Browser
Species Human (GRCh38)
Location 22:25109037-25109059
Sequence CAGTATGACCTCAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181768441_1181768445 4 Left 1181768441 22:25109010-25109032 CCTCACAACATGGCGGCTGGCTT 0: 6
1: 45
2: 149
3: 351
4: 619
Right 1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181768445 Original CRISPR CAGTATGACCTCAGAGAAGA AGG Intronic
901146174 1:7066119-7066141 GAGGATGGTCTCAGAGAAGAGGG - Intronic
903754279 1:25649977-25649999 CAGTACAACCACAGACAAGATGG - Intronic
904897206 1:33825933-33825955 CAATAGGACCTCAGACATGAAGG + Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905776831 1:40673393-40673415 AAGAAGGATCTCAGAGAAGAAGG - Intergenic
907217825 1:52880867-52880889 CTGTGAGATCTCAGAGAAGAGGG + Intronic
907562797 1:55406325-55406347 CAGTGAGACCTCAAAGAGGAAGG - Intergenic
907905199 1:58778185-58778207 AAGTAGGATCTCATAGAAGAGGG - Intergenic
910027714 1:82678343-82678365 AAGCATGATCTCAGAGAAAATGG - Intergenic
911933656 1:103938042-103938064 CAGTATGAGCTCATAGATAAGGG - Intergenic
912190876 1:107338763-107338785 GAGAATGACCACAGAGAATAGGG + Intronic
912654395 1:111472584-111472606 GAGAATGTCTTCAGAGAAGATGG - Intergenic
917379833 1:174393522-174393544 CAGCTTGGCCTCAGAGAAGTGGG + Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919551354 1:198992453-198992475 TAGGATGACATCAGAGAACAGGG + Intergenic
919871631 1:201826265-201826287 CAGTAAGACCCCACAGGAGATGG - Exonic
920728093 1:208456256-208456278 CAGCATGACCTCAGAGTAAAGGG - Intergenic
921072137 1:211669756-211669778 CAGGCTGACATAAGAGAAGAAGG - Intronic
922150681 1:223001049-223001071 TATTCTCACCTCAGAGAAGAGGG + Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922590205 1:226769858-226769880 AAGGAAGAGCTCAGAGAAGATGG + Intergenic
924225964 1:241921861-241921883 CAGTATGACCTGTAAGAAGAGGG + Intergenic
924260303 1:242222776-242222798 AAGTTTGACTTCAGAGATGATGG + Intronic
1062836823 10:641187-641209 CACTATGACCTCAAAGAACGAGG - Intronic
1063084207 10:2800376-2800398 CAGAATGACGTCAGGGAAGAAGG + Intergenic
1063696476 10:8340316-8340338 CAGTAGGAAGTCAGATAAGAAGG + Intergenic
1064514483 10:16131496-16131518 CAGTAAGACCCCTGAGAAGGGGG - Intergenic
1065472279 10:26094761-26094783 CAGTATAATCTCAGTGTAGATGG - Intronic
1065582341 10:27184277-27184299 CAGGAGGACCTCTGTGAAGAGGG + Intronic
1067797053 10:49328243-49328265 CACAGAGACCTCAGAGAAGAGGG - Intergenic
1069581645 10:69570742-69570764 CCCTAGGACCTCAGAGAATATGG - Intergenic
1070885222 10:79889407-79889429 CAGTTTAACCTCAGGGAAAACGG - Intergenic
1070951479 10:80434906-80434928 AAGTATGTCCTCTAAGAAGAGGG + Exonic
1073549038 10:104380477-104380499 CAGCATGGCAACAGAGAAGAGGG - Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075408744 10:122211875-122211897 CACTGTGACCGCAGAGAGGAAGG - Intronic
1076254715 10:129012812-129012834 CAGAAGGACCCCAGTGAAGAGGG + Intergenic
1076865260 10:133163457-133163479 CAGGATGAGCTCAGAGCAGAAGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077801802 11:5546638-5546660 AAGGATGACCTCAGACAAGTTGG - Intronic
1077962148 11:7087025-7087047 CAGGTAGACCTCAGATAAGAGGG + Intergenic
1081025461 11:38007755-38007777 CAGTCTTACCTAAGAGAAAAAGG - Intergenic
1082108174 11:48243197-48243219 CAAAATGTCCTGAGAGAAGAGGG + Intergenic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1084119907 11:67062860-67062882 CAGCATCCCCTCAGAGCAGAGGG + Intronic
1086189258 11:84059125-84059147 AAATATGAACTCAGATAAGAAGG - Intronic
1088883021 11:113986537-113986559 CAGGCTGACCACATAGAAGAGGG - Exonic
1089222420 11:116885020-116885042 CAGTAAGATATCAGAAAAGAAGG + Intronic
1090644473 11:128756723-128756745 AAGTAAGTCTTCAGAGAAGATGG - Intronic
1091015334 11:132045835-132045857 CAGAAAGAGCTCAGAGAAAAGGG - Intronic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1093243904 12:16711770-16711792 CATAATGACTTCAGACAAGAAGG + Intergenic
1094247730 12:28320536-28320558 AAGTCTGACCTCAGATAAGTGGG - Intronic
1095176878 12:39102847-39102869 CAGTATGACTGCATTGAAGAAGG + Intergenic
1097082763 12:56445089-56445111 CACTATCTCCTCAGTGAAGAAGG + Intronic
1098526245 12:71490249-71490271 CAGTATGAACTAACAGAAAAGGG - Intronic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1101166774 12:102044882-102044904 CAGGATGAACTCAGAAAAGAAGG - Intronic
1102797262 12:115699526-115699548 CTGCATGAACTCAGATAAGATGG + Intergenic
1103578218 12:121894648-121894670 TATTATGACTTCAGAGGAGAAGG + Intronic
1106055109 13:26230133-26230155 CAGTATGACCTCAGAAACACTGG - Intergenic
1107104948 13:36633152-36633174 CAGTATGTCCTCCAAGAAGTAGG + Intergenic
1107816995 13:44253392-44253414 CAGAATGTCTTCATAGAAGAAGG - Intergenic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1108730254 13:53227906-53227928 CAGGAAGACCTCAGGGAATAGGG - Intergenic
1112230210 13:97582412-97582434 CAGAATGAAGTCAGAGGAGAAGG + Intergenic
1112758396 13:102666338-102666360 CAGTATTATCTCACAGAAAAAGG + Intronic
1114852955 14:26402322-26402344 CAGTATGAGCTCATCGAAGTGGG + Intergenic
1115430791 14:33316128-33316150 CAGAATTATCTCAGAGAAAATGG + Intronic
1116598620 14:46888300-46888322 CAGAAAACCCTCAGAGAAGATGG + Intronic
1117764533 14:59067342-59067364 GAGTATGAGCTCAGAGGGGAAGG + Intergenic
1118475685 14:66114846-66114868 AAATATGACCTCATCGAAGATGG - Intergenic
1120248810 14:82037326-82037348 GAGTATGACTTCAGAGAAGCAGG + Intergenic
1121366744 14:93319430-93319452 CTATTTGGCCTCAGAGAAGAAGG + Intronic
1121661303 14:95637202-95637224 CAGGATGACCTCAGATGAAAGGG - Intergenic
1122459337 14:101882488-101882510 GAGTATGTTCTCAGTGAAGATGG + Intronic
1122993782 14:105251537-105251559 CTGTATGACCCCCGAAAAGAGGG + Intronic
1126341629 15:47646833-47646855 CAGTTTTCTCTCAGAGAAGATGG - Intronic
1126492092 15:49248430-49248452 CAGTATGGCCTCTGAAAAGATGG + Intronic
1128816311 15:70611223-70611245 CAGCATGACCTCAGAGAGACAGG - Intergenic
1129239443 15:74242816-74242838 CAGTGGGGACTCAGAGAAGACGG - Intronic
1129272568 15:74427183-74427205 CAGCATGATCTGAGCGAAGATGG - Intronic
1130134798 15:81173641-81173663 CAGTATGATCTCAGGGAAAGAGG + Intronic
1130797538 15:87225933-87225955 CTTGATGGCCTCAGAGAAGAAGG + Intergenic
1132037839 15:98501487-98501509 CAGCTTAACCTCAGAGATGAAGG + Intronic
1133077526 16:3291149-3291171 AAATATGACCTCAGACAAAAAGG + Exonic
1137822121 16:51456185-51456207 CAGTATGACCTAAGAATTGAAGG + Intergenic
1138316266 16:56072923-56072945 CAGTCTGGAATCAGAGAAGAAGG + Intergenic
1143717463 17:8785171-8785193 CAGTACAACCTTGGAGAAGAGGG + Intergenic
1143996996 17:11015220-11015242 TAGTATAACCTCAGGGAAAATGG - Intergenic
1144303526 17:13946186-13946208 CAGCATGATCTAAGAGAATAAGG + Intergenic
1146700859 17:34958624-34958646 CAGGATGACGTCACAGGAGATGG - Exonic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1150128694 17:62654523-62654545 AGGTCTGACCTCAGATAAGACGG - Intronic
1150783857 17:68146819-68146841 CAGCATTACCTCAGGGATGAGGG + Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151985229 17:77538564-77538586 GAGTATGACCTCAGATACAAAGG - Intergenic
1152416984 17:80169105-80169127 CAGTATTCCCACAGAGAAGATGG + Intergenic
1153073634 18:1135752-1135774 CAGTACCACCTAAAAGAAGACGG - Intergenic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154074732 18:11188944-11188966 CAGACTGACGTCAAAGAAGATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156058349 18:33039556-33039578 GAGCATGCCCTCAGAGGAGAAGG + Intronic
1158178895 18:54689482-54689504 CAGTAGGACTTCAGAGAGCAAGG - Intergenic
1158523367 18:58190561-58190583 TAGCATTACCTCAGAGAAGCAGG + Intronic
1159024309 18:63168487-63168509 AAGAATGACCTCAGAGACTATGG - Intronic
1159090770 18:63846205-63846227 CATTTTTGCCTCAGAGAAGATGG + Intergenic
1161147596 19:2688358-2688380 AAGAATGACCTCAGAGTAGCTGG + Intronic
1164607401 19:29610129-29610151 CAGAATAACCTCAGAAAAGCAGG + Intronic
1165242023 19:34476603-34476625 GAGTGGGGCCTCAGAGAAGAGGG + Intergenic
925345507 2:3169311-3169333 CAGAATGACCTCAGATGAAAAGG + Intergenic
925628627 2:5866804-5866826 CAGTTTGTCCTCAGAGTATATGG - Intergenic
926946599 2:18194637-18194659 AAGTATGATCACAGAGAAAAGGG + Intronic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927151590 2:20199372-20199394 CAGCACGATCTGAGAGAAGATGG + Intergenic
927512153 2:23650567-23650589 CAGTATGGCCTCAGAGATGATGG - Intronic
928318505 2:30264665-30264687 CCGCATGGCCTCAGAGAACAGGG + Intronic
929878678 2:45818030-45818052 GAGTATGACCTGAGACAAGAGGG + Intronic
931327223 2:61239151-61239173 CAGTATTGTCTCAGAGAATATGG - Intronic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
931895148 2:66720279-66720301 CTGGATGCCCTCAGAGGAGAAGG + Intergenic
933651309 2:84852450-84852472 CAGAATGACCGCAGAGTTGAGGG + Intronic
934900020 2:98152228-98152250 CAGTCTGACAACAGAGAAGTAGG - Intronic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
940250436 2:151669687-151669709 CAGAAGGGCCACAGAGAAGAGGG + Intronic
940890600 2:159032022-159032044 CCATATGACCTTAGGGAAGAAGG - Intronic
944902738 2:204232108-204232130 CAGTCCGTCCTGAGAGAAGAAGG + Intergenic
947990380 2:234482991-234483013 CAGTGTAACCTCAGAGCAGGTGG - Intergenic
948317426 2:237039175-237039197 ATTTATGACCTCAGAGGAGAGGG + Intergenic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169522017 20:6384486-6384508 CAGGATGAGCTCATGGAAGAGGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1172897636 20:38311738-38311760 CAGTTAGAGCTCAGAGGAGAGGG + Intronic
1178678142 21:34648208-34648230 CATTACGCCCTCAGAGAAGTGGG + Intergenic
1179605438 21:42513106-42513128 CAGGATGGCTTCAGAGCAGAGGG - Intronic
1179993503 21:44960709-44960731 AAGGCTGACCTCAGAAAAGAGGG - Intronic
1181116320 22:20634475-20634497 CAGTCTGGCCTCAGGGAAGGGGG - Intergenic
1181261235 22:21599360-21599382 CAGTGTGCCCTCAGAAAACAGGG - Intronic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1183752009 22:39726511-39726533 CAGAAGGACGTCAGAGAAGCAGG - Intergenic
949189931 3:1239769-1239791 GACTATGGCCTCAGAGAAAAAGG - Intronic
949385390 3:3496650-3496672 GAGCAGGACCTCAGAGCAGACGG - Intergenic
953301641 3:41783050-41783072 TAGCATGACAGCAGAGAAGAGGG + Intronic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
955463404 3:59210395-59210417 CAGGATGTAATCAGAGAAGAAGG - Intergenic
960928609 3:122821357-122821379 GAGAAAGACTTCAGAGAAGAGGG + Intronic
962426369 3:135272175-135272197 ACGTAGGAGCTCAGAGAAGAGGG + Intergenic
963837291 3:150070190-150070212 CAGTAGGATATCAGAGAAGGAGG - Intergenic
964469611 3:157038784-157038806 CAGTATGTCCTCATAGATGTAGG + Intronic
964876028 3:161369725-161369747 CAGTATACCCTGAGAGAAGCAGG - Intronic
965223527 3:165958332-165958354 GAGTATGATCTCAGATCAGAAGG + Intergenic
965815618 3:172633641-172633663 CATGATGTCCTCAGAGACGATGG - Exonic
965821125 3:172685306-172685328 CATTATGAGCCCAGTGAAGATGG - Intronic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
966350360 3:179027613-179027635 CACTTTGGCCTCAGAGAAAATGG + Intronic
967982078 3:195071792-195071814 CACCATGACATCAGAGAGGAGGG + Intronic
972644790 4:40957024-40957046 TTGTGTGACCTCAGAGAAAATGG + Intronic
972814661 4:42630719-42630741 CAGTCTGAACCCAGAGAAAATGG - Intronic
973022460 4:45220461-45220483 CAGCTTGACTTCAGTGAAGATGG - Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975315793 4:72951844-72951866 TAGAATGACATCAGAGAAAAAGG - Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
975733224 4:77357551-77357573 CTGTGAGACCTCAGAGAATAGGG - Intronic
977890694 4:102308139-102308161 CAGCATCTCCTCAGAGAAGGTGG + Intronic
982233402 4:153230027-153230049 CAGGCTAACCTGAGAGAAGAAGG + Intronic
985309228 4:188578822-188578844 CAGTATTTGGTCAGAGAAGAAGG - Intergenic
985971981 5:3385419-3385441 CTTTGTGACCCCAGAGAAGAGGG - Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
987078758 5:14407470-14407492 CACTATGAACCCAGAGAAGCTGG - Intronic
987448448 5:18051560-18051582 GAGTTTGACCTCTGAGAGGAAGG - Intergenic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
989596131 5:43157869-43157891 CATTATGAAGACAGAGAAGATGG - Intronic
992143716 5:73824385-73824407 TAGAAAGAGCTCAGAGAAGAAGG + Intronic
992548580 5:77840011-77840033 CAATTTGACCTCAGTGAACAAGG + Intronic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994094397 5:95835845-95835867 GGGGCTGACCTCAGAGAAGAGGG + Intergenic
994178876 5:96742202-96742224 CATTGTGCCTTCAGAGAAGAAGG + Intronic
994748885 5:103713651-103713673 CAGGCTGACCTCAGAGATCATGG - Intergenic
994987892 5:106961440-106961462 TGGTATAACCTCAGAGAAGCAGG - Intergenic
995570264 5:113472293-113472315 CAGAATGGCCACACAGAAGATGG - Intronic
996599993 5:125252204-125252226 CAGTATCATCTCAGAGTAGCAGG - Intergenic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
999147500 5:149405984-149406006 CAGCATGAGCTCTGGGAAGAAGG + Intergenic
1000003493 5:157162479-157162501 CACTATGACATCCGAGAAGACGG - Exonic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000300147 5:159949742-159949764 CAGCAAGATCTCAGAGCAGATGG + Intronic
1002166074 5:177347241-177347263 GAGGCTGACCTCAGAGCAGAAGG + Intronic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1003637345 6:7844797-7844819 GAGTATGACTTCACAGAAAAAGG - Intronic
1007670639 6:43550404-43550426 CAGTAGGACTTCAGAAAAGTGGG - Intronic
1014099388 6:117493712-117493734 TAGTCTGACCTCAAAGACGATGG - Intronic
1018414375 6:163588717-163588739 CAGTGTGACCGTAGAGAATAAGG - Intergenic
1019793432 7:3032440-3032462 CAGTTTGACCTCAGAGGTGAGGG + Intronic
1020853274 7:13384472-13384494 TAGAAAGAACTCAGAGAAGATGG - Intergenic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1021905577 7:25329925-25329947 CATGGTGACCTCAGAGAAGGTGG + Intergenic
1024973849 7:55095212-55095234 CAGTCGGACAGCAGAGAAGAGGG - Intronic
1026834948 7:73632540-73632562 CACTAGGACATCAGTGAAGATGG - Intergenic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1027978112 7:85185045-85185067 CTATCTGGCCTCAGAGAAGAAGG + Intronic
1032485206 7:132281366-132281388 CTGATTGACATCAGAGAAGATGG - Intronic
1035421632 7:158734232-158734254 AGGTATGACCTCACGGAAGATGG - Exonic
1035468171 7:159093305-159093327 AAGGATGACCTCTGAGAAGATGG - Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1036244148 8:7102304-7102326 CAGTGTTACCTCTGAGAAGCAGG - Intergenic
1037356052 8:18020679-18020701 CAGTATGAACTAATAGAAAAGGG + Intronic
1038455439 8:27669530-27669552 CAGCCTGGCCTCAGAGAAGCCGG - Intronic
1039136204 8:34325746-34325768 CACTATTATTTCAGAGAAGAAGG - Intergenic
1039613495 8:38937207-38937229 GAGAATGACCTCAGGGAAGGAGG + Intronic
1040720511 8:50316307-50316329 CGGTATGACATCATAGGAGATGG - Intronic
1041159013 8:55018359-55018381 CAGAGTGATATCAGAGAAGAAGG + Intergenic
1041562741 8:59238617-59238639 CAGAATGACTTTAGATAAGAAGG + Intergenic
1042782688 8:72509635-72509657 CAGTATTGCCTCAGGAAAGAAGG + Intergenic
1043358138 8:79438131-79438153 CAGTATGCCCTCTGAGGAGAGGG - Intergenic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045526556 8:102945443-102945465 CAGCATGGCCTCAGTGAAGAGGG - Intronic
1045833840 8:106496732-106496754 CAGCAAGATCTCAGAGAAGATGG + Intronic
1047067435 8:121301066-121301088 CAGTATGAACTCAGAGATATGGG + Intergenic
1047172032 8:122503062-122503084 CTGTATGACCTCAGAGGAGGTGG - Intergenic
1047768745 8:128013067-128013089 CAGGATGGCTTCAGGGAAGAAGG - Intergenic
1048577166 8:135701913-135701935 CAGTTTAGCCTCAGAGATGAAGG + Intergenic
1048601531 8:135923697-135923719 CAGCACCACCTTAGAGAAGAGGG - Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1050441625 9:5669972-5669994 CAGATGGACCTAAGAGAAGAAGG + Intronic
1051816024 9:21106335-21106357 CAGAAGGTCCTCAGAGAAGCTGG + Intergenic
1052578786 9:30326459-30326481 CAGAATGATCTAAGAGAAAAGGG + Intergenic
1053291785 9:36884896-36884918 CAGTATGTGCTCAGAGGAGCTGG + Intronic
1057256947 9:93557523-93557545 CAGTATGAGCTGAAACAAGAAGG + Intronic
1059774134 9:117458040-117458062 CAAAATGACCTCACTGAAGAGGG + Intergenic
1060283651 9:122229685-122229707 CAGTAGAACCCTAGAGAAGAAGG - Intergenic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1192051121 X:67724835-67724857 AAGTCTGACCACTGAGAAGAAGG + Exonic
1193987009 X:88254783-88254805 CAATATTACCTCAAAAAAGAGGG - Intergenic
1195661623 X:107384593-107384615 CAGCCTGACATCAGAGGAGAGGG + Intergenic
1197153563 X:123246059-123246081 CAATATGACCTCACAGAAGGTGG + Intronic
1198987382 X:142471042-142471064 CTGTATGACCTTATAGAAAAAGG + Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic